ID: 1174760891

View in Genome Browser
Species Human (GRCh38)
Location 20:53206465-53206487
Sequence GGGTTAAAACAAATAGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 440
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 419}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174760884_1174760891 28 Left 1174760884 20:53206414-53206436 CCCTTGCTTTTACTTTTCTGACT 0: 1
1: 0
2: 4
3: 64
4: 742
Right 1174760891 20:53206465-53206487 GGGTTAAAACAAATAGAGAAGGG 0: 1
1: 0
2: 1
3: 19
4: 419
1174760885_1174760891 27 Left 1174760885 20:53206415-53206437 CCTTGCTTTTACTTTTCTGACTC 0: 1
1: 0
2: 3
3: 42
4: 490
Right 1174760891 20:53206465-53206487 GGGTTAAAACAAATAGAGAAGGG 0: 1
1: 0
2: 1
3: 19
4: 419

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174760891 Original CRISPR GGGTTAAAACAAATAGAGAA GGG Intronic
900652475 1:3736756-3736778 GGCCTAAAACAAAGATAGAAAGG + Intergenic
902688619 1:18095581-18095603 GGGTTGGAACAGATAGAGGATGG - Intergenic
903232926 1:21932891-21932913 AATTTAAAACAAATAGAGATGGG - Intronic
903314934 1:22495940-22495962 GGGTAAAAACAAACAAATAAAGG + Intronic
903672447 1:25044863-25044885 GGTATAAGACAAATAAAGAAGGG + Intergenic
906744764 1:48213897-48213919 GGGTAGAGACAAAGAGAGAAGGG + Intergenic
906876405 1:49543349-49543371 GGGTTGTAAGGAATAGAGAAGGG - Intronic
907170936 1:52463944-52463966 GGGTTAAAAAAATTACAGAGAGG + Intronic
907296033 1:53455190-53455212 AGGCTAACAGAAATAGAGAAAGG + Intergenic
908361963 1:63377458-63377480 GCTTTCAAACCAATAGAGAAGGG - Intronic
908704190 1:66932560-66932582 GGTTTTAAACAATTAGACAAAGG + Intronic
909241515 1:73220392-73220414 GGGTAAAGACAAATAAAGAAGGG - Intergenic
909383150 1:75024504-75024526 GGGTGACAAAAAATAGGGAATGG + Intergenic
909401725 1:75240248-75240270 AGGTTAAAACAAGTAAACAAGGG - Intronic
909786366 1:79618946-79618968 GGAGAAAAACAAAGAGAGAAGGG - Intergenic
910891151 1:92021513-92021535 AGGTTAAAACAATTAGACATAGG + Intergenic
911533280 1:99071393-99071415 AAGTTAAATCAAAGAGAGAAAGG + Intergenic
911757817 1:101580555-101580577 TGCTTTAAACCAATAGAGAATGG + Intergenic
911970337 1:104427146-104427168 AGGTTAAAACAAAAAGAGATAGG + Intergenic
912092037 1:106090322-106090344 TGGTAAAAACAAATAGATAAAGG + Intergenic
912169843 1:107086267-107086289 GAGTTTACACCAATAGAGAAAGG + Intergenic
912603235 1:110960760-110960782 GGATTCAAAGAAATATAGAAGGG - Intronic
913061707 1:115214487-115214509 GGGGCAAAACAGATAGGGAATGG - Intergenic
913404179 1:118470496-118470518 TTCTTATAACAAATAGAGAACGG - Intergenic
914238325 1:145832721-145832743 GAGTTAAAATAGAGAGAGAAAGG + Intronic
914819491 1:151089794-151089816 AGGTTAAAACAAACAAAAAAAGG - Intronic
917918728 1:179731221-179731243 GGGTTAAAACAAATTGAGACAGG + Intergenic
918291900 1:183116539-183116561 TGGATAAAACAATCAGAGAAGGG - Intronic
918584817 1:186174110-186174132 GTGGTAAAACAAAGAGAGATGGG + Intronic
918800854 1:188969562-188969584 GGGTTTCAAGTAATAGAGAATGG + Intergenic
919196315 1:194291026-194291048 GGGTAAAAAGAAGAAGAGAAGGG + Intergenic
919481120 1:198091286-198091308 AGGATAAAAAAAATTGAGAAAGG + Intergenic
920253716 1:204639752-204639774 GGATTAAAAGAGATAGTGAATGG - Intronic
921341325 1:214137363-214137385 GGGGCATAACAAAGAGAGAAAGG + Intergenic
921489239 1:215753977-215753999 GGGTTAAGCCAAAGACAGAAAGG + Intronic
921523518 1:216188042-216188064 AGGATAAAAAAAATAGAGAGAGG + Intronic
922075927 1:222244564-222244586 AGGGTATACCAAATAGAGAAGGG + Intergenic
922177698 1:223209451-223209473 GGGTAAAAAGAAAAAGAGGAGGG + Intergenic
923848843 1:237770090-237770112 GAGCTAAAACTAATAAAGAAAGG - Intronic
923964119 1:239117304-239117326 AGGCTAAAACACATAGAAAATGG + Intergenic
924466353 1:244302197-244302219 GAGTAAAACCAAATAGAAAAAGG - Intergenic
1063802960 10:9602457-9602479 GGGTTAAAACAAAAAGAACCTGG + Intergenic
1064666812 10:17661599-17661621 GGTTTAAAACAAAAAGAGACAGG - Intronic
1065187160 10:23179424-23179446 GGGTTAAAAAAAAAAAAAAAAGG - Intergenic
1065986654 10:30960522-30960544 CTGCTAAGACAAATAGAGAAAGG - Intronic
1066156660 10:32685143-32685165 GGATTAAAAAAAAGAAAGAAAGG - Intronic
1066307998 10:34165969-34165991 GGGATAATAGAAATAGAGGAAGG - Intronic
1066466357 10:35653767-35653789 GGGTTATAAGAAATAAAAAAGGG + Intergenic
1068300996 10:55138876-55138898 GGGTTTAAAAAAATATACAAAGG - Intronic
1068373382 10:56148269-56148291 GAATTGAAACAAATTGAGAAAGG + Intergenic
1068737209 10:60427669-60427691 GATTTAAAAAAATTAGAGAAGGG + Intronic
1069760055 10:70803628-70803650 GGTTTAAGTCACATAGAGAATGG - Intergenic
1069837817 10:71319999-71320021 GGATTAAAAAATAAAGAGAAAGG - Intronic
1070019837 10:72574002-72574024 GGGGTAAATCAAATATAAAAAGG - Intronic
1070163049 10:73877321-73877343 GGGTTAAAAAAAAAAGACGATGG - Intergenic
1071287368 10:84161465-84161487 GGGGTAAGAAAAATTGAGAAAGG + Intergenic
1071379236 10:85041244-85041266 ATGTTAAGACACATAGAGAAAGG - Intergenic
1071441118 10:85696300-85696322 ACATTAAAAAAAATAGAGAAAGG + Intronic
1072012600 10:91316277-91316299 TGGTTACAAGAAATGGAGAAGGG + Intergenic
1072444877 10:95490329-95490351 GGGAAAAAAAAAAGAGAGAATGG + Intronic
1072889239 10:99307008-99307030 AGGCTAAAACAAGTAAAGAAAGG - Intergenic
1074554868 10:114479083-114479105 AAGTTAAAAGAAAAAGAGAATGG - Intronic
1074748203 10:116557144-116557166 AAGTTAAAATAAATAAAGAAGGG - Intronic
1074950065 10:118325100-118325122 GGGAAAAAACAAGTTGAGAAAGG - Intronic
1075902287 10:126052645-126052667 GGATAAAAACAAAGAGAGGAAGG + Intronic
1077345949 11:2053683-2053705 GGATTATAAATAATAGAGAATGG - Intergenic
1078179377 11:8998018-8998040 GGGGTAAAAGAAAAAGTGAATGG - Intronic
1079516878 11:21280244-21280266 TGGTTATAAAAAATGGAGAATGG + Intronic
1079745174 11:24117870-24117892 GCTTTAAAAAAAAGAGAGAAAGG + Intergenic
1079883882 11:25961492-25961514 GGTTTAAGACTAATAGAGATGGG + Intergenic
1080612395 11:33915794-33915816 GCGATAAAAAAGATAGAGAATGG - Intergenic
1080755265 11:35191200-35191222 GGGTGACAAGGAATAGAGAAGGG - Intronic
1081317621 11:41650185-41650207 GAGGAAAAACCAATAGAGAAAGG - Intergenic
1081322680 11:41710402-41710424 GAGCTAGAAGAAATAGAGAATGG - Intergenic
1081614108 11:44580212-44580234 GGGTGAAAACACAGAGAGATGGG - Intronic
1084776047 11:71376372-71376394 GGGATAAGACAAATAGGGATAGG + Intergenic
1085654928 11:78305379-78305401 GGTATAAAACTAATACAGAATGG + Intronic
1085737576 11:79052596-79052618 GAGTAAAAAGAAATAAAGAAAGG + Intronic
1085802478 11:79603213-79603235 GAGTTAAACCAAATATTGAAAGG - Intergenic
1086003378 11:82006565-82006587 GTGTTAACATAAAAAGAGAAGGG - Intergenic
1086832491 11:91583126-91583148 TGGGTAAAAAAAATAGAGACAGG + Intergenic
1087262537 11:96026817-96026839 GGGTTAAAAAAAAAAAAAAAAGG + Intronic
1087392271 11:97552172-97552194 ACTTTAAAACAAATAGAAAATGG - Intergenic
1087530762 11:99378741-99378763 GGTTTAAAAAAAAGTGAGAAAGG + Intronic
1087808946 11:102589355-102589377 GGGTCAAAACAAAGAGGAAATGG - Intronic
1088639875 11:111861781-111861803 AGTTTAAAAAAAAAAGAGAAAGG - Intronic
1091106824 11:132929112-132929134 GAGATAAACAAAATAGAGAATGG + Intronic
1092467615 12:8747381-8747403 TGTTTAAAAAAAAGAGAGAAAGG - Intronic
1092795670 12:12108177-12108199 GTGTAAAAACAATTAGGGAAGGG + Intronic
1093045321 12:14437053-14437075 GTGTTAAAAGGACTAGAGAAAGG + Intronic
1093206049 12:16251345-16251367 GAGATAAACAAAATAGAGAATGG + Intronic
1093998423 12:25667816-25667838 GGCTTAAAAATAATAGAGCAAGG + Intergenic
1094316588 12:29142730-29142752 AGGTTTAAACAAGTGGAGAAAGG - Intergenic
1095682146 12:44990185-44990207 TGGGTAGAACAAAGAGAGAAAGG - Intergenic
1096188424 12:49599134-49599156 GGGATGAAACAGAAAGAGAAAGG + Intronic
1097162101 12:57054389-57054411 GTCTTAAAAAAAATAGACAATGG + Intergenic
1097289518 12:57902647-57902669 AGGGTAAAACAAACAGAGACGGG + Intergenic
1097628629 12:62032292-62032314 GGGTTGAATGAAATTGAGAAAGG - Intronic
1098094760 12:66943211-66943233 GGGTTAACCCAAAGAGAGAATGG + Intergenic
1099070532 12:78040855-78040877 GGGTCAAAATAAGTAGTGAAGGG - Intronic
1100094774 12:91019919-91019941 ATATTAAAACAAATAGTGAAGGG - Intergenic
1100541036 12:95557561-95557583 GGGTTAAAAAAAAAAGAGTCTGG - Intergenic
1100633275 12:96409260-96409282 GGTTAAAAACAGAAAGAGAATGG + Intergenic
1101604952 12:106241217-106241239 CTGTTAAAACAAACAGGGAAAGG + Intronic
1101724510 12:107377883-107377905 GGATTAAAACAAGTCCAGAATGG - Intronic
1102729485 12:115095648-115095670 GGTTTAAGAAAAATAGTGAAGGG + Intergenic
1102788517 12:115623993-115624015 GGGAAAACACAACTAGAGAAAGG - Intergenic
1105346252 13:19575249-19575271 GGGTTGAAGAAAATAGAAAAAGG + Intergenic
1105776329 13:23664594-23664616 TGGTGAAAACAAATACAGATGGG - Intronic
1106227387 13:27795329-27795351 GCCTTAAAACAAAGAGAGGAGGG - Intergenic
1106920415 13:34557189-34557211 AGGTTAAAGAAAATAGAGAGGGG + Intergenic
1107199791 13:37700589-37700611 ATGTTAAAAGGAATAGAGAAGGG - Intronic
1107265352 13:38546639-38546661 GGGGAAATACAAATATAGAAAGG + Intergenic
1108095091 13:46893210-46893232 GGGTGAAGAAAAATAAAGAAAGG + Intronic
1108237572 13:48424484-48424506 AGGTTCAAACAAGTAGGGAAAGG + Intronic
1109717021 13:66231384-66231406 GGGTAGAAACAAGGAGAGAAGGG + Intergenic
1109746947 13:66636964-66636986 GGGTTAAAAAATATAGAGACTGG + Intronic
1110079721 13:71294975-71294997 AGATTAAAACAAAAAGGGAATGG + Intergenic
1110586131 13:77195735-77195757 GGGTTAGAAGAAGGAGAGAATGG - Intronic
1111613877 13:90640119-90640141 GAGAAAAAAGAAATAGAGAAAGG - Intergenic
1112161607 13:96874181-96874203 GGGTTAAAGCAAGTAGAGTTCGG + Intergenic
1112958335 13:105089688-105089710 GTGGTAACATAAATAGAGAAGGG + Intergenic
1115000210 14:28412848-28412870 TAATTAAAAAAAATAGAGAATGG - Intergenic
1115167195 14:30462360-30462382 GGGTTAAAACAAAAAAAAAGAGG - Intergenic
1115733343 14:36296202-36296224 GGCTAAAAGCAGATAGAGAAAGG + Intergenic
1116483753 14:45421753-45421775 AGGTTTAAACAAATTGTGAAAGG + Intergenic
1116553378 14:46271133-46271155 GGGATAAAAGAAATACAGGAAGG + Intergenic
1116829356 14:49702549-49702571 GGAATACCACAAATAGAGAAAGG - Intronic
1117184775 14:53228604-53228626 GGGTTAAAAAAAAAAGGCAATGG + Intergenic
1118160262 14:63281612-63281634 GGTTTAAAAGGAATAGACAATGG - Intronic
1119065705 14:71524221-71524243 GAGACAAAACAAATACAGAAAGG - Intronic
1119216176 14:72870901-72870923 GGACTAATACAAATAGAGACAGG - Intronic
1119571240 14:75675333-75675355 GGGTTTAAACAAAAATAGCATGG - Intronic
1119591657 14:75894187-75894209 GTGTTCAAACCAATAGAGCAGGG + Intronic
1120266390 14:82256569-82256591 GGGTTTAAAGAAATTCAGAAGGG - Intergenic
1120327057 14:83043479-83043501 GTATTATAACAAATAGATAAAGG + Intergenic
1120541737 14:85759523-85759545 GGGTTAAAAAAACTACAGATTGG - Intergenic
1120561529 14:85999407-85999429 GTCTAAAACCAAATAGAGAATGG - Intergenic
1120680163 14:87471451-87471473 GTGATAACACAAATAGAGACTGG - Intergenic
1121334653 14:93069826-93069848 GGGTAAAAACACATATACAAAGG + Intronic
1121786680 14:96666726-96666748 GGGTTAAAAAAAAAAGATATGGG - Intergenic
1121967484 14:98324059-98324081 TGGTTAAAATAAATGGAGAGCGG + Intergenic
1122183086 14:99970088-99970110 GGGCTTAAACAAATACAGGAAGG + Intergenic
1123700593 15:22912108-22912130 GGGAGAAAACAAAAAGAGAAAGG + Intronic
1124431940 15:29615552-29615574 GGGGTAAGACAAATTGGGAATGG - Intergenic
1124670313 15:31633268-31633290 GGTTTAAAACAAATACAGGGGGG - Intronic
1125129441 15:36264968-36264990 AGTTAAAAACAAATAGAGAATGG - Intergenic
1125348843 15:38746486-38746508 GGGTGAAAACAAAGAGGGATGGG + Intergenic
1125443510 15:39728809-39728831 GGGTAAACACAATTACAGAATGG + Intronic
1125733252 15:41906220-41906242 GTGTAAAAACAATTAGGGAAGGG - Intronic
1127183340 15:56449584-56449606 TGATTAAAACAAATTGGGAAGGG + Intronic
1127541394 15:59942242-59942264 GGCTTACATCAAAGAGAGAATGG + Intergenic
1128029015 15:64462730-64462752 GAGTTAAAATAAATATTGAAAGG - Intronic
1129494529 15:75965351-75965373 GGGTTTATGCAAATAGAAAAAGG + Intronic
1130646008 15:85727790-85727812 AGATTAAAACAAGGAGAGAAAGG + Intronic
1130732643 15:86514705-86514727 GGGGTATAACAAACAGAGAATGG - Intronic
1130789763 15:87141512-87141534 GGTTAAAAAAAAATAGAAAAAGG - Intergenic
1131295273 15:91142638-91142660 GGGATAAAACTAATAGAATAGGG - Intronic
1133629141 16:7602424-7602446 GGCTTACAACAAAAGGAGAATGG - Intronic
1133997206 16:10757561-10757583 GGGTTGTCACAAATAGAGTAGGG - Intronic
1134309784 16:13065290-13065312 GGTTTGAAAGAAAAAGAGAAAGG - Intronic
1135044793 16:19146378-19146400 GGATTTAAAGAAAAAGAGAATGG + Intronic
1138804707 16:60079663-60079685 GGGTAGAGACAAGTAGAGAAGGG - Intergenic
1140476880 16:75243453-75243475 AAGTTAAAACAAATAGCAAATGG + Intronic
1140524470 16:75611152-75611174 GGGTTAAAAAACATATATAATGG + Intronic
1141093425 16:81146238-81146260 GATTGAAAACGAATAGAGAAAGG + Intergenic
1142829184 17:2534888-2534910 TGATTAAAAAAAATAGAGATAGG - Intergenic
1143942361 17:10555916-10555938 GCGTTAAAATCAATGGAGAATGG - Intergenic
1145871747 17:28279473-28279495 GGTTCAAAGCAAATAGAGATTGG - Intergenic
1149008341 17:51829102-51829124 GGGATAAAACAAAAAAACAAAGG + Intronic
1150789433 17:68189664-68189686 GCGTTAAAATAAATAGGGATGGG + Intergenic
1150860341 17:68794945-68794967 GTGTTAAAAAAAATTCAGAATGG - Intergenic
1151691084 17:75685863-75685885 GGGATAAGACAAAAAGGGAATGG + Intronic
1151844466 17:76642574-76642596 GAGTTAAAAAAAATACAGAAAGG - Intronic
1151919990 17:77147204-77147226 TGGTTAAAACAAACAAACAAAGG - Intronic
1152373646 17:79906271-79906293 AGGTTACCACACATAGAGAAAGG - Intergenic
1153923100 18:9808600-9808622 GGATTCAAACAAAGAGAGAAGGG - Intronic
1154390220 18:13930435-13930457 GATTAAAAACAACTAGAGAATGG + Intergenic
1155593015 18:27449685-27449707 ATTTTAAAACAAATAGAGGAAGG + Intergenic
1156741635 18:40337515-40337537 GGCTTAAAACAAATGAAGCATGG + Intergenic
1156817932 18:41334353-41334375 GGGTTAAAAAAAAATGGGAAAGG + Intergenic
1158876951 18:61743050-61743072 GGGGTAAAGCAAGGAGAGAATGG + Intergenic
1159204114 18:65227995-65228017 GGACTAAAAAAAAGAGAGAAAGG - Intergenic
1159407477 18:68023529-68023551 GGGTTAAATGAAATATACAATGG - Intergenic
1159446572 18:68548006-68548028 AGGTTAAAAAAAATTGACAATGG - Intergenic
1160364421 18:78312351-78312373 GGGAAAAAAGAAATTGAGAAGGG + Intergenic
1162146550 19:8615783-8615805 TGGTTTAAATAAAAAGAGAATGG - Intergenic
1163310662 19:16512572-16512594 GGGTAAAAAAAAGTAAAGAAGGG + Intronic
1165200265 19:34137918-34137940 AAATTAAAAAAAATAGAGAAGGG - Intergenic
1165577912 19:36837604-36837626 GAATTAAAAAAAATAGAAAAGGG - Intronic
1167483046 19:49744995-49745017 GGGTGGAATCAATTAGAGAAGGG - Intronic
1167851820 19:52207984-52208006 AGGTTATAAGAAATAGAAAATGG + Intronic
1168011125 19:53533929-53533951 AGATTAACACAAATATAGAATGG + Intronic
1168537794 19:57185872-57185894 AGATTAAAAAAAATAGAGATGGG - Intergenic
925085474 2:1104574-1104596 GGGAAAACACAAATGGAGAAAGG + Intronic
925334987 2:3090514-3090536 GAGATAAATGAAATAGAGAATGG + Intergenic
926780416 2:16466055-16466077 GGGTGAAAGCAAGTTGAGAAAGG - Intergenic
926815785 2:16796769-16796791 GGGTAGAAACAAGGAGAGAAGGG + Intergenic
926903087 2:17778771-17778793 GGGTTAAAAAAAAAAAGGAAAGG - Intronic
927503673 2:23599086-23599108 GGGGCAAGAGAAATAGAGAATGG + Intronic
929313169 2:40448828-40448850 GGGCAAAAACAAAAAGATAAAGG + Intronic
929314951 2:40465881-40465903 GGATTAACACCAATATAGAACGG + Intronic
929595748 2:43174578-43174600 GAATCAAAACAAACAGAGAAGGG + Intergenic
929679156 2:43971170-43971192 GGGATAAAATACATAAAGAAGGG - Intronic
930807378 2:55504458-55504480 GGGTTATCACATATAGACAAAGG - Intergenic
930850014 2:55950582-55950604 GGATTAAGACAAAGAGAGCAGGG + Intergenic
930979318 2:57503477-57503499 GGATTAAAGGAAATAGAAAATGG + Intergenic
931083993 2:58808445-58808467 GGGTTGGAACATACAGAGAAAGG - Intergenic
931363397 2:61597849-61597871 GTGTTAAAACCAGTGGAGAAAGG + Intergenic
931626929 2:64264842-64264864 GTGTTCAAACAAACAGAGGAAGG - Intergenic
933151558 2:78921578-78921600 GGGTTATAAACAATAGAGAGTGG - Intergenic
933254158 2:80061406-80061428 TGTTTAAAACAAACAGAAAACGG - Intronic
933977256 2:87521458-87521480 GGATTAAGACACATAGAGACTGG - Intergenic
934032111 2:88057214-88057236 GTGTGATAATAAATAGAGAAAGG - Intergenic
938183722 2:129208480-129208502 GGGTTGAAACACCAAGAGAACGG + Intergenic
938401939 2:131000778-131000800 GCTTTAAAATAAGTAGAGAAAGG + Intronic
939120090 2:138105869-138105891 GGGTTGAAGCAAATTGAGCAGGG - Intergenic
939343526 2:140931882-140931904 TGGTTAATACAAACAGTGAATGG - Intronic
939351047 2:141037723-141037745 GGATTCAAACAATAAGAGAATGG + Intronic
939848099 2:147272013-147272035 TGGATAGTACAAATAGAGAAAGG - Intergenic
940877992 2:158917692-158917714 GTGGTAAAACACATAAAGAAAGG + Intergenic
940886807 2:158997231-158997253 AGGGTTAAACAAATAGTGAAGGG + Intronic
941453283 2:165686084-165686106 GGGAGAAAACCAAAAGAGAAAGG - Exonic
941735357 2:168969112-168969134 GGGTTAAAAAAAAAAAAAAAGGG + Intronic
942121516 2:172782489-172782511 GGGTTGAAAGAGTTAGAGAAGGG - Intronic
943061420 2:183045074-183045096 GGGTAAAGACACAGAGAGAAGGG - Intergenic
943260943 2:185662960-185662982 TGGATAGAACAAAAAGAGAAAGG - Intergenic
943380906 2:187146218-187146240 TGGATAGAACAAATAGACAAGGG + Intergenic
944929492 2:204501709-204501731 GTGTAAAAGAAAATAGAGAAGGG - Intergenic
945234396 2:207621415-207621437 GGGTTAAATCAGATAGTGTATGG + Intronic
948125062 2:235558520-235558542 GGGTTAAAGCAGAAAGGGAAAGG - Intronic
1169872096 20:10258856-10258878 GGGTAACAAAAAATAGAAAAAGG - Intronic
1169977905 20:11351497-11351519 GGACTAAAACCAACAGAGAAAGG - Intergenic
1170387277 20:15832949-15832971 TGGTTAAAACAATCAGAGAAGGG - Intronic
1173044551 20:39497230-39497252 AGGTTAAAAGAAACAAAGAATGG + Intergenic
1173046251 20:39515642-39515664 GAGACAAAACAAATTGAGAAAGG + Intergenic
1173416512 20:42861292-42861314 GGGTTTAATGAAATAGAGATTGG - Intronic
1173444923 20:43109067-43109089 GGGGAAAAAAAAATAGAAAATGG - Intronic
1174760891 20:53206465-53206487 GGGTTAAAACAAATAGAGAAGGG + Intronic
1174780196 20:53382441-53382463 TGGTTAAAAGAACTGGAGAAGGG + Intronic
1177327751 21:19614161-19614183 GTGTTAATCAAAATAGAGAATGG + Intergenic
1177751419 21:25288873-25288895 GGGTTAAAACAAATAGTTAGTGG - Intergenic
1178060320 21:28846623-28846645 AGGTTAAAAAAAATTGACAAAGG - Intergenic
1178422948 21:32456712-32456734 TGGTTAAAACAAAAACAAAAAGG - Intronic
1179279447 21:39922021-39922043 GACTTAAAAAAAATAGAGACAGG + Intronic
1179393378 21:41014417-41014439 GGATTAAAACAGAAAGAGCATGG + Intergenic
1179441279 21:41396126-41396148 GAGGTCAAACAAATAGTGAATGG + Intronic
1180168639 21:46044596-46044618 AGATTAAAAAAAATAGAGACAGG - Intergenic
1180672770 22:17566098-17566120 TGGTTCAAAAAAATAGAGATCGG - Intronic
1181821738 22:25481395-25481417 TGTTTAAAACAAATAGGGGAAGG - Intergenic
1182057068 22:27367348-27367370 GCGTTAAATAAAAGAGAGAAGGG - Intergenic
949115802 3:321223-321245 CTGTTAAAAATAATAGAGAAGGG - Intronic
950444621 3:13029360-13029382 GGGTTAATACAGATAGAACATGG + Intronic
950935308 3:16833514-16833536 GGGTAACAAGAAATTGAGAATGG - Intronic
952628356 3:35435087-35435109 GGGTTAATACAAATAGTTGAAGG + Intergenic
952882309 3:37992452-37992474 GAGTGAAAATGAATAGAGAAGGG - Intronic
953181064 3:40595782-40595804 GGGTAAAAAAAAAAAAAGAAAGG + Intergenic
953237309 3:41117990-41118012 GGGTAAACACAATTAGAGCATGG + Intergenic
953440814 3:42915424-42915446 GGGTTACAGCAAATTGTGAATGG - Exonic
953628312 3:44589186-44589208 GGGTTAAAAAGAAAAGAGGAAGG - Intronic
955076786 3:55621384-55621406 GGGTGACAACAAAGAAAGAACGG + Intronic
955150161 3:56359254-56359276 GGGTGACAAGAAGTAGAGAAAGG - Intronic
955644001 3:61117148-61117170 AGATTAATACAAATAGAAAATGG + Intronic
959366711 3:105469420-105469442 GGTTTAAAAGAAATAGAGTTTGG - Intronic
959506600 3:107163482-107163504 AGGTTAAAAAAAAAAGACAAAGG + Intergenic
960015853 3:112886585-112886607 GTGTTAAAAAAAAAAGACAAGGG - Intergenic
960196864 3:114779168-114779190 GTGTTAAAGCAAATAGAACAAGG - Intronic
960222797 3:115134923-115134945 GGCTAAAAAGAAATAGAGATAGG - Intronic
961004819 3:123397870-123397892 GGGTGAAAACAGACAGTGAAGGG + Intronic
962051962 3:131825596-131825618 GGGTAAATAGAAAAAGAGAAGGG + Intronic
962151461 3:132897777-132897799 GGGTTAAAGAAAATAGAAACTGG + Intergenic
963376945 3:144479352-144479374 GGGAGAAAACAATAAGAGAAAGG - Intergenic
963747590 3:149141268-149141290 GGGTTTAAAAAGACAGAGAAAGG - Intronic
964205003 3:154164323-154164345 TCCTTAAAACAATTAGAGAATGG - Intronic
964331135 3:155604588-155604610 GGTTTAATACAAATAGAAAAAGG - Intronic
964866668 3:161269906-161269928 GGCTGAAAAAAAAAAGAGAAAGG - Intergenic
965095752 3:164222995-164223017 AGGCTAAAACAGATAGAAAAAGG - Intergenic
965841053 3:172906159-172906181 GGCTTAAAGTAAATAGAAAAAGG - Intronic
966083807 3:176041364-176041386 GGATTAAAACAGACAGAGAGGGG + Intergenic
966402054 3:179557468-179557490 GGATCAGAAAAAATAGAGAAGGG + Intergenic
966505321 3:180694322-180694344 GGGTTAAAAGAAAATAAGAAAGG - Intronic
967281380 3:187827262-187827284 GGGTAGAAGAAAATAGAGAATGG - Intergenic
967488554 3:190062221-190062243 GGGTTGAAGCAAATAAGGAAGGG - Intronic
967776678 3:193392699-193392721 TGGTTAAGAGAGATAGAGAAGGG - Intergenic
971226657 4:24759877-24759899 GGGGTAGAAATAATAGAGAATGG + Intergenic
971668358 4:29523125-29523147 GGCTGAAAATAAATAGAGGAGGG - Intergenic
971714858 4:30162940-30162962 TGGTTTAAAAGAATAGAGAAGGG + Intergenic
973087625 4:46087154-46087176 TCTTTAAAAAAAATAGAGAAAGG - Intronic
973175808 4:47203610-47203632 GTGTTAAAACAATTACTGAAAGG - Intronic
973275082 4:48298754-48298776 CTACTAAAACAAATAGAGAAAGG - Intergenic
973807929 4:54543514-54543536 GGATTAAAACACATAAATAAAGG - Intergenic
974095480 4:57359317-57359339 CTGTTAAGAGAAATAGAGAATGG + Intergenic
975366058 4:73529152-73529174 GTGTTTCAACAAATAGAGCATGG - Intergenic
975576380 4:75867073-75867095 GGGTGAAAACAAATAGAGTCAGG - Intronic
975809698 4:78154386-78154408 GGTTTTAAACAAATAGACCAAGG - Intronic
976322902 4:83735980-83736002 GGAGGAAAAAAAATAGAGAAAGG - Intergenic
976672166 4:87665764-87665786 TGGTTAGAACAAAAACAGAAGGG + Intergenic
977305038 4:95313087-95313109 GGGTTTAAAGATTTAGAGAAAGG + Intronic
977400921 4:96531012-96531034 GGGACAAAAGAAATATAGAAAGG + Intergenic
977461895 4:97336770-97336792 AGCCTAAAAGAAATAGAGAATGG + Intronic
977513210 4:97988314-97988336 AGGTTAAAAAAAGCAGAGAAGGG - Intronic
977609422 4:99016941-99016963 GGGCTAAAGAAAATACAGAAGGG - Intronic
977861586 4:101967472-101967494 AGATTTAAACAAATTGAGAAAGG + Intronic
978358015 4:107898256-107898278 GGGTCAAAAAAAAAATAGAAGGG - Intronic
979056812 4:116005778-116005800 GTGTTTAAACAAAAACAGAAAGG - Intergenic
979076430 4:116276399-116276421 ATGTTAAAGCAACTAGAGAAAGG + Intergenic
980522000 4:133947608-133947630 GGGTAAAAAGAAAAAGAGAAGGG - Intergenic
980563202 4:134503620-134503642 GGGTTTGAACAAAGAGACAAAGG - Intergenic
982515520 4:156343593-156343615 TGGTTGAAACAAAGAGATAAAGG + Intergenic
982741604 4:159062527-159062549 GAGTTAAAAGAAAGAGTGAATGG - Intergenic
983143434 4:164183101-164183123 GTGATCAAACAATTAGAGAATGG - Intronic
983381380 4:166998850-166998872 GGGTGAAATAAAAAAGAGAAGGG - Intronic
983427651 4:167607903-167607925 GGCTTAAAACATAAAGAAAAAGG - Intergenic
983601296 4:169532401-169532423 GGATTTAAACAAATATATAATGG - Intronic
983664253 4:170164907-170164929 GGGGAAAAAAAAATAGAAAATGG - Intergenic
984019861 4:174471952-174471974 AGATTGAAACAAAAAGAGAAAGG - Intergenic
984219854 4:176960632-176960654 AGATCAAAAGAAATAGAGAAAGG + Intergenic
984287896 4:177757025-177757047 AGGTTAAATCAAATATATAACGG + Intronic
984448229 4:179865794-179865816 TGGGTAAGACAAATGGAGAAAGG + Intergenic
984559512 4:181252064-181252086 GGGTTTAAACAAGTAGATGATGG - Intergenic
986487846 5:8258138-8258160 AGATTCAAACAAATAAAGAAAGG - Intergenic
987031455 5:13980279-13980301 GGGTTAGAATGAATGGAGAAGGG - Intergenic
987787887 5:22525663-22525685 AGGTGAAAACAAAGAGAGATGGG - Intronic
987947278 5:24627744-24627766 GTGTTAAAGCAAATAAATAAAGG - Intronic
988104190 5:26722396-26722418 GAGTTAAAACAGATAGAAATAGG - Intergenic
988570918 5:32364997-32365019 GGGCTAAAAGAAAGGGAGAATGG - Intronic
990446821 5:55901008-55901030 AGGTGTAAGCAAATAGAGAAAGG - Intronic
990479678 5:56198042-56198064 GTAATAAAACAAATAAAGAAGGG - Intronic
991178693 5:63722390-63722412 GAAGTAAATCAAATAGAGAATGG + Intergenic
992341452 5:75827968-75827990 GGGTGAAAGCAAATAAGGAAAGG - Intergenic
993880961 5:93360314-93360336 GGGTTAAAAAAAATTGAGGAGGG + Intergenic
995173161 5:109141223-109141245 GGCTTATAAAAAATTGAGAAAGG - Intronic
996146270 5:119980841-119980863 GGGGGAAAACCAAGAGAGAATGG + Intergenic
996719855 5:126619225-126619247 GGGTTAAAAAGAATAAAGGAGGG - Intronic
997414848 5:133718627-133718649 GGGAAAAAGGAAATAGAGAAAGG + Intergenic
998291519 5:140919498-140919520 GAATTAAAACATATAGAAAAAGG - Intronic
1000010352 5:157225462-157225484 GGGTTAAAAAAAAAAAAGAGGGG + Intronic
1000454041 5:161426953-161426975 GGGTTGAAAGAATGAGAGAATGG + Intronic
1004855086 6:19741437-19741459 GGGTGAAAGAAAGTAGAGAAGGG - Intergenic
1007190156 6:40008464-40008486 GGGTTTAAAAAAATAGAATAAGG - Intergenic
1007920946 6:45609033-45609055 GGGTTAAAAAAAAAAAAAAAGGG - Intronic
1008147488 6:47909132-47909154 GGGTCAAAATAAATCTAGAAGGG + Intronic
1008472814 6:51902699-51902721 GGGATAAAATAATTAGAAAAGGG + Intronic
1009885458 6:69618844-69618866 GGGTAAAAAGAAAAAGAGGAGGG - Intergenic
1010233928 6:73559319-73559341 GGGGTAAAAAAAAGAAAGAAAGG - Intergenic
1010564955 6:77399498-77399520 GGGTTAAAGGAAGTAGGGAATGG + Intergenic
1010999226 6:82568777-82568799 TGCACAAAACAAATAGAGAATGG + Intergenic
1011446158 6:87443263-87443285 GAGTTTAAACAAATAGTAAAAGG - Intronic
1011484578 6:87828830-87828852 AGGATAAAATAAGTAGAGAAGGG - Intergenic
1011612093 6:89162493-89162515 GGGTAAAAAAAAAGAAAGAATGG - Exonic
1012545025 6:100409521-100409543 GGAGTAAATGAAATAGAGAATGG - Intronic
1014502136 6:122204486-122204508 GGGTTAAAGCGGAGAGAGAATGG - Intergenic
1015720970 6:136241681-136241703 GGGTGAAAAAAAATAGGAAATGG + Intronic
1015937264 6:138416161-138416183 GGGTTTATACAACTAGATAAAGG + Exonic
1016090314 6:139969993-139970015 GGGAGAAAACAAATAGTAAATGG + Intergenic
1016199100 6:141385982-141386004 AGTTTGAAATAAATAGAGAAAGG + Intergenic
1016383327 6:143507670-143507692 GTCTTAAAAAAAAGAGAGAATGG - Intronic
1017262725 6:152405921-152405943 GGGTAAAGAGAAATAGAGTAAGG - Intronic
1019860075 7:3650053-3650075 AGTTTAAAAAAAATAGAGATAGG + Intronic
1021958948 7:25853116-25853138 GTGTTTAAACAAATGGAGATGGG - Intergenic
1022027819 7:26465156-26465178 GGGTTAAATGAAATGAAGAATGG - Intergenic
1022578483 7:31523128-31523150 GTGTTAAGACAAATTTAGAAAGG - Intronic
1022871380 7:34483405-34483427 GGGTTAAAAGACATAGCTAATGG + Intergenic
1026298378 7:69076110-69076132 GGGTTAAAACACATGCAAAATGG - Intergenic
1026629567 7:72026585-72026607 GGGAAAAAAAAAATAGAGAGGGG + Intronic
1026839942 7:73664793-73664815 GGGCTAAAATAAATGGTGAAAGG + Intergenic
1027379410 7:77590537-77590559 GATTTAAAAAAAATAGAGATGGG - Intronic
1028485540 7:91353596-91353618 GGAAAAAAAAAAATAGAGAAAGG - Intergenic
1030669557 7:112320631-112320653 AGGTTAAAACAAACAATGAAGGG - Intronic
1031465298 7:122102594-122102616 GTATTAAAATAAATAGAAAATGG + Intronic
1031567061 7:123313525-123313547 CTGATAAAACAAATACAGAATGG - Intergenic
1032099697 7:128963834-128963856 GGGTAAAATCAGATATAGAAGGG - Intronic
1032210502 7:129909958-129909980 GGTTGAAAACAAATATAGAGGGG + Intronic
1033894129 7:146051514-146051536 GGGTAAAAAGAAAAAGAGGAAGG - Intergenic
1034009413 7:147512096-147512118 GGGTGAAAACATATACAGCATGG + Intronic
1035194888 7:157209582-157209604 GGGTTTAATCAAATATTGAAAGG - Intronic
1035986369 8:4436620-4436642 GGATTAAAAAAAATAGAAGAAGG - Intronic
1036056553 8:5261545-5261567 TTGTTAGAACAAATAGAGAGTGG - Intergenic
1036809700 8:11859130-11859152 GGGTTAAAAAAAACAGAAAAGGG + Intronic
1037261343 8:17012269-17012291 GGGAGAAGAGAAATAGAGAAAGG + Intergenic
1037262420 8:17023764-17023786 AGGTTAAAATAATTAGATAAAGG + Intergenic
1037473033 8:19229288-19229310 GCGTAAAAACAATTAGGGAAGGG + Intergenic
1039139613 8:34371729-34371751 GGGTAAAAACAAATGTAAAACGG + Intergenic
1039271036 8:35880737-35880759 GGTTTAAAAAATGTAGAGAAAGG - Intergenic
1040047318 8:42976873-42976895 GGGACAAAACAAAGAAAGAATGG + Intronic
1040924251 8:52660204-52660226 GTGTGAAAAGAAATATAGAAGGG + Intronic
1041359367 8:57035673-57035695 GGGTTAAAAAGTAAAGAGAAGGG - Intergenic
1041899322 8:62963656-62963678 GGATTTAAACTAAAAGAGAAAGG - Intronic
1044112863 8:88297929-88297951 GGAAGAAAACAATTAGAGAAAGG + Intronic
1044123043 8:88421946-88421968 GGGTAAAAACAAGGAGGGAAAGG - Intergenic
1044208878 8:89525539-89525561 GGGTTAAAAAAAAAAAAAAATGG + Intergenic
1044392536 8:91668870-91668892 GTGTTAGAAAAAAGAGAGAATGG + Intergenic
1046256857 8:111710868-111710890 AGGACCAAACAAATAGAGAAAGG + Intergenic
1046515688 8:115256770-115256792 GGGTGAAAACAAATACAAATTGG - Intergenic
1046529569 8:115426085-115426107 GGGTGAAAACACATACAGGATGG - Intronic
1046671252 8:117058881-117058903 AGGTTAAAACAAAGACTGAAAGG + Intronic
1050256654 9:3799402-3799424 GGGGTAAAAGATATAGAAAATGG + Intergenic
1050689264 9:8206966-8206988 GGCTTATAACACATTGAGAATGG + Intergenic
1050820303 9:9871465-9871487 GGGTGAAAACCAAGAGAGATTGG + Intronic
1051130978 9:13860662-13860684 GGGATATAACAAACAGAAAACGG - Intergenic
1051719917 9:20026204-20026226 GTGGTAAAAAAAATAGGGAATGG + Intergenic
1052155028 9:25176153-25176175 GAGTTCTAACAAATAGAGGATGG + Intergenic
1053043613 9:34895212-34895234 GGGTGAAAAAGAATACAGAAAGG - Intergenic
1053123480 9:35562278-35562300 GGGTTGAAACTAATAGATATGGG - Intronic
1053358067 9:37463991-37464013 GGGTTAAAAGGAAGAGTGAACGG + Intronic
1053491781 9:38512324-38512346 TGTTTAAAATAAATATAGAAGGG + Intergenic
1054891676 9:70258741-70258763 GAGTTAAAACAAAAAAAAAAAGG + Intergenic
1054963734 9:70998555-70998577 GGGTTTAGACAAATCTAGAATGG + Intronic
1055410018 9:76018968-76018990 GTGTTAAAACTAAAACAGAAAGG - Intronic
1055566626 9:77575723-77575745 GACTTAAAACCAATAGAAAATGG - Intronic
1056332870 9:85536079-85536101 GGATTATAACATATAGGGAAAGG - Intergenic
1056473623 9:86930474-86930496 TGGTTATAAGAAACAGAGAAGGG + Intergenic
1056522185 9:87411702-87411724 GGGTAGAGACAAAGAGAGAAGGG - Intergenic
1056700048 9:88895853-88895875 GTCTTAAAACAAATAAATAATGG - Intergenic
1057672077 9:97101526-97101548 TGTTTAAAATAAATATAGAAGGG + Intergenic
1057686432 9:97238584-97238606 GGGATAAAATAAATAGCAAAGGG - Intergenic
1057880205 9:98787371-98787393 GGGTTAAAAAAAAAAAAAAAAGG - Intronic
1057941737 9:99290943-99290965 TGGTTTAAAAAAAAAGAGAATGG - Intergenic
1058364657 9:104194771-104194793 GGTTTAAATAAAATAGAAAATGG - Intergenic
1058798725 9:108523806-108523828 AGGTTAAAATAAATAAATAAGGG + Intergenic
1059233922 9:112746291-112746313 AGGTTAAAAGAGAGAGAGAAAGG + Intergenic
1059808276 9:117828212-117828234 GGGTAAAGAGAAATTGAGAAAGG + Intergenic
1059991970 9:119874173-119874195 GCTTTAAAGCAAATAAAGAAGGG - Intergenic
1186625553 X:11289521-11289543 GGGAGAAAAAAATTAGAGAAGGG + Intronic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1187655534 X:21467457-21467479 GTGTTAAAACAAATCAAGAAAGG - Intronic
1187840616 X:23483371-23483393 TCATTAAAACAAATACAGAACGG - Intergenic
1189048456 X:37618337-37618359 GTGGTAAAACAACTAGAGGAAGG + Intronic
1189591578 X:42517986-42518008 GTGTGTAAAAAAATAGAGAAGGG - Intergenic
1189796483 X:44650736-44650758 GGATTAAAAGAAATGGAGAGAGG + Intergenic
1190130714 X:47746295-47746317 AAATTAAAAAAAATAGAGAAGGG - Intergenic
1190934138 X:54979511-54979533 GATTTAAAACAAATAAAGCATGG + Intronic
1193106599 X:77682143-77682165 GGCATAAAACAAATTAAGAATGG - Exonic
1193878044 X:86886323-86886345 GGGTTTAAACAAATGTATAAGGG - Intergenic
1194208884 X:91044697-91044719 AGGTTAAAAAAAATAAACAATGG + Intergenic
1195395954 X:104410838-104410860 AGATTAGAACAAAGAGAGAAAGG - Intergenic
1197256151 X:124265420-124265442 GGGTTAGAAAAAATTCAGAATGG - Intronic
1198257170 X:134933947-134933969 GGGTTAAAAGATATAGGAAAGGG - Intergenic
1198624063 X:138549067-138549089 GTGTTAAAAAAAAAAGAGATCGG + Intergenic
1201297642 Y:12478010-12478032 TGGTTACAACAAGTAGAGATGGG - Intergenic