ID: 1174764540

View in Genome Browser
Species Human (GRCh38)
Location 20:53240299-53240321
Sequence CAGCGCCCACACATAGACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 78}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174764536_1174764540 19 Left 1174764536 20:53240257-53240279 CCTAAATAGGATGCTACGGCAAG 0: 1
1: 0
2: 1
3: 3
4: 58
Right 1174764540 20:53240299-53240321 CAGCGCCCACACATAGACCTGGG 0: 1
1: 0
2: 0
3: 9
4: 78
1174764534_1174764540 28 Left 1174764534 20:53240248-53240270 CCTGAATAACCTAAATAGGATGC 0: 1
1: 0
2: 0
3: 10
4: 177
Right 1174764540 20:53240299-53240321 CAGCGCCCACACATAGACCTGGG 0: 1
1: 0
2: 0
3: 9
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174764540 Original CRISPR CAGCGCCCACACATAGACCT GGG Intronic
901681620 1:10916092-10916114 CAGCGCCTACAAATTCACCTGGG - Intergenic
924358078 1:243205251-243205273 CAGTGCCCACACATAGGGCCAGG + Intronic
1070736630 10:78867693-78867715 CAGTGCCCACAGACAGTCCTAGG + Intergenic
1070823860 10:79379753-79379775 CAGCTCCCGCACACAGCCCTGGG - Intergenic
1074289537 10:112128031-112128053 CAGCTCCCACAGATACACCTGGG + Intergenic
1084942321 11:72619531-72619553 CAGTGCACACACATAGACACAGG - Intronic
1090186256 11:124740749-124740771 CAGCGCCCACGCGGAAACCTGGG + Intronic
1095070089 12:37831684-37831706 AAGCGCCCACAAATATCCCTTGG - Intergenic
1104917970 12:132275885-132275907 CAGCTCCCACACACACACCTGGG - Intronic
1105330994 13:19415060-19415082 CAAGACCCAGACATAGACCTGGG + Intergenic
1105435756 13:20376878-20376900 CAGCGACACCACATAGGCCTGGG - Intergenic
1106589778 13:31089336-31089358 CAGTGCCCACACACACAGCTCGG - Intergenic
1108048190 13:46403151-46403173 CAGGGCCCACAGAGAGCCCTTGG - Intronic
1119731358 14:76953408-76953430 CCTCGCCCACACCTATACCTTGG + Intergenic
1122270463 14:100566658-100566680 CACCGCCCCCACCTGGACCTTGG + Intronic
1124260164 15:28182440-28182462 CAGGCCCCACACAAACACCTTGG + Exonic
1126866905 15:52946719-52946741 GAGGGCCCACACTTAGGCCTTGG + Intergenic
1129810772 15:78507936-78507958 CAGCGACCCCACACAGACCCGGG - Intronic
1135538298 16:23311493-23311515 CAACCTCCACACATAGACGTAGG - Intronic
1139589457 16:67925562-67925584 CTGCGCCCACCCACAGCCCTTGG + Intronic
1140776168 16:78250619-78250641 CAGAGCCAACAGATAGACATGGG + Intronic
1141616476 16:85212592-85212614 CCCTGCCCACACATTGACCTTGG + Intergenic
1142595461 17:1027641-1027663 CAGGACCCACACATAGGCCCAGG + Intronic
1143315124 17:6026627-6026649 AAGCGTCCCCACATAGACCCCGG - Intronic
1143782768 17:9238076-9238098 CTGCACCCACACATGGACCAGGG - Intronic
1147705369 17:42422034-42422056 CCGCGCCCCCACATCGGCCTCGG - Intronic
1148183078 17:45620609-45620631 CAGCGCCCACTCGTAGGCCTGGG + Intergenic
1148265773 17:46225082-46225104 CAGCGCCCACTCGTAGGCCTGGG - Intronic
1152815079 17:82403107-82403129 CAGAGACAACACAGAGACCTGGG + Intronic
1153662092 18:7333943-7333965 CAGGGACCACACATACACCCAGG + Intergenic
1156401498 18:36744189-36744211 CAGCGTCCACAGACATACCTTGG - Exonic
1159180253 18:64893315-64893337 GAGCCCCCACACAGAGTCCTAGG - Intergenic
1162967998 19:14164903-14164925 CAGAACCCACACATAGGCCAGGG + Intronic
925083837 2:1092075-1092097 CAGCCCCCTCACATAGCCCCAGG + Intronic
926118934 2:10230568-10230590 CAGTGACCACACAGAGACCCAGG - Intergenic
927062746 2:19439892-19439914 CAAAGCACACACATAGACCCAGG + Intergenic
928364683 2:30691889-30691911 CAGCCCCCACTCAGAGGCCTTGG + Intergenic
929596702 2:43180573-43180595 CAGGCCCCACACAAAGAGCTTGG - Intergenic
932698768 2:73978795-73978817 CAGCGCCCACAGAGAGACCCAGG - Intergenic
932776499 2:74531034-74531056 CAGCGTCCAGCCAGAGACCTGGG + Exonic
934639693 2:96020263-96020285 CAGCACCCACACAGAGTCCTCGG + Intergenic
934793953 2:97085114-97085136 CAGCACCCACACAGAGTCCTCGG - Intronic
936861930 2:117029465-117029487 CAGAGCACACACAGAGACCCAGG + Intergenic
1170139903 20:13115299-13115321 CAGGGCACACACAGAGTCCTAGG - Intronic
1174398872 20:50265052-50265074 CAGGACTCACACAAAGACCTGGG + Intergenic
1174764540 20:53240299-53240321 CAGCGCCCACACATAGACCTGGG + Intronic
1175777817 20:61664037-61664059 CAGCCCCCACACAATGCCCTTGG - Intronic
1179479823 21:41670044-41670066 GAGCTCCCACACATGGACTTGGG + Intergenic
1180597841 22:16990568-16990590 CACAGCCCACACATACAACTGGG - Intronic
961452376 3:127008209-127008231 CAGCCCCCACACAGAGGCCCAGG - Intronic
963122065 3:141784568-141784590 CAGCTCCCACACATATAATTGGG + Intronic
966489994 3:180516924-180516946 CAGAGGACACACACAGACCTGGG + Intergenic
969540837 4:7787935-7787957 CAGCACCCACGCGGAGACCTGGG - Intronic
970446597 4:16128158-16128180 CAGCGCCCACATCTCGACTTAGG + Intergenic
973614439 4:52664602-52664624 CATCTCCCACACTCAGACCTAGG + Intergenic
975779205 4:77820548-77820570 CAGCGCCCACACAAGAACCCGGG - Intergenic
979243735 4:118474231-118474253 CAGTGCCCACACATAGGGCCAGG - Intergenic
979286613 4:118932835-118932857 TAGGGACCACACATAGTCCTTGG - Intronic
985685805 5:1280899-1280921 GAGCGGCCACACCTGGACCTGGG + Intronic
987402832 5:17495714-17495736 CAGCTCCCAGACCAAGACCTGGG + Intergenic
987942944 5:24565777-24565799 CCACACCCACACATACACCTTGG + Intronic
988702159 5:33686171-33686193 CAGTGCCCTCACAAAGCCCTTGG + Intronic
990187523 5:53224003-53224025 CATCACCCTCACAGAGACCTGGG - Intergenic
992225858 5:74619271-74619293 CAGTGCCCACCCAGGGACCTTGG + Intergenic
995490784 5:112689669-112689691 TGGAGCCCACACACAGACCTGGG - Intergenic
999351008 5:150871855-150871877 CAGAGCCCACACTTAATCCTGGG - Intronic
1000363132 5:160466637-160466659 CAGAGCCCACTCAGATACCTGGG + Intergenic
1005507783 6:26484985-26485007 CAGAGCACACACACAGCCCTGGG - Intergenic
1008885795 6:56430792-56430814 CAGCGCACACGCAGAGAGCTCGG + Intergenic
1011046784 6:83093195-83093217 CAGCACCCAAACATAGTGCTTGG + Intronic
1018227640 6:161644568-161644590 AGGCGCCCACACTTGGACCTGGG - Intronic
1019933695 7:4240643-4240665 CAGCGCCTACACACATACCAGGG - Intronic
1024045371 7:45582282-45582304 CAGCACCACCACAGAGACCTGGG + Intronic
1024506319 7:50165156-50165178 CAGGGCCCAGACACAGCCCTGGG + Intergenic
1024604767 7:51014305-51014327 CAGTCCCCACACTTAGCCCTGGG - Intergenic
1029660699 7:101959219-101959241 CACTGCACACACATAGAGCTAGG - Intronic
1030293168 7:107891754-107891776 CAGCTCCAACAGATAGCCCTCGG + Intronic
1035260165 7:157656101-157656123 CAGCCCCCACACACAGTCCCTGG - Intronic
1037970032 8:23165131-23165153 CAGGGCCCAGACAATGACCTAGG + Intergenic
1048482306 8:134809894-134809916 CAGTGCCCACTCAAAGACCTAGG + Intergenic
1049128154 8:140810865-140810887 CAGGGTGCACACACAGACCTGGG + Intronic
1052791047 9:32875986-32876008 CAGAGCCCAGACATAAACTTTGG - Intergenic
1053842587 9:42200864-42200886 CAGAGACCACACACAGACCACGG - Intergenic
1057825933 9:98372042-98372064 CTGAGCCCACACTTAGACCTTGG + Intronic
1059961563 9:119570045-119570067 CAGCTCCCACATATACACCATGG - Intergenic
1060593948 9:124836877-124836899 CAGGTCCCACAAATAGAACTGGG + Intergenic
1062215045 9:135384564-135384586 CAGCACCCGCACAGACACCTAGG + Intergenic
1196527281 X:116741092-116741114 CATCGCCCTCACAGAGCCCTGGG - Intergenic