ID: 1174764981

View in Genome Browser
Species Human (GRCh38)
Location 20:53245090-53245112
Sequence ACCAGCACTGAGAAGTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 189}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174764981 Original CRISPR ACCAGCACTGAGAAGTTGGG AGG Intronic
901529959 1:9846644-9846666 ACCAGCACTGAGAATCCAGGCGG - Intergenic
904054562 1:27661671-27661693 GCCATCACTGAAAAGTTAGGGGG + Intergenic
904459381 1:30666524-30666546 CCCAGCTCGGAGAAGGTGGGGGG + Intergenic
905238455 1:36566323-36566345 AGCAGCCCTGAGAAGCAGGGAGG - Intergenic
910708724 1:90156912-90156934 TCCAGCAGTGAGGAGGTGGGGGG - Intergenic
912693686 1:111823971-111823993 CCCAGCACTGAGGAGTAGTGTGG + Intronic
919904625 1:202069690-202069712 AGCAGCACTCAGAAGTTCAGTGG + Intergenic
920026965 1:203006188-203006210 AGCAGCACGGAGAGGTTTGGGGG - Intergenic
921221811 1:212978864-212978886 TCCAGCACTTGGAGGTTGGGAGG + Intronic
921646340 1:217622790-217622812 TCCAGCACTGAGAAGCGTGGCGG - Intronic
921712760 1:218389034-218389056 ATTAGCACTGAGAAGTCTGGGGG + Intronic
922909072 1:229200212-229200234 CCCAGCAGTGAGTACTTGGGGGG - Intergenic
1064194227 10:13232497-13232519 AGAAGCACTGAAAGGTTGGGAGG - Intronic
1065359593 10:24877090-24877112 ACTATCACTGAGAAGTAGGGGGG - Intronic
1065785778 10:29213219-29213241 ATCAGCAGTGGGAAGTGGGGAGG - Intergenic
1070493593 10:77000149-77000171 ACCAGCTCTGAGCACTTGGAAGG + Intronic
1074039061 10:109770162-109770184 CACAGCACTGAGGACTTGGGTGG - Intergenic
1074914001 10:117938388-117938410 ACCAGCACTGTGGACTGGGGAGG + Intergenic
1075494698 10:122909815-122909837 AGCAGCAGTGGCAAGTTGGGTGG - Intergenic
1076737960 10:132467129-132467151 GCAAGCCCTGAGAAGCTGGGCGG + Intergenic
1077814558 11:5674325-5674347 ACCAGAACTAAGAAATAGGGTGG + Intronic
1078234364 11:9470417-9470439 ACCATGATTGAGCAGTTGGGAGG + Intronic
1083600883 11:63946906-63946928 AACAGCACAGACAAGTGGGGCGG - Intronic
1084698620 11:70771344-70771366 ACCAGCACACAGAAGTGGTGGGG + Intronic
1084782332 11:71418502-71418524 ACCAGGACTGAGAAGTTTTTGGG - Intergenic
1088312716 11:108477019-108477041 GAGAGCACTGAGAAGATGGGAGG + Intronic
1088407125 11:109494357-109494379 TCAAGCACAGAGAATTTGGGGGG + Intergenic
1088407185 11:109494926-109494948 TCAAGCACAGAGAATTTGGGGGG + Intergenic
1088558739 11:111090577-111090599 ACCAGGAGTAAGAATTTGGGGGG + Intergenic
1089630354 11:119780382-119780404 ACCAGAAATGAGAAGTGAGGAGG - Intergenic
1092398961 12:8155379-8155401 ACAGCCACTGAGAAGTTGGGTGG - Intronic
1094392260 12:29964374-29964396 ATGAGCACAGAGAAGTTGAGAGG + Intergenic
1095287292 12:40429389-40429411 ATCAGAGCTGAGACGTTGGGTGG + Intronic
1096257951 12:50074227-50074249 CTCACCACTGAGAAGTTGTGAGG - Intronic
1096403591 12:51326648-51326670 TCCACCACTGAGGAGCTGGGTGG - Intergenic
1098476140 12:70906169-70906191 ACGAGAAGAGAGAAGTTGGGAGG - Intronic
1099568867 12:84287676-84287698 ACCAGCATTAAGAATTTTGGTGG - Intergenic
1100024595 12:90112401-90112423 TCCAGCACTAACAAGTTGGCAGG - Intergenic
1101729850 12:107417914-107417936 ACCAGTAGGGAGAAGTTTGGAGG + Intronic
1103430361 12:120879550-120879572 ATGAGCTATGAGAAGTTGGGCGG - Intronic
1103659841 12:122505084-122505106 TCCAGCACAGATAAGCTGGGTGG - Exonic
1104081018 12:125430688-125430710 AACAGGACTCAGAAGGTGGGTGG - Intronic
1104165867 12:126229268-126229290 AACAGCACTCAGGAGGTGGGTGG - Intergenic
1104395058 12:128425468-128425490 ACCACCACTGCGCAGTTTGGGGG + Intronic
1106801598 13:33261967-33261989 ACGAGCAGTGAGAAGTTAGGAGG + Intronic
1107667191 13:42703333-42703355 TCCATCACTAAGAAGTTGGCAGG - Intergenic
1107740835 13:43448672-43448694 ACCAGCAGTCAAAAGTAGGGAGG - Intronic
1112414004 13:99189438-99189460 GCCAGCACTGAAGAATTGGGAGG + Intergenic
1113668245 13:112155746-112155768 ACCAGCTCTGAGAAGCTGCTCGG + Intergenic
1114610558 14:24037146-24037168 ACCAGGACTGAGAAGAGAGGTGG - Intergenic
1115075248 14:29381240-29381262 ACCTGTACGGAGAACTTGGGAGG - Intergenic
1115510196 14:34130914-34130936 ACCAGGGCTGAGGAGTTGCGGGG + Intronic
1118814161 14:69298226-69298248 ACCAGCCCTGAGAAAGAGGGGGG - Intronic
1120718772 14:87868248-87868270 AACATCACTAAGAAGTTGGGTGG - Intronic
1121106590 14:91283765-91283787 GCCAGCCCTGAGAGGCTGGGAGG + Intronic
1121792471 14:96709519-96709541 ACCATCACAGAGTTGTTGGGTGG - Intergenic
1128016329 15:64350922-64350944 AGAAGCTCTGAGAAGCTGGGAGG - Intronic
1133315310 16:4879861-4879883 ACTAGCACTGTGAAGGTCGGTGG - Intronic
1134016208 16:10890214-10890236 ACCACCACTGAGAAGTTGCCTGG - Intronic
1134306888 16:13041125-13041147 TCCAGCTCTGAGATGTTGGGAGG - Intronic
1137561917 16:49508047-49508069 ACCAGCTCTGAGGCCTTGGGGGG + Intronic
1137923464 16:52515495-52515517 ACCAGCTTTGGGAAGCTGGGCGG + Intronic
1138509969 16:57503077-57503099 ATCTGCACTGAGCAGCTGGGAGG + Intergenic
1141111370 16:81273438-81273460 TCCTGCACTGAGAAACTGGGCGG - Intronic
1141291636 16:82723159-82723181 ACCTGCAGGGAGCAGTTGGGTGG + Intronic
1142708954 17:1713246-1713268 ACCATCACCCAGAAGCTGGGTGG - Intergenic
1143267583 17:5651768-5651790 ACTATCATTTAGAAGTTGGGGGG - Intergenic
1143625262 17:8106286-8106308 AACAGAACAGAGAGGTTGGGAGG + Intronic
1143887291 17:10074455-10074477 TCCAACACTGAGAAGGTAGGAGG - Intronic
1145734007 17:27213678-27213700 ACCAGGAATGAAAAGTTGGAGGG - Intergenic
1146554614 17:33812934-33812956 TCCAGAACTCAGAAGGTGGGAGG + Intronic
1146957706 17:36946422-36946444 GCCAGCCCGGAGAAGTTGGGTGG - Intergenic
1147340540 17:39751071-39751093 GCCAGCACTGAGAAGGGAGGGGG - Intergenic
1149991246 17:61384790-61384812 ACCAGCAGTGAGCGCTTGGGAGG - Intronic
1151395572 17:73820367-73820389 GCCATCACTAAGAATTTGGGAGG + Intergenic
1151482691 17:74379708-74379730 GCCAGCACCGAGTAGTTGGGTGG + Intergenic
1151552767 17:74831573-74831595 AGCAGCAGTGAGAAGCTGGGAGG - Intronic
1152358370 17:79817594-79817616 ACCAGCACAGAGAAGTAGTTAGG - Intergenic
1155156756 18:23164005-23164027 CCCAGCACTGAGAACTTATGTGG + Intronic
1157422662 18:47559486-47559508 CCCAGCAGTGGGAGGTTGGGAGG - Intergenic
1159272529 18:66170781-66170803 ACTAGCACTGAGAATTTTTGTGG + Intergenic
1162127836 19:8508872-8508894 CCCAGCTCTGAGGAGTGGGGTGG - Intergenic
1162182829 19:8882365-8882387 ACCTGCACAGAGAAGGAGGGAGG + Exonic
1162187436 19:8916898-8916920 ACCTGCACAGAGAAGGAGGGAGG + Exonic
1162507047 19:11091752-11091774 ACCAGCTCTCAGAAGTCTGGAGG - Intronic
1163351907 19:16782204-16782226 CCCAGCACTTTGAAGATGGGAGG + Intronic
1165130316 19:33628044-33628066 ACCTGCACTGAGAGGTTAGGAGG + Intronic
1167509232 19:49887617-49887639 ACCTGCCCTGGGAGGTTGGGCGG + Intronic
926337808 2:11877351-11877373 ACCAGCAATGTGAGGCTGGGAGG - Intergenic
931091611 2:58892704-58892726 ACCAGCACAAAGAAGATGAGGGG - Intergenic
932508221 2:72257761-72257783 CCCAGCCCTGGGAAATTGGGTGG - Intronic
933430813 2:82175866-82175888 AACAGAACTGTGAATTTGGGAGG - Intergenic
936473824 2:112822701-112822723 ACCAGCACAGTGAGGTTGGAAGG - Intergenic
937003308 2:118488335-118488357 ACCAGCAAAGAGATGTTAGGAGG + Intergenic
937853091 2:126653218-126653240 ACTAGCACTGAGGATTTGGAAGG + Intergenic
937896329 2:126979168-126979190 ACCTGCCCTGAGATGTGGGGTGG + Intergenic
942369300 2:175265112-175265134 ACCAGCAATGTGAAGTTAGCAGG + Intergenic
944444273 2:199773934-199773956 AGCATCACTGAGAAGTTCAGTGG - Intronic
944866563 2:203868201-203868223 GCCAGCAGGGAGCAGTTGGGCGG + Intronic
945126786 2:206520786-206520808 ACCAGAACTCAGAACTTGGAAGG - Intronic
947699286 2:232218938-232218960 AGCAGCGCTGGGAAGTGGGGTGG - Intronic
1168788371 20:558981-559003 ACCATCACAAAGTAGTTGGGTGG + Intergenic
1171346785 20:24471168-24471190 CCTAGCACGGAGAAGTTGGCCGG - Intronic
1171398438 20:24855905-24855927 ATCAGCACTGGGAAGAGGGGAGG - Intergenic
1173180710 20:40804441-40804463 CTGAGCCCTGAGAAGTTGGGGGG + Intergenic
1174052525 20:47777009-47777031 CCCAGCACTGAGAACCAGGGTGG - Intronic
1174764981 20:53245090-53245112 ACCAGCACTGAGAAGTTGGGAGG + Intronic
1175049935 20:56145843-56145865 AACAGGACTGAGAAGTGGAGAGG + Intergenic
1181055261 22:20257950-20257972 AGCAGTTCTGAGACGTTGGGGGG - Intronic
1182834260 22:33328844-33328866 CCCAGCACTTAGGAGTTGTGTGG + Intronic
1184739809 22:46421282-46421304 CCCAGCAGTGAGGGGTTGGGTGG + Intronic
950077742 3:10199213-10199235 AGCAGCTCTGAGAAGCTGGCTGG + Intronic
950332601 3:12168395-12168417 ACCTGCTCTGAGATGTTTGGCGG + Exonic
950472462 3:13194548-13194570 AGCAGCTCTGAGAAGGGGGGTGG - Intergenic
952144641 3:30518478-30518500 AACAGCACTGGAAAGTTGGCAGG + Intergenic
956671716 3:71697562-71697584 ACCAGAGCTGGGAAGTTGTGGGG - Intronic
960156602 3:114302700-114302722 AGCATCATTGAGAAGTTTGGTGG - Intronic
960544018 3:118891341-118891363 ATCAGCACTGTGAAGTTGGAGGG + Intergenic
961210604 3:125122463-125122485 ATAAGCAAAGAGAAGTTGGGAGG + Intronic
961695749 3:128703197-128703219 GCCAGCAGTGAGGACTTGGGCGG + Intergenic
963482971 3:145900300-145900322 ACCTGCACTCTGAATTTGGGAGG + Intergenic
964249937 3:154701665-154701687 AACAGCACAAAGAAGGTGGGTGG + Intergenic
964632371 3:158825704-158825726 ACCAGCACTGAGAAAGGGAGAGG + Intronic
966214122 3:177483705-177483727 ACCAGGACTGTGAATTAGGGTGG + Intergenic
968067895 3:195768982-195769004 GTCAGCACTGAGCAGTTGGCAGG - Intronic
968227805 3:196986290-196986312 AGCAGCACTGAAAAGATGGAAGG + Intergenic
968860003 4:3160300-3160322 AACAGCACGGAAAAGTTTGGAGG + Exonic
969366681 4:6699258-6699280 CCCAGAACTGATAAGCTGGGTGG - Intergenic
970585482 4:17510863-17510885 CCAAGCACTGAGCAGATGGGTGG + Intronic
972620914 4:40747695-40747717 ACCAGGAGTGAGAAGTAAGGAGG + Intergenic
972626527 4:40804913-40804935 CACAGCACTGAGAGGTTTGGTGG - Intronic
974703807 4:65486174-65486196 ACCAGTAATGAGAAGATGAGGGG - Intronic
978092662 4:104737050-104737072 ACCAGCAATGAAAATATGGGGGG + Intergenic
980077310 4:128307482-128307504 ACCAGCCCTGTGATGGTGGGGGG - Intergenic
983833946 4:172366847-172366869 ACCAGCATTCAGAAGTTGCTGGG + Intronic
986652451 5:9978171-9978193 ACCAGCACAGAGAAGTAGTCAGG + Intergenic
986750036 5:10779098-10779120 ACCAGCTGTGAGAATGTGGGTGG - Intergenic
989011969 5:36882558-36882580 AACTTCACTGAGTAGTTGGGTGG - Intronic
989343204 5:40400389-40400411 ACCAGCCCTTAGTAGTTTGGAGG + Intergenic
992296225 5:75329407-75329429 AGCAGCACTGAGAACTTGCTGGG + Intergenic
992380244 5:76229260-76229282 AACAGCACTGCAAAGTTGGATGG - Intronic
993022316 5:82605988-82606010 AGTAGCAGTGACAAGTTGGGTGG - Intergenic
993561442 5:89416047-89416069 ACCAGGAATGAGAAGATGAGGGG - Intergenic
994167864 5:96626573-96626595 AGCAGTCCTGAGAAGATGGGAGG - Intronic
995872283 5:116756068-116756090 GACTGCACAGAGAAGTTGGGGGG - Intergenic
996400783 5:123060049-123060071 ACCAGAAGGAAGAAGTTGGGTGG + Intergenic
996621797 5:125514202-125514224 ACCACCACTGGGAAGTTGTGGGG + Intergenic
997856080 5:137373823-137373845 ACTAGCAGTGTGATGTTGGGTGG + Intronic
998407456 5:141882212-141882234 ACCTCCACTGAGGAGTTGGTAGG - Intergenic
999531000 5:152463577-152463599 ACCAGCAGTGAGAAGTGTGCTGG - Intergenic
1001452154 5:171835217-171835239 ACCAGCAGGGAGAGGATGGGCGG + Intergenic
1001477510 5:172061064-172061086 CCCAGCCCTGGGAAGTGGGGTGG - Intronic
1003667331 6:8123610-8123632 ACCAGGACTGAGCAGTTGCAGGG - Intergenic
1003694477 6:8389646-8389668 GCCAGCACTAAAAGGTTGGGCGG - Intergenic
1004422565 6:15484820-15484842 AAAAGCACAGAGAAGTTTGGAGG + Intronic
1006101321 6:31687964-31687986 ACCAGCACAGGGAAGGAGGGAGG - Intronic
1006861278 6:37172929-37172951 ACAAGCACAAAGAAGCTGGGTGG - Intronic
1008487660 6:52053162-52053184 ACCAGCACTGGGGAGTTTGCCGG + Exonic
1010368569 6:75081027-75081049 AACAGCACTGAGAAGTGAGGAGG + Intergenic
1010395944 6:75392157-75392179 TCCAGCACTGAGAGACTGGGAGG - Intronic
1012452381 6:99366312-99366334 AACAGCCCTGAGAAGTAGGTAGG + Intergenic
1012805186 6:103884689-103884711 ACCAGCAGTGAGCAGTAGGTTGG - Intergenic
1015059182 6:128941876-128941898 TCCATCACTGAGAAGTTCAGAGG + Intronic
1015912529 6:138183194-138183216 CCCAGGACTGAGCAGGTGGGAGG + Intronic
1016243529 6:141958034-141958056 TCCACCAATGAGTAGTTGGGTGG - Intergenic
1020101043 7:5394594-5394616 GCCTGCAGAGAGAAGTTGGGAGG + Exonic
1022599484 7:31743526-31743548 ATCAGCATTGAGAAGTTCGCTGG + Intergenic
1022812214 7:33880820-33880842 ACCAGCACTAATTAGTAGGGAGG + Intergenic
1024891267 7:54206340-54206362 ACCAGCACTAACAAATTTGGTGG + Intergenic
1025045851 7:55691383-55691405 CTCAGCACTGAGCAGTCGGGGGG + Intergenic
1026168059 7:67928603-67928625 GCCTGCACTGAGAAGTTGTGGGG + Intergenic
1026334072 7:69378822-69378844 CCCAACACTGGGAACTTGGGAGG + Intergenic
1028007543 7:85593886-85593908 ACCAGCACAGTGAAGTGGGGGGG + Intergenic
1029136265 7:98374452-98374474 ACCAGCAGCGAGAGGTGGGGTGG + Intronic
1032427098 7:131830985-131831007 ACATGCACTGTGAAGGTGGGAGG - Intergenic
1032638990 7:133743851-133743873 AGCAGCAGTGAGAAGCAGGGTGG - Intronic
1033361841 7:140643529-140643551 GCCAGCTCTGAGAAGTTGGAGGG - Intronic
1033736875 7:144231167-144231189 CCCAGCAGTGAAAAGTTGTGTGG + Intergenic
1033746182 7:144319779-144319801 CCCAGCAGTGAAAAGTTGTGTGG - Intergenic
1034999153 7:155597597-155597619 CTCAGCACTGAGCAGCTGGGGGG + Intergenic
1035459371 7:159029791-159029813 AACAGCCCTGTGGAGTTGGGTGG + Exonic
1035865048 8:3073046-3073068 AATAGCACTGGGAATTTGGGAGG - Intronic
1036229318 8:6985960-6985982 TCCAGCACAGAGAGGTTGGGAGG + Intergenic
1036231770 8:7005064-7005086 TCCAGCACAGAGAGGTTGGGAGG + Intronic
1036714451 8:11107537-11107559 ACCAGCAGGGAGAAGTGGTGAGG + Intronic
1036820808 8:11937649-11937671 ACAACCCCTGAGAAATTGGGAGG + Intergenic
1039125758 8:34199832-34199854 TCCAGCAATGACAAGTTGTGTGG - Intergenic
1041153239 8:54957707-54957729 ACCATCACTGAGAAGCTCAGTGG - Intergenic
1043931583 8:86097836-86097858 ACCAGCCCTCAGAAGCTGTGAGG - Intronic
1045323358 8:101098511-101098533 GGCAGAGCTGAGAAGTTGGGAGG - Intergenic
1052989580 9:34511311-34511333 TCCAGCCCTGAGAAGATGGGTGG + Intronic
1055141573 9:72882577-72882599 ATAAGCACTGAGCAGTTGTGTGG + Intergenic
1056424251 9:86460789-86460811 ACCAGCACTGATAACCTGGAAGG - Intergenic
1056543578 9:87594849-87594871 ACCAGGCCTGAGGAGGTGGGTGG + Intronic
1056729706 9:89155159-89155181 AACAGCACTGAGAACCTGGCTGG - Intronic
1057241109 9:93410177-93410199 GCCACCACAGAGAAGTTTGGAGG - Intergenic
1059341578 9:113600484-113600506 CCCAGGCCTGAGAAGATGGGGGG + Intergenic
1059859600 9:118444570-118444592 ACCAGCCCTGAGATGTTGGGTGG - Intergenic
1061217713 9:129231434-129231456 CACAGCTCTGAGTAGTTGGGTGG + Intergenic
1062375192 9:136258959-136258981 ACCTGCACTGAGCTGTGGGGAGG + Intergenic
1062635893 9:137491527-137491549 ACCTGCACTGTGAATTTTGGGGG - Intronic
1186008493 X:5102610-5102632 AGAAGCACTGAGAAGTCGTGTGG + Intergenic
1186039142 X:5457170-5457192 ACCACCTCAGAGAAGTAGGGTGG + Intergenic
1186807190 X:13152174-13152196 AGAAGCAATGAGAAGCTGGGAGG - Intergenic
1188009283 X:25039989-25040011 ACCAGCACTTAGAAGAAGGGTGG + Intergenic
1189244522 X:39553178-39553200 TGAAGCACAGAGAAGTTGGGTGG - Intergenic
1192548198 X:72030879-72030901 ACCTGCATTGGGTAGTTGGGTGG - Intergenic
1196275970 X:113765458-113765480 ACAATCACTTACAAGTTGGGTGG + Intergenic
1198076131 X:133194868-133194890 ACAGGAAGTGAGAAGTTGGGAGG - Intergenic
1199704131 X:150409428-150409450 ACCAGAACTGATCAGATGGGCGG - Intronic
1202018107 Y:20433856-20433878 ACTAGCACTGAGAAATGTGGTGG + Intergenic