ID: 1174767206

View in Genome Browser
Species Human (GRCh38)
Location 20:53265487-53265509
Sequence CTGCGGGGCTGGAGGAGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 738
Summary {0: 1, 1: 0, 2: 13, 3: 82, 4: 642}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174767206_1174767214 -4 Left 1174767206 20:53265487-53265509 CCTTTCCTCCTCCAGCCCCGCAG 0: 1
1: 0
2: 13
3: 82
4: 642
Right 1174767214 20:53265506-53265528 GCAGCGTTAACCTACTCCGTGGG 0: 1
1: 0
2: 0
3: 0
4: 19
1174767206_1174767219 21 Left 1174767206 20:53265487-53265509 CCTTTCCTCCTCCAGCCCCGCAG 0: 1
1: 0
2: 13
3: 82
4: 642
Right 1174767219 20:53265531-53265553 CTCAGCCCACCTCTGTGAGCTGG 0: 1
1: 0
2: 1
3: 28
4: 270
1174767206_1174767213 -5 Left 1174767206 20:53265487-53265509 CCTTTCCTCCTCCAGCCCCGCAG 0: 1
1: 0
2: 13
3: 82
4: 642
Right 1174767213 20:53265505-53265527 CGCAGCGTTAACCTACTCCGTGG 0: 1
1: 0
2: 0
3: 1
4: 7
1174767206_1174767216 -2 Left 1174767206 20:53265487-53265509 CCTTTCCTCCTCCAGCCCCGCAG 0: 1
1: 0
2: 13
3: 82
4: 642
Right 1174767216 20:53265508-53265530 AGCGTTAACCTACTCCGTGGGGG 0: 1
1: 0
2: 0
3: 2
4: 29
1174767206_1174767215 -3 Left 1174767206 20:53265487-53265509 CCTTTCCTCCTCCAGCCCCGCAG 0: 1
1: 0
2: 13
3: 82
4: 642
Right 1174767215 20:53265507-53265529 CAGCGTTAACCTACTCCGTGGGG 0: 1
1: 0
2: 0
3: 1
4: 13

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174767206 Original CRISPR CTGCGGGGCTGGAGGAGGAA AGG (reversed) Intronic
900300210 1:1973343-1973365 CTGTGGGGAGGGAGGAGGCAGGG + Intronic
900318979 1:2073227-2073249 CTGGGGGGCAGGAACAGGAAAGG - Intronic
900519500 1:3098772-3098794 CTGCAGGGCTGGAGCAGCAAGGG - Intronic
900572482 1:3365358-3365380 CTGAGGGTCAGGAAGAGGAAAGG + Intronic
900607548 1:3530621-3530643 CTGTGGGGCTCCAGGAAGAACGG + Intronic
900658269 1:3770792-3770814 CTGGGGGAGGGGAGGAGGAAGGG + Intronic
901050753 1:6424830-6424852 CTGCGGGCCGGGAGGCGGAGCGG - Exonic
901183655 1:7358514-7358536 CAGGGACGCTGGAGGAGGAAGGG - Intronic
901236540 1:7670359-7670381 GTGAGGGGCTGGAGCAGGACGGG - Intronic
901510739 1:9717009-9717031 TGGCGAGGATGGAGGAGGAATGG - Exonic
901839415 1:11944705-11944727 CTGCGGTGCTGGGGGAGGAGGGG - Intronic
902265187 1:15258231-15258253 CTGGGGGGCTGGGAGGGGAAGGG - Intronic
902368229 1:15990810-15990832 CTGTGGGGCCGGAGGAGCCAGGG + Intergenic
903214639 1:21836968-21836990 CTGCTGGGATGGAGGTGGCAGGG + Exonic
903670247 1:25031171-25031193 CTGGAGGGATGGAGGATGAAGGG + Intergenic
904698953 1:32346915-32346937 GAGAGGGGCTGGAGGAGGGAGGG + Intergenic
905404912 1:37726120-37726142 CTGAGAGGCAGAAGGAGGAAAGG - Intronic
905797661 1:40824565-40824587 GTGCAGGGATGGAGGAGTAAGGG - Intronic
906157433 1:43622014-43622036 CGGCGGGGGTGGCGGAGGAGAGG - Exonic
906288499 1:44603845-44603867 CTGCAGGGCTGGATGGGCAATGG - Intronic
906325526 1:44843169-44843191 CGCGGCGGCTGGAGGAGGAATGG + Intergenic
906935786 1:50212959-50212981 CTGTGAGGCAGGAAGAGGAAGGG - Intergenic
907074545 1:51566434-51566456 CTGGGGCTCTGGAGGAGGACTGG - Intergenic
907666234 1:56435977-56435999 TTGCCAGGCTGGAGGAGGAGGGG - Intergenic
907706604 1:56837890-56837912 CGGAGGGGCTGGAGGAGCAGTGG + Intergenic
908867748 1:68570339-68570361 TTGCAGGGCTGGAAAAGGAAAGG + Intergenic
909033896 1:70574669-70574691 CTGAGGGGCTGGAGTAGAAAGGG - Intergenic
909593225 1:77375699-77375721 TTGTGTGGCTGTAGGAGGAAAGG - Intronic
910251256 1:85201111-85201133 CTGAGGGGGCGGAGGCGGAACGG - Intergenic
910852020 1:91657743-91657765 CTTAGGGGCAGGATGAGGAAGGG - Intergenic
912483767 1:110007292-110007314 CAGGGAGGCTGGTGGAGGAAGGG + Intronic
912798582 1:112707144-112707166 CCGCGGCGCTGGAGGAGGGCGGG - Intronic
913201457 1:116498052-116498074 CTCAGGGGCTAGAGGAGGGAAGG - Intergenic
913250693 1:116910157-116910179 CGGCGGGGAAGGAGGAGGAGGGG + Exonic
913280485 1:117180811-117180833 TGGCTGGGCTGGAGGAGGAGAGG - Intronic
913485896 1:119332648-119332670 CTACGGGTCTGGAGGAGGTTTGG + Intergenic
914839719 1:151238454-151238476 CTGGGGAGATGGGGGAGGAAGGG - Intronic
915604017 1:156939702-156939724 TTGCAGGGCTGGAGGGGGAACGG - Exonic
916029423 1:160863109-160863131 GAGAGGGGCTGGAGGAGGAGTGG + Intergenic
916243602 1:162664012-162664034 CTGAGAGGCTGGGGGAGGACAGG + Intronic
916327742 1:163582125-163582147 TTGAGGGGCTGAAGTAGGAAGGG + Intergenic
917427284 1:174928082-174928104 CTGCAAGGCTGGAGAAGGAAGGG - Intronic
917790250 1:178494803-178494825 CTGCAGGGCTGGAACAGGAGAGG + Intergenic
919765497 1:201124678-201124700 CTGCAGGGCTGGAGGGGAGACGG + Intronic
919803016 1:201364845-201364867 CTGCGGGGGAAGAGGAGGCAAGG + Intronic
920074373 1:203325839-203325861 CAGCGGGGATGGTGGAGGATGGG + Intergenic
920215981 1:204361818-204361840 CTGCGGAGCCAGTGGAGGAAAGG + Intronic
920491609 1:206419970-206419992 TGGCTGGGGTGGAGGAGGAAGGG - Intronic
921187581 1:212683546-212683568 CTGCTGGGCTGAAGGAAGGAAGG - Intergenic
921384189 1:214552384-214552406 CTACGGGGCGGGAGGGGGCAGGG - Intronic
921944449 1:220877253-220877275 CCGCGGGCCTGGCGGAGAAAGGG + Intergenic
922314844 1:224434042-224434064 CGGCGGCGGTGGAGGAGGAGGGG - Exonic
922790054 1:228306357-228306379 CTGTGGGGCTGCAGGGGGCAGGG - Exonic
922803372 1:228373926-228373948 CTGCAGGTCTGGAGAAGGAGGGG + Exonic
922880573 1:228977432-228977454 CCGCAGGGCTGGGGGAGGAGAGG + Intergenic
923001888 1:230012939-230012961 CTGCGGGGAAGGAGGTTGAAGGG + Intergenic
923055701 1:230425206-230425228 CGGCGTGGCTGGTGGAGGCAGGG - Intronic
923202534 1:231725996-231726018 CTGCAAGGCTGGAGGAGGAAAGG - Intronic
923405725 1:233657234-233657256 CTGCGGGGGTTGTGGATGAAGGG - Intronic
924139756 1:241010038-241010060 GTGTGGGGCTGGGGGAGGGATGG + Intronic
924740780 1:246793324-246793346 CTGCTGGACTGGAGGGGGAGGGG + Intergenic
1062929627 10:1344374-1344396 CTGCATGGCAGGAGAAGGAAGGG + Intronic
1064707287 10:18086205-18086227 CTGTGGTGTTGGAGCAGGAATGG + Intergenic
1065100520 10:22326122-22326144 CTGCTGGGCTGGAGGACAAATGG + Intronic
1065239762 10:23694214-23694236 CCGCGGGGGTGGAGGTTGAAAGG + Intergenic
1065814801 10:29473847-29473869 CGGTGGAGCTGGACGAGGAAAGG - Exonic
1065998724 10:31084194-31084216 CCCTGGGGCTGGAGGAAGAAAGG - Intergenic
1066067368 10:31772163-31772185 CTGGGAGGCAGGAGGAGGAGAGG - Intergenic
1067031662 10:42882193-42882215 CTGAGGAGGAGGAGGAGGAAGGG + Intergenic
1067146057 10:43694732-43694754 CAGAGGGGCTGGAGGAGGGGAGG + Intergenic
1067297553 10:44983553-44983575 GTGCTGGGCTGGAGAAGGAGTGG - Intronic
1067343014 10:45419500-45419522 CTGCGGGGCTGGGGGAGGGCCGG - Intronic
1067564321 10:47325878-47325900 ATGCCAGCCTGGAGGAGGAAAGG + Exonic
1067660569 10:48233865-48233887 CTCAGGGGCTGGTGGAGGAAAGG + Intronic
1067798858 10:49342928-49342950 CTGCCGGGGTGGAGGAGGAGTGG - Intergenic
1067991286 10:51215554-51215576 CAGGGGGCATGGAGGAGGAAGGG + Intronic
1068912294 10:62391388-62391410 GGGAGGGGGTGGAGGAGGAAAGG - Intronic
1069409748 10:68141060-68141082 TTGGGGGGGTGGTGGAGGAAGGG - Intronic
1069505873 10:68997451-68997473 CTACATGGCTGGAGTAGGAAGGG - Intronic
1069582945 10:69577649-69577671 CTGAGGGGATGGTGGAGGCAGGG + Intergenic
1069904364 10:71723789-71723811 CTGCGAACCTGGAGGAGGATCGG + Intronic
1069962684 10:72087844-72087866 CTGCGGGCCGGGAGTGGGAAGGG - Intronic
1070630474 10:78081165-78081187 CTGGGGGGCAGGAGGAAGAATGG + Intergenic
1072153490 10:92702448-92702470 GTGCGGGGCTTGGGGAGGGAGGG - Intergenic
1073015001 10:100391637-100391659 GTGCGGGGCTGGGGGAAGATTGG + Intergenic
1073037089 10:100571624-100571646 ATGCGGGGCTGGGGGTGGATGGG - Intergenic
1073053429 10:100684023-100684045 CTGGGGGGCTGCAGGGGGGAGGG + Intergenic
1073212739 10:101818155-101818177 CTGCGGAGAGGGAGGGGGAAGGG - Exonic
1073759241 10:106612390-106612412 CTGCGGGGGTGGGGGCGGGAGGG - Intronic
1074108759 10:110408157-110408179 CAGAGGGGCTGGAGGAGGCCTGG + Intergenic
1074765564 10:116697440-116697462 CTGGGGGGATAGAGGAGGAGGGG + Intronic
1074892352 10:117746246-117746268 CAGCGGGGCATGGGGAGGAAGGG - Intergenic
1075616000 10:123891453-123891475 CTGCGGGGCCCGGGGAGGAGTGG - Exonic
1076009358 10:126974993-126975015 ATGGGAGGCAGGAGGAGGAAGGG - Intronic
1076253188 10:128999111-128999133 GTGAAGGGCTGGAGGAGGGAAGG + Intergenic
1076930527 10:133528923-133528945 CTGCGGGCCCAGAGGCGGAACGG - Intronic
1077069763 11:663490-663512 CTGAGGAGATGGAGGAGGAAAGG - Intronic
1077069780 11:663603-663625 CTGAGGAGATGGAGGAGGAAAGG - Intronic
1077069789 11:663660-663682 CTGAGGAGTTGGAGGAGGAAAGG - Intronic
1077069806 11:663769-663791 CTGAGGAGATGGAGAAGGAAAGG - Intronic
1077071600 11:676413-676435 CTGGGTGGGTGGAGCAGGAAGGG - Intronic
1077194580 11:1272736-1272758 CTGCGGGAATGCAGGAGGAGGGG + Intergenic
1077377744 11:2213155-2213177 CGGAGGGGCTGGAGGAGGTTGGG - Intergenic
1077394999 11:2316338-2316360 CTGAGGGGCAGGAGGTGGGAAGG - Intronic
1077473569 11:2776123-2776145 CAGCGGTGCCGGAGGAGGGAGGG + Intronic
1077602298 11:3582020-3582042 CTGTGGGGCTGGAGCATGGAGGG + Intergenic
1077677770 11:4212208-4212230 CTGCGGGGCTGCGGCAGGGAGGG + Intergenic
1077914434 11:6602102-6602124 CTGAGGAGGAGGAGGAGGAAAGG - Exonic
1078084269 11:8224447-8224469 GGGCGGTGGTGGAGGAGGAAGGG + Exonic
1078105824 11:8357402-8357424 CCGCGGGCCTCCAGGAGGAAAGG + Intergenic
1079120545 11:17681061-17681083 CTGTTGGGCTGAAGTAGGAAAGG - Intergenic
1080403398 11:31957479-31957501 CTGAGGCACAGGAGGAGGAATGG - Intronic
1082095596 11:48126955-48126977 CTGAAGGGCTAGAGGAGGACAGG + Intronic
1082759262 11:57110943-57110965 CTGTGTGGCTGGAGAAGGGAAGG - Intergenic
1082854162 11:57791558-57791580 CCCGGGCGCTGGAGGAGGAACGG + Exonic
1082958872 11:58900474-58900496 CTGCCGGGCGGGAGTAGGAGTGG - Intronic
1083184615 11:61009879-61009901 CTGGGGGGGTGGAGTAGGATGGG - Intronic
1083265758 11:61546198-61546220 CGGCGGGGCTGGCGGTGGAGCGG - Exonic
1083266983 11:61551301-61551323 CTGTGGGGCTGGGGGAGAGAAGG + Intronic
1083749291 11:64752629-64752651 CTGGGCGGCTGGAGGAGGAGGGG - Intronic
1084092211 11:66886156-66886178 CTCCAGGGTGGGAGGAGGAAGGG + Intronic
1084167672 11:67383579-67383601 CTGCAGGGCTGGAGGTGGAGGGG - Intronic
1084173401 11:67411123-67411145 CTGAGGGGCTGGTGCAGGATTGG - Intronic
1084227559 11:67726689-67726711 ATCCGGGGCTGGGGGAGGAGGGG + Intergenic
1084669075 11:70594848-70594870 CTGCAGGGCTGGAGGAGCATGGG - Intronic
1084814553 11:71638643-71638665 CTGTGGGGCTGGAGCATGGAGGG - Intergenic
1087144356 11:94797599-94797621 CTGCAGGGCTGTAGCAGGAAAGG + Intronic
1089119309 11:116122350-116122372 GTCAGGGGCTGGAGGAGAAAGGG + Intergenic
1089254414 11:117186709-117186731 CTAGGGGGTTGGAGGAGGAAGGG + Intronic
1089352784 11:117830890-117830912 CTGCTGGGCTGGAGAAGGAAGGG - Intronic
1089496611 11:118911314-118911336 CTGCGGGGCTGCTGGAGGCTGGG + Intronic
1089556586 11:119318652-119318674 CTGCTGGGCTGGAGTGGGAATGG + Intronic
1089566469 11:119374381-119374403 CTGCAGGACTGGAGCAGGGAAGG - Intronic
1090664545 11:128905749-128905771 GGGCGGGGCGGGGGGAGGAAAGG + Intronic
1091218704 11:133918577-133918599 CTCCGGGGCCGGCCGAGGAAGGG - Intronic
1091237974 11:134034299-134034321 CTGCAGAGCTGGAGGAGGGAGGG + Intergenic
1091354432 11:134924729-134924751 ATGAGATGCTGGAGGAGGAAAGG - Intergenic
1091770324 12:3147232-3147254 CTGCTGGGCAGCAGGAGGCAGGG + Intronic
1091973649 12:4809074-4809096 CTGCGGGGGTGGAGGGGGTGTGG + Intronic
1092153896 12:6269699-6269721 CTGCGATGCTGAAGGAGGACAGG - Intergenic
1092173110 12:6385391-6385413 CTGAGGGGCTGGATGTGAAAAGG + Intronic
1092226026 12:6748872-6748894 CTCAGGGGCTGGGGGACGAAGGG - Exonic
1092658223 12:10710088-10710110 CTGGGGAGGAGGAGGAGGAAGGG - Exonic
1092732219 12:11545644-11545666 CTGAGTGGCAGGGGGAGGAAGGG - Intergenic
1092879316 12:12875706-12875728 CTGGGGGCCTGGAGGGGGTAGGG - Intergenic
1095206383 12:39443762-39443784 CTCCGGGGAGGGAGGAGGGAGGG - Intergenic
1096583270 12:52601937-52601959 CTGGGAGGCAGGAGGAGGACAGG - Intergenic
1097098768 12:56571309-56571331 CTGCGTGGCTGGAAGAGAAGTGG + Intronic
1097259688 12:57711121-57711143 CTGTGGGGCTGGAGCAGGGATGG - Intronic
1097528820 12:60772893-60772915 CTGTGGGGGTTGAGGAGGGAAGG + Intergenic
1097957463 12:65500952-65500974 CTGGTGGTCAGGAGGAGGAAAGG - Intergenic
1098311934 12:69157191-69157213 CTGCAAGGCTGGAGGAGGGAAGG - Intergenic
1099141226 12:78978011-78978033 CGGCGGGGCCGGCGGAGGGAAGG + Intronic
1099285549 12:80710460-80710482 CTGTTGGGGAGGAGGAGGAAAGG - Intergenic
1100749251 12:97678937-97678959 GTGGGGGGCTGGGGGAGGGATGG + Intergenic
1101051247 12:100866379-100866401 CTGAGGAGCTGGAGAAGGTAAGG - Intronic
1101719144 12:107335959-107335981 TGTCGGGGCAGGAGGAGGAAGGG - Intronic
1102177531 12:110886938-110886960 CTGTGCGACTGCAGGAGGAAAGG - Intronic
1102462228 12:113107008-113107030 CTGAGGAGCTGGAGGGGGAAAGG + Intronic
1102950642 12:117028510-117028532 CTGCAGGGCTGGAGCTGGGAGGG - Exonic
1102952954 12:117042278-117042300 CTGGGGGGCTGGGGGAGGGGAGG - Intronic
1103358857 12:120342097-120342119 TTGCGGGGGTCGAGGGGGAAGGG + Exonic
1103568138 12:121827350-121827372 CTGATGGGATGGAGGAGGCAGGG + Intronic
1103950637 12:124549262-124549284 CTGAGGGGCTGGCGGTGGGAGGG + Intronic
1104668328 12:130663220-130663242 CTGAGGGGGTGGAGCAGGAGGGG - Intronic
1104671986 12:130686783-130686805 CTGCAGGGCCGGAGGAGGAAGGG + Intronic
1104856724 12:131905642-131905664 AGGCTGGGCTGGAGGAGCAAGGG - Intronic
1106845651 13:33735483-33735505 CTGCAGGGCTGGCAGAGGCAGGG + Intergenic
1107810945 13:44199113-44199135 CCCCAGGGGTGGAGGAGGAAAGG + Intergenic
1107884973 13:44867640-44867662 CTTCAGGGCTGGAGAAGAAAAGG + Intergenic
1109687730 13:65843601-65843623 CGGAGGGGGTGGAGGAGGCAGGG - Intergenic
1110217086 13:73035041-73035063 CTCCAGGGATGGGGGAGGAATGG - Intergenic
1113058528 13:106296194-106296216 CTGCAGGGCTGGAGGATTAGTGG + Intergenic
1113074601 13:106455331-106455353 CTGTGGGGCAGGAGGAGGTCTGG + Intergenic
1113530464 13:111020724-111020746 CTGGGGGACAGGAGGAGGGAGGG - Intergenic
1113813253 13:113154392-113154414 GCGCGGGGGAGGAGGAGGAAGGG + Intergenic
1113813276 13:113154472-113154494 GTGTGGGGGAGGAGGAGGAAGGG + Intergenic
1113893552 13:113749057-113749079 CAGGGCGGGTGGAGGAGGAAGGG + Intergenic
1114560783 14:23589042-23589064 CTGTGGGGGTGGAGGTGGGAGGG + Intergenic
1115163760 14:30424845-30424867 CAGCAGGGCAGGAGGAGAAAAGG + Intergenic
1116471582 14:45291810-45291832 CTGGGGTGCTGGAGGGGAAATGG + Intergenic
1116665125 14:47764851-47764873 CTGAGGAGGAGGAGGAGGAAGGG + Intergenic
1116833490 14:49746041-49746063 CAATGGGGCTGGAGAAGGAAGGG + Intronic
1117305556 14:54470013-54470035 CTCTGGGGTTGGAGGAGGAGGGG - Intergenic
1117394811 14:55298646-55298668 GTTCGGGGCTGGAGGGGGTAAGG + Intronic
1117756465 14:58979397-58979419 ATGTGGGGCTGCAGGAGGAAGGG + Intergenic
1118532674 14:66724512-66724534 CTGAGGGGCTGGAGTGGGAAGGG + Intronic
1119029759 14:71182809-71182831 CGGCGGGGCTGCAGGAGGCCAGG + Intergenic
1119042106 14:71284061-71284083 CTGGGGGGAGGGAGGAAGAAAGG + Intergenic
1119403211 14:74378441-74378463 CTGCGGAGCTCGCGGAGGCAAGG - Intergenic
1119739814 14:77007086-77007108 TTGTGGGGCTGCAGGAGCAAGGG + Intergenic
1120727659 14:87962958-87962980 TTGAGGGGCTTGAGTAGGAAGGG - Intronic
1121654991 14:95588504-95588526 CCTGGGGGCTGGAGGAGGATGGG + Intergenic
1121708592 14:96019949-96019971 CTCTGGGGATGGAGCAGGAAGGG + Intergenic
1121717311 14:96085419-96085441 CTCCTGGGCTGGGGCAGGAAGGG + Intronic
1122179840 14:99947020-99947042 CCGCGGGGCTGGAGGGGGCTTGG - Intergenic
1122365478 14:101192587-101192609 CTGGGGGCCTGGAGAAGGAAAGG + Intergenic
1122912263 14:104836713-104836735 CTGCGGAGCTCGCGGAGGCAAGG - Intergenic
1123067972 14:105627784-105627806 GTGGGGGGCAGGAGGAGCAAGGG - Intergenic
1124013607 15:25859180-25859202 GGGCAGGGCTGGAGGAGGAGAGG - Intronic
1124439242 15:29674940-29674962 CAGCGGGGCTGGCGGAGGGGCGG - Intergenic
1124616877 15:31248482-31248504 ATTGGGGGCTGGGGGAGGAAGGG + Intergenic
1125500692 15:40238908-40238930 CTGAAGGGGAGGAGGAGGAAGGG - Intronic
1125584886 15:40813163-40813185 CTGCAGGGCTGGGGCAGGCAGGG + Intronic
1125720443 15:41842640-41842662 GTGCGGGGCTGGAGGAGGCCTGG + Intronic
1126087404 15:45023070-45023092 CTCCGGGTCTGGAGGAGGCTGGG + Intergenic
1127797610 15:62452017-62452039 CCTCGGGGCTGGAGGATGCATGG - Intronic
1128033358 15:64501007-64501029 TTGCAGGGCTGGAGGAGAATGGG + Intronic
1128096332 15:64959178-64959200 CTGAGGGGCAGGAGGGGGAGGGG + Intergenic
1128556936 15:68638182-68638204 CTGAGGGTCAGGAGGAGGGAGGG - Intronic
1128582018 15:68817620-68817642 CTGAGCGCCTGCAGGAGGAACGG + Intronic
1128607521 15:69047807-69047829 CTGAGGGGAGGCAGGAGGAAGGG - Intronic
1128716765 15:69914292-69914314 CTGCAGGGCAGGAGCAGGGACGG - Intergenic
1128926650 15:71662260-71662282 TTACGGGGGGGGAGGAGGAAGGG + Intronic
1129161850 15:73752058-73752080 AGGCGGGGCTGGGGGAGGGAGGG - Intronic
1129386714 15:75200494-75200516 GCGCGGTGCTGGAGGAGGAGGGG + Intronic
1130531584 15:84750808-84750830 CTGTGGGGCTGGAGGGGGAAAGG + Intronic
1130757761 15:86783957-86783979 CTGCTGGTTTAGAGGAGGAATGG + Intronic
1130758770 15:86795527-86795549 CTGAGGGGCTGGATGAGGAAGGG - Intronic
1130990278 15:88871905-88871927 CAGAGGGGATGGAGGAGGAAAGG - Intronic
1131579217 15:93625599-93625621 CTGAGGGGGAGGAAGAGGAATGG + Intergenic
1132670078 16:1098931-1098953 CTGTGGGGCTGGAGCAGACACGG + Intergenic
1132697384 16:1207990-1208012 CTGCGGGACAGAGGGAGGAATGG - Intronic
1133013949 16:2930398-2930420 CTGAGGGGCTGCTGGGGGAACGG - Exonic
1133110362 16:3544466-3544488 CTGCAGGGCCTGTGGAGGAAGGG - Intronic
1133246489 16:4452327-4452349 CTGATGGGCGGGAGGAGGGAAGG - Intronic
1133510536 16:6453249-6453271 GTGGGGGGCTAGAGGAGGGATGG - Intronic
1134610856 16:15606842-15606864 CTGTGGGGCTGAGGGAGCAAGGG - Intronic
1135587174 16:23679899-23679921 CCGCTGTGCTGGAGAAGGAATGG + Intronic
1136020006 16:27434254-27434276 CTCGAGGGCTGGAGGAAGAATGG - Intronic
1136375538 16:29863094-29863116 CTGCGGGGCTGGCAGAGGCGAGG - Exonic
1136418106 16:30115667-30115689 TTGTGGGGCTGGAGGATGCAAGG + Intronic
1136478591 16:30527453-30527475 CCGCGGGGTTGGAGGAGGCGGGG - Intronic
1137252964 16:46753261-46753283 GTGTGGGGCAGGAGGAGGGATGG - Intronic
1137253440 16:46756973-46756995 GTGAGGGGCAGGAGGAGGAAGGG + Intronic
1137786318 16:51140457-51140479 CTGGGGGGCTGGTGGCAGAATGG + Exonic
1137879777 16:52034051-52034073 CTGCTGGGATGGGGTAGGAAAGG + Intronic
1138134759 16:54512035-54512057 CTCGGGGGCGGGAGGAGGACGGG - Intergenic
1138448867 16:57081184-57081206 ATGAGGGGCCGGGGGAGGAATGG + Intronic
1138510815 16:57507616-57507638 CTGTGGGGCTTGAGGAAGACTGG + Intergenic
1138536730 16:57664164-57664186 CTGGGGGGCTGAGGGAGGGAGGG - Exonic
1138577140 16:57915256-57915278 CAGCGGGGCAGGCGGAGGAGGGG + Exonic
1139559879 16:67735150-67735172 CAGCAAGGCTGGAGGAGGCAGGG + Intronic
1139630619 16:68230003-68230025 ATGCAGGGCTGGGGGTGGAATGG - Exonic
1140067089 16:71620801-71620823 CTGCAGGGAGGGAGGAAGAAAGG - Intergenic
1140719568 16:77759051-77759073 CTGAGAGGGTGGAGAAGGAAGGG - Intergenic
1141053914 16:80798412-80798434 CTGAGGAGGAGGAGGAGGAAGGG - Intronic
1141105368 16:81229104-81229126 CTTCGGGGCTGGAGAAGGAAGGG - Intergenic
1141216970 16:82033759-82033781 ATGAGGGGCAGGAGGAGGAAGGG - Intergenic
1141464453 16:84196793-84196815 CTGCAGGGCTGGAGAGGGACCGG - Intronic
1141545655 16:84766476-84766498 CTGCTGGGCTGAAGGAGCAAAGG - Intronic
1141555397 16:84833848-84833870 CTGCTGGGCTGGGGGAGTCAGGG - Intronic
1141599827 16:85118894-85118916 CTGCTGGCCTGGAGGAAGATGGG - Intergenic
1141920879 16:87134550-87134572 TTCAGGGGCTGGAGGAGGGAAGG + Intronic
1142668698 17:1477472-1477494 CTGCGGGGCTGCTGGGGGCAAGG - Intronic
1142698052 17:1644304-1644326 CTGCTGGGCTGGAGGAGAGCTGG + Intronic
1143205336 17:5136778-5136800 CTGTGGGGCTGTAGGAGCAGGGG + Intronic
1143711512 17:8739193-8739215 CTGGTGGCCTGGATGAGGAAGGG + Intronic
1144728518 17:17513686-17513708 CTGAGGGGCTGGTGCAGGGAGGG + Intronic
1144750860 17:17647157-17647179 GTTCGGGGCTGCAGGGGGAAGGG + Intergenic
1145218543 17:21070093-21070115 CTGCAGGGCTGGGGTGGGAAAGG + Intergenic
1145275169 17:21424832-21424854 CTCTGTGGCTGGAGGAGAAAGGG + Intergenic
1145313023 17:21710730-21710752 CTCTGTGGCTGGAGGAGAAAGGG + Intergenic
1145761029 17:27425613-27425635 CTAGGGGGCTGGAGGAGCAGCGG + Intergenic
1145937494 17:28723492-28723514 CCGGAGGACTGGAGGAGGAAGGG + Intronic
1146161080 17:30559771-30559793 CTGGGGGGCTGGAGGAACAGCGG + Intronic
1146245898 17:31282507-31282529 CTGAGGGGGGGCAGGAGGAAAGG - Intronic
1146793069 17:35763984-35764006 CTGCGGGCCGGGAGGAGGTCAGG - Intronic
1146821170 17:35984524-35984546 CTGAGGGCATGGAGGAGGGAAGG + Intronic
1146842239 17:36164101-36164123 CTGCAGGGCTTGAGAGGGAACGG - Intergenic
1146854550 17:36252060-36252082 CTGCAGGGCTTGAGAGGGAACGG - Intronic
1146866070 17:36336316-36336338 CTGCAGGGCTTGAGAGGGAACGG + Intronic
1146870450 17:36375952-36375974 CTGCAGGGCTTGAGAGGGAACGG - Intronic
1146877807 17:36427033-36427055 CTGCAGGGCTTGAGAGGGAACGG - Intronic
1147068940 17:37936928-37936950 CTGCAGGGCTTGAGAGGGAACGG + Intergenic
1147073333 17:37976576-37976598 CTGCAGGGCTTGAGAGGGAACGG - Intergenic
1147080464 17:38016465-38016487 CTGCAGGGCTTGAGAGGGAACGG + Intronic
1147084854 17:38056114-38056136 CTGCAGGGCTTGAGAGGGAACGG - Intronic
1147096411 17:38140425-38140447 CTGCAGGGCTTGAGAGGGAACGG + Intergenic
1147100802 17:38180080-38180102 CTGCAGGGCTTGAGAGGGAACGG - Intergenic
1147307040 17:39571170-39571192 CTGAGGGGCTGAAACAGGAAGGG - Intergenic
1147558197 17:41492966-41492988 CTTGGGGGCAGGAGGAAGAAGGG + Intergenic
1147898791 17:43770003-43770025 CTGCGTGGCTGGGGGAGGTGAGG + Intronic
1148053837 17:44781921-44781943 CTGGGGTGCTGGAGGCGGGAAGG + Intergenic
1148103226 17:45105368-45105390 CTGTGGCACTGGGGGAGGAAGGG - Intronic
1148111928 17:45149363-45149385 GTCCGGGGCCGGAGGGGGAAGGG + Exonic
1148442938 17:47721144-47721166 CTGGAGGGGTGGAGGGGGAAGGG + Intergenic
1148496544 17:48056320-48056342 CTGAGGGGCAGGACAAGGAAGGG + Intronic
1148552453 17:48558597-48558619 CTGGGAGGCTGGAGGACGGAGGG + Intronic
1148763643 17:50022869-50022891 CGGCTGGGCTGGAGGAGGTCAGG - Intergenic
1148792417 17:50180853-50180875 CTGGGTGGGTGGAGGAGGAGAGG - Intergenic
1148852014 17:50560150-50560172 CTGCGGGACTGGGGGAGGGAAGG - Intergenic
1149857907 17:60099487-60099509 TTATGGGGCAGGAGGAGGAAAGG + Intergenic
1150106288 17:62464812-62464834 TGGAGGGGCTGGAGGGGGAAAGG + Intronic
1150288222 17:63966043-63966065 CTGCAGGGATGGAGGGGGAGTGG + Intronic
1150636488 17:66916743-66916765 ATGCGAGGCTGGAGAAGTAAAGG + Intergenic
1151171234 17:72247943-72247965 GAGTGGGGTTGGAGGAGGAAGGG - Intergenic
1151370805 17:73645097-73645119 CTCCCGGGCCGGAGGAGCAACGG + Intergenic
1151537467 17:74747048-74747070 CTGCCGGCCTGGAGGGGGAGAGG + Exonic
1151679346 17:75615391-75615413 CTCTGGGACTGGAGGAGGGAGGG + Intergenic
1151708424 17:75785087-75785109 GGGCCGGGCCGGAGGAGGAAGGG - Intronic
1152081477 17:78190227-78190249 AGGCTGGGCTGGAGGAGGAGGGG - Intronic
1152223971 17:79084236-79084258 TTGGGGGGCTGGGGGAGGATGGG - Intronic
1152345583 17:79748608-79748630 CTGTGGGGTTGGAGGAGGGATGG + Intergenic
1152690461 17:81715598-81715620 CTGCCGGGCGGGAGGGGGAGGGG + Intronic
1153285195 18:3450093-3450115 CGGCGGGGCGGGAGGGGGACGGG + Intronic
1153774889 18:8443666-8443688 CTGAGGGGCATGATGAGGAATGG + Intergenic
1153927135 18:9843963-9843985 CTCTGGGGCAGGTGGAGGAAGGG + Intronic
1153959762 18:10130818-10130840 CTGCAGGCCTAGAGTAGGAAGGG - Intergenic
1155168236 18:23248107-23248129 CTGCGGCTCTGGAGGGGGCAAGG - Intronic
1155257719 18:24013992-24014014 CAGTGGGGCAGGAGGAGAAATGG - Intronic
1156454643 18:37286109-37286131 CTGCAGGGGAGGAGGAGGACAGG + Intronic
1157406722 18:47428025-47428047 CTGCAAAGCTGGAGGAGGAGAGG + Intergenic
1157518654 18:48329444-48329466 CTGAGGGGCTGCAGAAGGAAAGG + Intronic
1158551046 18:58436632-58436654 CTGAGTGACAGGAGGAGGAATGG + Intergenic
1159115090 18:64104884-64104906 CACAGGGCCTGGAGGAGGAAGGG - Intergenic
1159388655 18:67759553-67759575 CTGCTGGGTTGGAGCAGGGAAGG - Intergenic
1159511743 18:69402978-69403000 GTGCAGAGCTGGAGGTGGAAGGG + Intronic
1160255966 18:77249558-77249580 CTGGGGAGGAGGAGGAGGAAAGG + Intergenic
1160622560 18:80181114-80181136 CTGCGGGGGTGGGCCAGGAAGGG + Intronic
1160803027 19:979335-979357 CAGCGTGGCTGGAGGTGGACAGG + Intergenic
1160896047 19:1402387-1402409 CTGCAGGGCCGCCGGAGGAAAGG - Intergenic
1161409462 19:4108810-4108832 CTGCCGGGCGCGAGGAGGAGGGG + Intronic
1161477797 19:4496056-4496078 CTGCTGGGCAGGAGGAGTGAAGG + Intronic
1161535756 19:4817710-4817732 CTGCGGTGCAGGCTGAGGAAGGG + Exonic
1161717439 19:5884534-5884556 GTCAGGGGCTGGGGGAGGAAGGG + Intronic
1161779288 19:6280145-6280167 CGGAGGGGCGGGAGGAGGGAGGG + Intergenic
1162029043 19:7909591-7909613 CTGCTGGGCTGGAGGAGCTGGGG - Intronic
1162214246 19:9119395-9119417 GTGAAGGGCTGGAGGAGGCAGGG - Intergenic
1162744540 19:12791276-12791298 CGGCGGGGCTGCAGGGGGAGGGG - Intronic
1163312093 19:16520844-16520866 ATGCGGGCCCGGCGGAGGAAAGG - Exonic
1163350000 19:16770607-16770629 CTGTGGGGCAGGGGGAGGGATGG - Intronic
1163364792 19:16869830-16869852 GTGCGGGGCTGGGGGCGGCAGGG - Exonic
1163639138 19:18451584-18451606 CTGGGGGGCTGGAGGCAGCAGGG + Exonic
1164655953 19:29922004-29922026 CTCCGGAGCTAGAGAAGGAATGG - Intergenic
1165013848 19:32866797-32866819 CAGAGGGGATGGAGGAGGGACGG - Intronic
1165027016 19:32969572-32969594 CTGCAGGGATGGAGGGTGAAGGG + Intronic
1165245526 19:34496500-34496522 CTGCGGGGCAGGAAAAGGACAGG - Intronic
1165305426 19:35000261-35000283 CGGCGGGGCGGGGGAAGGAAGGG + Intronic
1165335751 19:35168559-35168581 CTGAGGGGCTGGAGGAGGCAAGG + Intronic
1165636507 19:37344753-37344775 TTCCGGGGCTGGAGGAATAACGG + Exonic
1165721051 19:38080021-38080043 CTGCGGGGCTTGTGGAGCAGGGG + Intronic
1165864053 19:38925338-38925360 CTGTGGGGAAGGAGGAAGAAGGG - Intronic
1166151757 19:40880245-40880267 CTGCGGGTGTGGAGGGAGAAGGG + Intronic
1166211098 19:41306927-41306949 CTGAGGGGCTGGAGCAGGGTTGG - Exonic
1166984246 19:46649936-46649958 CTTCCGGGCTGGATGAGAAATGG - Intronic
1167040780 19:47021393-47021415 CTGGTGGGAAGGAGGAGGAAGGG - Intronic
1167401049 19:49269695-49269717 CTGAGGGAGAGGAGGAGGAAGGG - Intergenic
1167590737 19:50403030-50403052 CTGCGAGGCAGGAGGATGCAGGG - Intronic
1167737017 19:51300919-51300941 CAGAGGGGATGGAGGAGGGATGG + Intergenic
1168072203 19:53959492-53959514 GTGCGGAGCTGGAGGACGAGAGG - Intergenic
1168231963 19:55038336-55038358 GGCCGGGGCTGGTGGAGGAAGGG - Intergenic
1168710667 19:58498300-58498322 CTGCGTGGATGAAGGAGCAATGG - Intronic
1168714299 19:58518158-58518180 CAGCAGGGGTGGAGGAGGAGTGG - Intronic
925083068 2:1084822-1084844 TTGGGTGGCGGGAGGAGGAAGGG + Intronic
925742793 2:7020297-7020319 CAGCGGAGGTGGAGGTGGAAGGG + Intronic
925996962 2:9301363-9301385 CTGCGGTGATGCAGGATGAAAGG + Intronic
926739701 2:16101229-16101251 GTTCATGGCTGGAGGAGGAAGGG - Intergenic
927080949 2:19630137-19630159 GTTGGGGGCTGGAGGAGGTAAGG + Intergenic
927475434 2:23410957-23410979 ATGAGGGGCTGGGGGAGGAAGGG - Intronic
928298205 2:30103678-30103700 CTGCAGGGCTGTGGGAGGAAAGG + Intergenic
928549105 2:32354595-32354617 CTGTGGGGCTGGAGTGAGAAGGG - Intergenic
928609037 2:32973724-32973746 GTGAGGGGCTGGAGGAGAAGTGG - Intronic
928781794 2:34831395-34831417 ATGGGGGGATGGAGGAGGAGTGG + Intergenic
929083625 2:38146749-38146771 CTGCGGGGGTGGCGGGAGAAGGG - Intergenic
929564382 2:42975442-42975464 CTGGAGGGCTGGAGGAAGACAGG - Intergenic
929575017 2:43046172-43046194 CTTCAGGGATTGAGGAGGAAAGG - Intergenic
929788123 2:45006355-45006377 GTGCGGGGCTGGATGATGAGTGG + Exonic
930018734 2:46987984-46988006 CTGCAGGGCTAGGGGAGGACAGG + Intronic
930070416 2:47361638-47361660 CTGCGTGTCTGAAGGAGGAGAGG - Intronic
930119243 2:47746635-47746657 TTGCATGGCTGGAGTAGGAAGGG - Intronic
931116938 2:59175091-59175113 CTGCGGGTCTGGAGGAGCAGCGG - Intergenic
931665628 2:64608201-64608223 CTGCGAGGTGGGTGGAGGAAAGG - Intergenic
931868994 2:66439646-66439668 CTTCAGGGCTCCAGGAGGAAGGG + Intronic
932716892 2:74107219-74107241 CTGCAGCTCTGCAGGAGGAAGGG - Exonic
934559164 2:95303440-95303462 CTGCGGGAATGTAGGAGGCAGGG - Intronic
934649904 2:96084819-96084841 CTGCTGGGCTGGAGGAGGCAAGG + Intergenic
935485043 2:103643146-103643168 CAGAGGGGTTGGAGGAGGTAAGG - Intergenic
935639239 2:105275072-105275094 TTGTGGGCCTGGAGGAGGGAGGG - Intronic
935939043 2:108219741-108219763 CTGTGGGGAGGGAGGAGGAAAGG + Intergenic
936078764 2:109418265-109418287 CAGGGAGCCTGGAGGAGGAAGGG - Intronic
936345744 2:111673668-111673690 TTGCAGGGCTGGGGGTGGAATGG - Intergenic
937206207 2:120238696-120238718 CAGTGGGGCAGGAGGAGGACAGG + Intergenic
937207562 2:120246270-120246292 CCTGAGGGCTGGAGGAGGAAGGG + Intronic
937253600 2:120539796-120539818 CGGCAGAGCTGGAGGAGGATCGG + Intergenic
937457586 2:122055786-122055808 CAGTGGGGCTGGTGGGGGAAAGG - Intergenic
937559677 2:123206284-123206306 CAGGGGGTATGGAGGAGGAATGG + Intergenic
937899863 2:127011692-127011714 CTGGGGGAGGGGAGGAGGAAAGG - Intergenic
937905406 2:127050555-127050577 GTGCAGGGCTGGAGGTGGGACGG - Intronic
938406970 2:131038226-131038248 CTGCAAGGCTGCAGGAGGGAGGG - Intronic
938406992 2:131038317-131038339 CTGCAAGGCTGCAGGAGGGAGGG - Intronic
938407003 2:131038348-131038370 CTGCAAGGCTGCAGGAGGGAGGG - Intronic
938407040 2:131038499-131038521 CTGCAAGGCTGCAGGAGGGAGGG - Intronic
938407049 2:131038530-131038552 CTGCAAGGCTGCAGGAGGGAGGG - Intronic
938415447 2:131100259-131100281 CAGGTGGGCTGGAGGAGAAAGGG + Intergenic
938952730 2:136270348-136270370 CTGGAGGGCAGGAGGAGGGAGGG + Intergenic
940420049 2:153470380-153470402 CTGGGTGGCTGCAGGAAGAAGGG - Intergenic
940855067 2:158723309-158723331 CTGTGGGGGTGGAGGACAAATGG - Intergenic
941034488 2:160553369-160553391 CTCCGGGGCTGGAAGAACAAAGG + Intergenic
941494203 2:166180860-166180882 CTGGGGCGGTGAAGGAGGAAGGG + Intergenic
941773989 2:169371932-169371954 GTGGGGGGCAGGAGGAGGGAGGG + Intergenic
942744664 2:179217984-179218006 TTGCGGGGCTGGGGGAGGGATGG + Intronic
945056041 2:205869772-205869794 CTGGGGGATGGGAGGAGGAAAGG + Intergenic
945080683 2:206084949-206084971 CTGGGGGGCTCTAGGGGGAAGGG + Intronic
945119826 2:206445292-206445314 ATGCGGAGCTGGTGGAGGTAGGG - Exonic
945614784 2:212054068-212054090 CTGTGGGGCAAGAGGAGGAGGGG - Intronic
946137530 2:217659904-217659926 CTGAGGGGGAGGAGGTGGAATGG + Intronic
946201570 2:218073609-218073631 GTGGAGGGCTGGAGGATGAATGG + Intronic
946419536 2:219557252-219557274 AAGCGGGGGTGGAGGAGTAAGGG + Intronic
947363431 2:229369564-229369586 CTGTGGTGGTGGAGGAGGGAAGG + Intronic
947720286 2:232365823-232365845 CAGCTGGGCTGGAGGGGGAAGGG + Intergenic
948055563 2:235007380-235007402 CTGGGGGGCTGGGAGAGGCAAGG - Intronic
948528837 2:238589992-238590014 CTGGGGGGCTGGGAGAGGACTGG + Intergenic
948534329 2:238634904-238634926 CTGCCGCGATGGAGGAGGAATGG - Intergenic
1168895333 20:1319988-1320010 GTGCTGGGATGGAGGAGGAAGGG + Intronic
1169251023 20:4061179-4061201 CTGCAGGGCAGGAGGCGGTAAGG - Intergenic
1169656066 20:7924465-7924487 ATGCTGGGCTTGATGAGGAAGGG + Intronic
1170204569 20:13784643-13784665 CTGCGGTACAGGAGGTGGAAAGG - Intronic
1171093229 20:22306000-22306022 CTGAGGGGCTGGAGCGGGAAAGG + Intergenic
1171188852 20:23144074-23144096 CTGCAGGGCTGGCTGAAGAATGG + Intergenic
1171283412 20:23919477-23919499 CTGCTGGACTGGAGGAGGGCTGG - Intergenic
1172295978 20:33811489-33811511 GTTCGGGGCTGGAGGGGGTAAGG + Exonic
1172447434 20:35000577-35000599 CTGCGGAGCTGGAGGAGCTGCGG + Exonic
1172519104 20:35555939-35555961 CTGCGGAGATGTGGGAGGAAGGG - Intronic
1172563136 20:35906854-35906876 ATGCAGGGCTTGAGGAGGGAGGG + Intronic
1173006143 20:39141219-39141241 CTGGTGGCATGGAGGAGGAAGGG - Intergenic
1173837658 20:46136345-46136367 TTGGGGGTCAGGAGGAGGAAGGG + Intergenic
1173860691 20:46281328-46281350 CTGGGGGACTGGAGGAGGCCAGG + Intronic
1174166383 20:48586491-48586513 CTGCAGGGGTGGAGCAGGAGTGG - Intergenic
1174390478 20:50215848-50215870 CTGGGGGGCTGGGGGTGGGAGGG + Intergenic
1174767206 20:53265487-53265509 CTGCGGGGCTGGAGGAGGAAAGG - Intronic
1175217270 20:57398123-57398145 CTTGGGGGATGGAGGAGGTAGGG + Intronic
1175237618 20:57525310-57525332 CTGGGGGGGTGGATGAGGAGGGG + Intronic
1175798664 20:61788328-61788350 CTGAGGGGCTGGGGGAGGGCTGG + Intronic
1175844095 20:62049625-62049647 GTGCGGGGCTGGGGCAGGCAGGG - Intronic
1175871130 20:62210051-62210073 CAGCAGGGCTGGAGCAGGGAGGG - Intergenic
1176107352 20:63395675-63395697 AGGCGGGGCTGGAGGTGGACTGG + Intergenic
1176111221 20:63411598-63411620 CTGGGGCCCTGGTGGAGGAAGGG + Intronic
1178698058 21:34810973-34810995 CTGCTGCTCTGCAGGAGGAAGGG - Intronic
1178789973 21:35690887-35690909 CTGAAGGGGTGGGGGAGGAAGGG - Intronic
1179286910 21:39985347-39985369 ATGCAGGGATGGAGGAAGAAGGG - Intergenic
1179540244 21:42079159-42079181 CTGCAGAGCGGGAGCAGGAAGGG - Intronic
1179569441 21:42269409-42269431 TAGCGGGGCTGGAGGAGGACCGG - Intronic
1179787400 21:43737647-43737669 CTGCGGGGCTGGAGAAGGCCAGG + Intronic
1179838987 21:44058175-44058197 GTGCGGGTCAGGAGGAGGAAAGG + Intronic
1180075425 21:45459280-45459302 GTGAGGGGCAGGAGGAGGAGGGG + Intronic
1180098358 21:45572254-45572276 ATGGGGGGCTGGAGGAGGCAAGG + Intergenic
1180177809 21:46098647-46098669 CGGCGGGGCGGGGGGAGGAGGGG + Intronic
1180225431 21:46389199-46389221 CTCCGGCGCTGGAGGAGACATGG + Exonic
1180751776 22:18129703-18129725 CTGAGGGGCTGGTGTGGGAATGG - Intronic
1181532139 22:23522796-23522818 CGGCCGGGCTGGTGGGGGAAGGG - Intergenic
1181590629 22:23882886-23882908 CCACAGGGCTGGTGGAGGAAGGG - Intronic
1181682863 22:24507936-24507958 TTGGGGGGCTGGAGGAGGTGGGG - Intronic
1181781193 22:25194748-25194770 CTGTGGTGCTGGAGGAGACAAGG - Exonic
1181793235 22:25283499-25283521 CTGAGGGGATGGAGTTGGAAAGG - Intergenic
1182051042 22:27313096-27313118 GTGTGGGGGAGGAGGAGGAAAGG + Intergenic
1182443990 22:30379814-30379836 CTACAGGGGTGGGGGAGGAAGGG + Intronic
1183269156 22:36849947-36849969 CTGTAGGGATGGAGGAGGAGAGG + Intergenic
1183354173 22:37349600-37349622 GGGCAGGGCAGGAGGAGGAAGGG - Intergenic
1183403971 22:37620858-37620880 CTTCGGCCGTGGAGGAGGAAGGG - Exonic
1183585535 22:38751005-38751027 CTGCGGGTGCGGAGGAGGAGAGG - Exonic
1183728871 22:39605831-39605853 CTGAGGGGGTGCATGAGGAAGGG + Intronic
1183762324 22:39833048-39833070 CTGGGGGACAGGAAGAGGAAGGG - Intronic
1184021997 22:41827099-41827121 CTACGGGGCTGCAGCAGCAAAGG + Intergenic
1184332848 22:43836971-43836993 CTGCGAGGCTGGAGGGCAAAGGG - Intronic
1184363293 22:44031550-44031572 TTTCGGGGCTTGGGGAGGAAGGG + Intronic
1184748977 22:46473373-46473395 CTGAGGACATGGAGGAGGAAAGG + Intronic
1185041372 22:48506165-48506187 GTGCGGGGCTGCAGGAGGAGGGG - Intronic
1185280050 22:49966153-49966175 CTGGGGGGCTGGAGGGGGCCAGG - Intergenic
949509995 3:4759227-4759249 TTGCAGGGCTGGGGGAGGATGGG + Intronic
950483631 3:13260091-13260113 TTGCAGGGCTGGAGGAAGAGGGG + Intergenic
950627511 3:14259079-14259101 CTGCGGGGCTGGTGGAGGCAAGG - Intergenic
950642663 3:14358590-14358612 TTGCGGAGCCGCAGGAGGAACGG - Intergenic
950771867 3:15318240-15318262 CTAAGGGGCTGGAGGAGGAAAGG + Intronic
951279685 3:20732408-20732430 CTGGGGGGATGGAGGAGGGATGG + Intergenic
952433844 3:33252406-33252428 GTTTAGGGCTGGAGGAGGAATGG - Intergenic
952860175 3:37806522-37806544 GTGGTGGGCTGGAGGAGGCAGGG - Intronic
952952891 3:38538843-38538865 CTGGGAGGCTGGGAGAGGAAGGG - Intronic
952963293 3:38606141-38606163 CTGAGGGTCTGGGGGAGCAAGGG + Exonic
953044088 3:39280216-39280238 CTGCGGAGCTGGAGGGAGAGAGG + Intronic
954047706 3:47947302-47947324 CTGGGTGCCAGGAGGAGGAAGGG - Intronic
954612884 3:51955535-51955557 GTGAGGGGCCGGAGGAGCAAGGG + Exonic
954861632 3:53695436-53695458 GGGCGGGGCAGGAGGAGGGATGG - Intronic
956066372 3:65401369-65401391 GTGGGGGGCTGGAGGTGGGAGGG - Intronic
956389904 3:68760507-68760529 GTGCTGGGCAGGAGGAGGAAGGG - Intronic
957164028 3:76647328-76647350 CTGAAAGGCTAGAGGAGGAAGGG - Intronic
957835127 3:85577448-85577470 CTGCATGGCAGAAGGAGGAAGGG - Intronic
958802899 3:98777131-98777153 CTGCCAGCCAGGAGGAGGAAAGG + Intronic
960038362 3:113124352-113124374 CTGCTGGGCTGGGAGAGGGAGGG + Intergenic
960937377 3:122912244-122912266 GTGCGGGGCTGGTGCAGGAACGG + Exonic
961774963 3:129278334-129278356 CTGAGGGGCTGGGGCAGGAAAGG + Intergenic
962023263 3:131522194-131522216 CTGGTGGGGTAGAGGAGGAATGG + Intergenic
962751192 3:138435612-138435634 CCGCGGGGCTGGAGGTGGAGTGG + Intronic
966381801 3:179352114-179352136 TTGCGGGGCTGGGGGAGGATGGG - Intronic
966711942 3:182980511-182980533 CTGCGGAGCCGGAGGAGGAGGGG - Exonic
968043843 3:195612440-195612462 GGGCGGGGCTGGAGGAGGGCTGG + Intergenic
968224841 3:196967139-196967161 CTGCGGGGCGGGAGGAGGGGAGG + Intronic
968446585 4:655287-655309 CCGTGGGGCTGGAAGAGGAGGGG + Intronic
968619524 4:1597516-1597538 CTGGGGGTCTGGAGCAGGCAGGG - Intergenic
968701890 4:2061324-2061346 CAGCGGGGCTGGGGGAGGCACGG + Intronic
968729713 4:2263938-2263960 CTGTGGGGCGGGAACAGGAAGGG - Intergenic
968850427 4:3074375-3074397 CGGCGAGGCGGGACGAGGAAGGG - Intergenic
969116396 4:4872986-4873008 CAGCCGGGCTGGGGGAGGCAGGG + Intergenic
969308569 4:6339378-6339400 GTGAGGGGCTGGAGCAGAAACGG - Intronic
969737218 4:8999934-8999956 CTGTGGGGCTGGAGCATGGAGGG - Intergenic
970654155 4:18212948-18212970 CTGCTGTGCTGGAGGAGCCAAGG + Intergenic
973907568 4:55546688-55546710 CTCCTGGGCTGGTGGAGGAGGGG - Intronic
975685172 4:76913558-76913580 TTGGGGGGTTGGAGGAAGAAAGG - Intergenic
976291806 4:83426347-83426369 CTGAGGGGAAGGAGAAGGAAAGG + Intronic
977177504 4:93834862-93834884 CTGCGCAGCTGGGGGAGGAGAGG - Intergenic
977223428 4:94365972-94365994 TAGCGGAGGTGGAGGAGGAAGGG - Intergenic
979610810 4:122687057-122687079 CTGGGGGGAGGGAGAAGGAATGG + Intergenic
979631058 4:122903678-122903700 CTGCAAGGCTGGAGGAGGAAGGG + Intronic
981044322 4:140252201-140252223 CAGCAGGGCAGGAGGAGGATGGG + Intergenic
981346862 4:143685867-143685889 GTGGGGGCCTGGAGGAGGGATGG + Intronic
981429886 4:144646227-144646249 CGGCGGGGCAGGCGGAGGCAGGG - Exonic
983604082 4:169565793-169565815 CTGCGGGGTTGGGGGAAGAATGG + Intronic
984829589 4:183959469-183959491 CTGCGGGGGAAGGGGAGGAACGG - Intronic
984866107 4:184282064-184282086 CTGAGAGGTTGCAGGAGGAAGGG + Intergenic
985223389 4:187732041-187732063 CTGAGGGGGAGGAGGAGGACGGG - Intergenic
985540716 5:486213-486235 CCTCGGGGCTGGGGGAGGATGGG + Intronic
985611377 5:891534-891556 CTGCGTGGCTGGAGGAGGGGAGG - Intronic
985670995 5:1206641-1206663 CTGGGGGGCGGGAGGATGATGGG + Intronic
985840150 5:2299967-2299989 CTGCTGGAGTGGAAGAGGAAAGG - Intergenic
986599410 5:9456626-9456648 CAAAGGGGCTGGAGGAGAAAAGG + Intronic
986645423 5:9912150-9912172 CTGCTGGGCTGGGGGAGGCCAGG - Intergenic
988613722 5:32752757-32752779 CTGAGGTGTTGCAGGAGGAATGG + Intronic
988778328 5:34496980-34497002 CAGATGGGCTGGAGCAGGAAAGG + Intergenic
989332030 5:40270993-40271015 CTGAGGGTCTGGAGTAGTAAAGG - Intergenic
992080649 5:73232681-73232703 ATGCGGGGCTGGAGGAAGAGTGG - Intergenic
992760939 5:79950546-79950568 GAGAGGGGCTAGAGGAGGAATGG - Intergenic
993228677 5:85204096-85204118 CTACTGTGCTGGAGGAGCAAAGG + Intergenic
993899124 5:93572506-93572528 CTGCGGGGAGCGAGGAGGGACGG - Intergenic
995043822 5:107621217-107621239 CTGGGGGGCTGGAGTAAGAGAGG + Intronic
996101841 5:119452500-119452522 CTGCGGGACAGGAGGAGGCGGGG - Intronic
997035758 5:130189517-130189539 CTGTTGGGGTGGAAGAGGAAAGG - Intergenic
997592791 5:135086100-135086122 CCACGGGGCTGGTGCAGGAAAGG - Intronic
997673243 5:135693768-135693790 CTGAGGGAATAGAGGAGGAAGGG + Intergenic
997716890 5:136049193-136049215 CTTGGGGGCAGGAAGAGGAAAGG + Intronic
998159664 5:139806271-139806293 CAGCAGGGCTGGAGGTGGGAAGG + Intronic
998349032 5:141489015-141489037 CTGGGGAGCTGGAGGAGGAGAGG - Intronic
998399477 5:141841097-141841119 CTGAGGGGTTGTAGGAGGGAGGG - Intergenic
998788871 5:145744236-145744258 CTGCTGGTCTGCAGGAGAAAAGG - Intronic
999627580 5:153536522-153536544 ATGCTGGGCTGGAGGAGGTTAGG - Intronic
1000679985 5:164171622-164171644 CTGGGGGGCTGGAGGTGGGGTGG - Intergenic
1001234775 5:170020168-170020190 CTGCGGGGATGGTGGAGAAGAGG - Intronic
1001746923 5:174099322-174099344 CTGCGAGACAAGAGGAGGAAGGG - Intronic
1001827944 5:174761352-174761374 GTGGGGGGCTGGGGGAGGAATGG - Intergenic
1001831309 5:174791473-174791495 CTGTAGGGCTGGAGAAGGAGGGG - Intergenic
1001928652 5:175657737-175657759 CTGCGGGGCGGGGAGAGGGAAGG + Intergenic
1002132834 5:177091957-177091979 GTGTGGGGCTGGAGGAGCAGAGG + Intronic
1002558497 5:180063025-180063047 CTGGGGGTGGGGAGGAGGAAGGG + Intronic
1002802827 6:542427-542449 CTTCGGGAATGGAGGAGGAGAGG + Intronic
1002897685 6:1389158-1389180 CGGCGGGCCAGGAGGAGGAAGGG + Intergenic
1003485203 6:6569591-6569613 CTGGGGAGCAAGAGGAGGAATGG + Intergenic
1003567988 6:7236576-7236598 CTGCAGGGGTGGAGGAGCAATGG + Intronic
1003593136 6:7452714-7452736 ATGGGGAGCTGGAGGGGGAATGG - Intergenic
1004919904 6:20366716-20366738 CTGCGGGGATGGGGGTGGAGTGG + Intergenic
1005260856 6:24057829-24057851 AGGCAGGGCTGGAGGATGAAAGG - Intergenic
1005925758 6:30444221-30444243 CAGTGGAGCAGGAGGAGGAAGGG - Intergenic
1006146735 6:31963898-31963920 CCGCGGTCCTGGAGAAGGAAGGG - Exonic
1006318390 6:33304517-33304539 CTGGGGGCCTGGAGGTGGAGTGG - Exonic
1006510260 6:34517550-34517572 CTGCCAGGCTTGAGGAGCAAGGG - Intronic
1006513316 6:34533081-34533103 CGGTGGGACTGGAGGAGGAACGG + Exonic
1006517316 6:34552199-34552221 ATGCGGGGCTGGAGGAGGGTAGG - Intronic
1006671018 6:35729746-35729768 CTATGGGGCTGGAGGGGAAAGGG - Intergenic
1006793919 6:36720451-36720473 CTGGGCGGCTGGAGGAGGTGCGG + Exonic
1007368045 6:41408282-41408304 CTGGGTGGGTGAAGGAGGAATGG - Intergenic
1007673518 6:43576107-43576129 GGGCGGGGCGGGAGGCGGAAGGG + Intergenic
1007782875 6:44264299-44264321 ATCTGGGTCTGGAGGAGGAAGGG + Intronic
1007878984 6:45140656-45140678 CTGCTGTGCTGGAGGTGGCAGGG - Intronic
1007975696 6:46098978-46099000 CTGCGGGGGTGGGGGTAGAAGGG + Intergenic
1008876680 6:56337338-56337360 CTGCAAGGCTGGAGAATGAAAGG + Intronic
1009861539 6:69340752-69340774 GTGGGGGGCTAGAGGAGGGATGG - Intronic
1011099598 6:83708022-83708044 CCGCGCGGCTGGAGGAGGCAAGG - Intronic
1011746937 6:90415250-90415272 CGGCCAGGGTGGAGGAGGAAGGG - Intergenic
1012056645 6:94420623-94420645 GTGAGGGGCTGGGGGAGGGATGG + Intergenic
1012134171 6:95535332-95535354 CTGCTGGGGTGGAGGAGAAAAGG - Intergenic
1012472725 6:99589459-99589481 CTGAGAAGCTGGAGGAGGACCGG + Intergenic
1012525320 6:100170202-100170224 CTGAAGGGGTGGAGGGGGAAGGG - Intergenic
1013039944 6:106423654-106423676 CTGGAGGGCTGGAGGAGAAGAGG - Intergenic
1015825552 6:137307216-137307238 CAGCTGTGCTGGATGAGGAAAGG + Intergenic
1015838399 6:137448022-137448044 CTGAGGGGATAGAGGAGGAAAGG + Intergenic
1015888599 6:137946296-137946318 CTGTGGAGCTTGAGGTGGAAGGG + Intergenic
1016255519 6:142100535-142100557 CCAGGGGACTGGAGGAGGAAAGG + Intergenic
1016454556 6:144216815-144216837 CTGCGGGGCGGGAGGCGGCCGGG + Intergenic
1018737775 6:166701634-166701656 CTGCGGGGAGGGAGGAGTCATGG + Intronic
1018743654 6:166748469-166748491 GTGCGGGGCTGGAGGATGCTGGG + Intronic
1018762898 6:166906494-166906516 CTGCGGGGCTGCAGGACCACGGG - Intronic
1018920332 6:168168041-168168063 ATGCGGGGGTGCAGGAGGATGGG + Intergenic
1018984260 6:168623895-168623917 CTGTGGGGATGGCAGAGGAAGGG + Intronic
1019188542 6:170236117-170236139 CAGGGGGGTTAGAGGAGGAAGGG - Intergenic
1019266495 7:120109-120131 CAGTGGGGCTGGAAGAGGAGTGG - Intergenic
1019716480 7:2541684-2541706 CTGCTGGGCTGCATGAGGACCGG + Intronic
1019767704 7:2863725-2863747 CTCCGGGCCTGGAGGAGGCTCGG - Intergenic
1020037510 7:4973841-4973863 CCACGAGGCTGGAGGATGAAAGG - Intergenic
1021802048 7:24316837-24316859 CTGTAGGGCTGGAGGGGCAAGGG - Intergenic
1021883622 7:25116987-25117009 CTGAGAGGCTGGCCGAGGAAGGG + Intergenic
1022020862 7:26398512-26398534 GCCCGGTGCTGGAGGAGGAAGGG - Intergenic
1022181354 7:27923641-27923663 CTGGGGGGCTGCAGGGGGAATGG - Intronic
1022221965 7:28322583-28322605 GTGGGGGGCTGGGGGAGGGAGGG - Intronic
1022276213 7:28857379-28857401 GTGTGGGGGTGGAGAAGGAAGGG + Intergenic
1022446688 7:30476831-30476853 CAGCAGGGCAGGAGAAGGAATGG + Intronic
1022574294 7:31482664-31482686 CGGAGTGGCTGGAGGAAGAAAGG + Intergenic
1022972789 7:35532555-35532577 GTGCGGGGTGGAAGGAGGAATGG + Intergenic
1023850103 7:44145731-44145753 CTGCGGGGCGGGAGGAGGTAGGG + Intronic
1024353973 7:48395605-48395627 CTGAGGAGGAGGAGGAGGAAGGG - Intronic
1026771290 7:73201581-73201603 CTGGGGGGCTGGAAGACAAAGGG - Intergenic
1026907137 7:74069026-74069048 CTGGGGGGAGGGAGGAGGGAAGG + Intronic
1026934088 7:74242060-74242082 CTGCAGGGAGGGAGGTGGAAGGG + Intronic
1027012157 7:74754978-74755000 CTGGGGGGCTGGAAGACAAAGGG - Intronic
1027075884 7:75191076-75191098 CTGGGGGGCTGGAAGACAAAGGG + Intergenic
1027554578 7:79647816-79647838 CTGCTGCGCTGGAGGAGTCAAGG + Intergenic
1029421575 7:100474579-100474601 CTCCAGAGCTGGAGGAGGGAAGG - Intronic
1029459253 7:100685984-100686006 CCGAAGGGCTAGAGGAGGAAGGG - Exonic
1029502431 7:100940745-100940767 CTGGCGGGCTGGGGGAGGGATGG - Intergenic
1029574664 7:101395558-101395580 CAGCGGGGCTGGAGGGAAAATGG + Intronic
1029596930 7:101542876-101542898 CTTGGGGGATGGAGGAGGAGGGG + Intronic
1029657171 7:101934935-101934957 GTGAGGAGCAGGAGGAGGAAGGG + Intronic
1029905864 7:104093021-104093043 CAGTGGGGCTGGAGGAGACAAGG + Intergenic
1031729712 7:125283974-125283996 CTGCGTGCCTGTAGAAGGAAAGG + Intergenic
1032002014 7:128271690-128271712 CCGCGGGGCTGGTGGTGGGAGGG + Intergenic
1032035353 7:128517400-128517422 TGGAGGGGCTGGAGGGGGAAAGG + Intergenic
1032225994 7:130032300-130032322 CAGTGGGGATGGTGGAGGAAGGG - Intronic
1032510130 7:132465819-132465841 CTGCAGAGCTGGAGGAGAGAGGG + Intronic
1032735847 7:134692098-134692120 GTGCGGTGGTGGAGGATGAAGGG + Intergenic
1033220117 7:139522244-139522266 CTGCGGGTGTGGAGGGGGAGGGG + Intergenic
1033226043 7:139563261-139563283 CTGCTGGGCTGAAGGGGCAATGG - Exonic
1033231596 7:139602672-139602694 CTAAGGAGCTGGAGGAGGAAAGG + Intronic
1033306823 7:140231195-140231217 CTGCGGGACTGGGCGATGAAGGG + Intergenic
1033329201 7:140404114-140404136 CAGCGAGGCAGGAGGAAGAAGGG + Exonic
1033538160 7:142331207-142331229 CTGGGGGGATGGAGGAGGCTGGG + Intergenic
1034098853 7:148434939-148434961 ATGCTGGGCTGGAGGAGGCCAGG - Intergenic
1034222814 7:149459584-149459606 CTGCGGGCCTGGACGGGGAGGGG - Intronic
1034443733 7:151101234-151101256 CTCCTGGGCTGGTGGGGGAATGG + Intronic
1035241623 7:157534303-157534325 GTGAGGGGCTGGAGTAGGGAGGG - Intergenic
1035372843 7:158390506-158390528 CTGCGAGGCTGGAGAAGGGATGG - Intronic
1035555122 8:562274-562296 CTGAGGGGCTGGGGTGGGAAGGG + Intergenic
1035727223 8:1832056-1832078 CTGTGGGGCTGGAGGAGCAGCGG + Intronic
1036688168 8:10925234-10925256 CTGTTGTTCTGGAGGAGGAAAGG + Intronic
1036833201 8:12037852-12037874 ATCCGGGGCTGGGGGAGGAGGGG + Intergenic
1036855050 8:12284417-12284439 ATCCGGGGCTGGGGGAGGAGGGG + Intergenic
1037468434 8:19183835-19183857 CTGCAGAGCAGGAGCAGGAAAGG - Intergenic
1037502058 8:19495829-19495851 CTCCAGGCCTGCAGGAGGAAGGG + Intronic
1037910257 8:22739896-22739918 CTGGGGGGATGGAGGGGGAGGGG + Intronic
1038109122 8:24475185-24475207 CAGAGGGGAGGGAGGAGGAATGG - Intronic
1038154118 8:24971336-24971358 CTGAAGGGTGGGAGGAGGAATGG + Intergenic
1038644363 8:29350442-29350464 CCGCGAGGCTGCGGGAGGAAGGG - Exonic
1039341736 8:36658071-36658093 GTGAGGGGATGGAGAAGGAAGGG - Intergenic
1039465723 8:37783913-37783935 GTGAGGGGCTGGAGGAGGCTAGG + Intergenic
1039882324 8:41632687-41632709 CTTCTGGGCTGGCGGAGGGAAGG + Intergenic
1040412012 8:47164106-47164128 TTGTGGGGTTGGAGGAGGCAGGG + Intergenic
1040483779 8:47851557-47851579 CTGTTGGGCTGGATGAGGAGAGG - Intronic
1040981790 8:53251813-53251835 CTGCGGGGCTGGAGGGGACGCGG - Intergenic
1041055880 8:53985549-53985571 CTGCTGAGCTGGGGGAGGAGAGG - Intronic
1042040859 8:64587118-64587140 TGGCAGGACTGGAGGAGGAAAGG + Intergenic
1042606638 8:70552887-70552909 CTGCCAGGCAGTAGGAGGAAAGG + Intergenic
1043148295 8:76682332-76682354 GTGCGGGGCTGGCGGAGGCCCGG + Intronic
1044503728 8:92992234-92992256 CTGGGGGAGTGGAGGAGAAATGG + Intronic
1045023506 8:98064488-98064510 GTGCGCACCTGGAGGAGGAAGGG - Exonic
1045376339 8:101578218-101578240 CTGCAGGGCTGGAGAATCAAAGG + Intronic
1047373485 8:124275262-124275284 CTTGGGGGCTGCAGGTGGAATGG - Intergenic
1047749217 8:127867254-127867276 CTGGGAGGGTGGAGGAGGAGGGG + Intergenic
1048223856 8:132566433-132566455 CTGCGGGGTTGGGGGAGAATTGG + Intergenic
1048972960 8:139655453-139655475 AGGTGGGGCTGGGGGAGGAAGGG + Intronic
1049018110 8:139935949-139935971 TTGTGGGACTGGAGCAGGAAAGG - Intronic
1049358019 8:142198330-142198352 CTGCTGGGCTGGGGCAGGAAGGG + Intergenic
1049543452 8:143218823-143218845 CTGCTGGGCTGGATGAGAAAGGG - Intergenic
1049635774 8:143688368-143688390 CTGCTGTGCTGGAGGTGGGAGGG + Intronic
1049676231 8:143890509-143890531 CACCGGGGCTGCAGGAGGCAGGG - Intergenic
1049695777 8:143983726-143983748 CTCGGGAGCTGGAGGAGGAAGGG - Exonic
1049803252 8:144527780-144527802 CTGCGGGTCTGGGGGATGAAGGG + Exonic
1050504175 9:6330013-6330035 CTGAGGGGCTGGAGGAAAACAGG + Exonic
1051840458 9:21391952-21391974 CTGCGAAGCAGGAGGAGGAAGGG + Intergenic
1052925894 9:34016116-34016138 CAGCAGGGAAGGAGGAGGAAGGG + Intronic
1053064712 9:35059794-35059816 TGGCGGGCCTGTAGGAGGAATGG + Exonic
1053148447 9:35727796-35727818 CTTCCGTGCTTGAGGAGGAAGGG - Intronic
1053494916 9:38542918-38542940 CTGTGGGGCTGGAGGATCCAAGG - Exonic
1054906583 9:70418860-70418882 CCCAGGGGCTGGAGGGGGAAGGG + Intergenic
1055522816 9:77098985-77099007 TTGCGGGGTTGGGGGAGGATTGG + Intergenic
1055541543 9:77311282-77311304 CTTATGGGCTGGAGGAAGAAGGG - Intronic
1055581547 9:77711510-77711532 GTGCTGGGCAGGTGGAGGAAGGG + Intergenic
1057054102 9:91948838-91948860 CTGCGGGGGTGGAGGAGGGCGGG - Intronic
1057407725 9:94788820-94788842 CTGTGGTGCTGGAGGAGAAATGG - Intronic
1058153565 9:101487093-101487115 CTGCGAGGCGGGAGGAGGTGAGG - Intronic
1058910072 9:109512895-109512917 CTTAGGGGCAGGAGGAGGGAGGG - Intergenic
1059489807 9:114657781-114657803 GTGCGCGGTGGGAGGAGGAAAGG + Intergenic
1060046915 9:120348763-120348785 CTGGGGGGCTTTAGGAAGAAGGG + Intergenic
1060153956 9:121306081-121306103 CTGCGGAGTGGGAGGAGGAGGGG - Intronic
1060484787 9:124040188-124040210 ATGCAGGGCTGGAGGGGGCAGGG + Intergenic
1060944490 9:127561916-127561938 CTTCTGTGCTGGAGGAAGAAGGG - Intronic
1061212635 9:129202791-129202813 CTGCGGCCCGCGAGGAGGAAGGG - Intergenic
1061298806 9:129692561-129692583 TTGCAGGGCTGCAGGAGGGACGG - Intronic
1061393203 9:130329154-130329176 CAGTGGGGCTGGAGCAGAAATGG - Intronic
1061727010 9:132587563-132587585 CTGCGGGGGTAGAGGCAGAAAGG + Intronic
1061769879 9:132910634-132910656 GAGTGGGGCTGGAGGAGGAGAGG + Exonic
1061828464 9:133275638-133275660 CTGCGGGGCTGGAGGGCTACAGG - Intergenic
1061925567 9:133804565-133804587 CTGAAGCCCTGGAGGAGGAATGG - Intronic
1061967646 9:134025283-134025305 AGGAGGGGCTGGAGGAGGAGGGG - Intergenic
1061967652 9:134025298-134025320 AGGAGGGGCTGGAGGAGGAGGGG - Intergenic
1062187361 9:135225045-135225067 CTGCGGGGCTAGAGCAGGGCCGG - Intergenic
1062187780 9:135227848-135227870 GGGCGGGGCTGAAGGAGGACAGG - Intergenic
1062196741 9:135278365-135278387 GTGCGGGGCTGGGGTGGGAAGGG + Intergenic
1062432294 9:136531611-136531633 CTGCTGGGCGGGAGGAAGGAAGG - Intronic
1062435197 9:136543955-136543977 CTGCGCGGCTGCAGAAGGCAGGG + Intronic
1062480329 9:136748059-136748081 CTGCTGGGCTGGAGGCTGGAGGG - Intronic
1062568202 9:137172575-137172597 CTCCAGGGCTGGGGCAGGAAGGG + Intergenic
1062574455 9:137199921-137199943 CTGGGGGGCGGGTGGAGGGAGGG + Exonic
1062611000 9:137373373-137373395 CTGAGGGGCAGGGGCAGGAAGGG + Intronic
1062640231 9:137515000-137515022 CAGCAGGGCTGGGGAAGGAAGGG + Intronic
1186107906 X:6226668-6226690 TTGAGGGACAGGAGGAGGAAGGG + Intronic
1186898850 X:14032099-14032121 CTCCTGGGCTGGGGGAGGAGGGG + Intergenic
1187065341 X:15830246-15830268 TTGTGGGGCAGGAGGAGGAAAGG + Intronic
1187319334 X:18226280-18226302 CAGGGGAGCTGGAGGAGGGAAGG + Intergenic
1189183020 X:39020847-39020869 CTGGGGGGTTGGAGGAGGAAAGG + Intergenic
1189249039 X:39585832-39585854 CTCTGGGGCAGGAGGAGGAGTGG + Intergenic
1190385345 X:49878893-49878915 CTGCGGGGCTGGGGGCCGAGCGG - Intergenic
1191044019 X:56116499-56116521 CTGGAAAGCTGGAGGAGGAATGG + Intergenic
1191717001 X:64200604-64200626 CTGAGAGGCTGGGGGAGGAGTGG + Intronic
1192488355 X:71550892-71550914 TTGGGGGGGTGGAGGAGGGATGG + Intronic
1194937759 X:99971190-99971212 CTGTGGGGATGGGGGAGGGATGG + Intergenic
1195083297 X:101390807-101390829 CTGCGGGGCGGGAGGAAGTCGGG + Exonic
1195218207 X:102721272-102721294 CTGTGGTGCTGGATCAGGAAAGG + Intronic
1195574199 X:106431533-106431555 TGAAGGGGCTGGAGGAGGAAGGG - Intergenic
1195852943 X:109302930-109302952 CTGCTGGGAGGGAAGAGGAAAGG + Intergenic
1195988889 X:110662892-110662914 GTGGGGGGCTGGGGGAGGGATGG + Intergenic
1196016378 X:110944545-110944567 CTGCTGGGCAGGAGGAGCAGGGG - Intronic
1196616944 X:117777088-117777110 TTGAGGGGCTGATGGAGGAAAGG - Intergenic
1196963239 X:121026614-121026636 CTCTGGGGCTGGAGAAGGTAGGG - Intergenic
1197706775 X:129639859-129639881 CTGCAGTGCTGGAGGTGGAAGGG + Intergenic
1198165415 X:134050479-134050501 CTGGGGGGCGGTGGGAGGAAGGG - Intergenic
1198405976 X:136312807-136312829 CTGGAGTGCTGGGGGAGGAACGG - Intronic
1199710642 X:150466826-150466848 GTGCAGGGATGGAGGAGGCAGGG - Intronic
1199944171 X:152652462-152652484 CTGGGGGGAGGGAGGAGGGAAGG - Intronic
1200065590 X:153502850-153502872 CTCCGGGGCTGGCTGCGGAAAGG + Intronic
1200120021 X:153785811-153785833 CTGGGGTGCTGGAGTGGGAAGGG + Exonic
1200224977 X:154412229-154412251 GTGCTGGGCAGGGGGAGGAAAGG + Intronic
1200279234 X:154762813-154762835 CCGCGGGGCGGGAGGAGGCGGGG - Exonic