ID: 1174767585

View in Genome Browser
Species Human (GRCh38)
Location 20:53268521-53268543
Sequence CGGGATGGAACCGGTCTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 45}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174767580_1174767585 -1 Left 1174767580 20:53268499-53268521 CCACTTCATGGCTAAGCATGTGC 0: 1
1: 0
2: 1
3: 5
4: 112
Right 1174767585 20:53268521-53268543 CGGGATGGAACCGGTCTTCCTGG 0: 1
1: 0
2: 0
3: 6
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174767585 Original CRISPR CGGGATGGAACCGGTCTTCC TGG Intronic
918236828 1:182589212-182589234 CGGGCTGCAAGCAGTCTTCCAGG - Exonic
1069833717 10:71296008-71296030 CGGGAGGGAGCTGGGCTTCCCGG - Intronic
1076730615 10:132437113-132437135 CTGGATGGAGCCAGTCATCCAGG - Intergenic
1077444313 11:2583248-2583270 CGGGATGGCACATGTCTCCCAGG - Intronic
1083590270 11:63889530-63889552 CGGGGTGGAGGCTGTCTTCCGGG + Intronic
1084514217 11:69627403-69627425 CTGGATGGAGCCGGACTCCCAGG - Intergenic
1085404829 11:76255525-76255547 CGGGCTGGACCGGGTCTTGCTGG - Intergenic
1090408007 11:126488898-126488920 CGGCAAGGATCCCGTCTTCCTGG - Intronic
1102179608 12:110902461-110902483 GGGCATGGGACAGGTCTTCCAGG - Intronic
1104795112 12:131511805-131511827 AGGGATGGAACCAGTCCTGCAGG - Intergenic
1106916515 13:34521214-34521236 TGGGAAGGAACAGGTCTTCCTGG - Intergenic
1107659470 13:42624283-42624305 CATGATGGAAATGGTCTTCCTGG + Intergenic
1119022971 14:71130525-71130547 TGGAATGGAACCTGTCTTCCTGG + Intergenic
1136924321 16:34357847-34357869 CTGTTTGGAACCGGTCTTCTTGG + Intergenic
1136980252 16:35053959-35053981 CTGTTTGGAACCGGTCTTCTTGG - Intergenic
1143496195 17:7314038-7314060 CCAGATGGAACCGGCCTTCTTGG - Intronic
1143568676 17:7740754-7740776 CCGGAGGGAACCCGCCTTCCCGG + Intronic
1144240646 17:13307608-13307630 AGGGATGGAACCAGTATTGCAGG + Intergenic
1144795569 17:17889041-17889063 CTGGATGGAGCCGGTCTCCCTGG - Intronic
1153689532 18:7578038-7578060 CTGGTTGGATCAGGTCTTCCTGG + Intronic
1157209751 18:45731840-45731862 AGGGAGGGAACCAGTATTCCAGG + Intronic
1164259808 19:23559768-23559790 CGTGATGTAACCGTTCTTCCAGG - Intronic
1165114969 19:33523168-33523190 AGGGATGGTACTGGGCTTCCAGG - Intergenic
1167470344 19:49672276-49672298 CTGGATGGAACCGGTTTCCCTGG + Intronic
928715266 2:34053153-34053175 CGGCATTGAACAGATCTTCCAGG - Intergenic
929428881 2:41870267-41870289 AGGGAGGGAACTGCTCTTCCTGG + Intergenic
934067773 2:88355185-88355207 CTGGATGGAGCAGGTCTTTCTGG + Intergenic
934563188 2:95323689-95323711 CGGGATGCCACCTGTCTTCCAGG + Intronic
1174767585 20:53268521-53268543 CGGGATGGAACCGGTCTTCCTGG + Intronic
1176300477 21:5096713-5096735 CAGGATGGAACCCGTGGTCCTGG - Intergenic
1179856566 21:44165268-44165290 CAGGATGGAACCCGTGGTCCTGG + Intergenic
1180631393 22:17232596-17232618 CGGGAAGGGAAAGGTCTTCCAGG - Intergenic
1181966009 22:26657305-26657327 CGGGGTGCAACCGGTCTTGGAGG - Intergenic
1183377571 22:37474020-37474042 CGGGATGGAATGGGTCTTTGGGG - Intronic
986224495 5:5800586-5800608 CTGGTTGGAACGGTTCTTCCTGG - Intergenic
986430789 5:7679244-7679266 CGTGATGGAACCAGCCATCCAGG + Intronic
995797892 5:115961596-115961618 TGGGCTGGAACTGGTTTTCCCGG - Intergenic
998377896 5:141703003-141703025 CGAAATGAAACCGGTCTTTCGGG - Intergenic
1017141226 6:151191768-151191790 CTGGAGGGAACTGGCCTTCCAGG + Intergenic
1039879974 8:41619207-41619229 GGGGTTTGAACCAGTCTTCCAGG + Intronic
1040332847 8:46401115-46401137 TGGGATGGGACAGGTCTCCCTGG + Intergenic
1044569429 8:93700662-93700684 CGGGCTGTTACCGGTTTTCCAGG - Exonic
1047094961 8:121615086-121615108 CAGGATGGAACAGGTTTTGCTGG - Intronic
1049453030 8:142672571-142672593 AGGGATGGAGCCAGCCTTCCGGG - Intronic
1061512349 9:131068932-131068954 TGGGATGGCACTGGTCCTCCTGG - Exonic
1185580136 X:1205226-1205248 TGGGAAGAAACCGGCCTTCCAGG - Intronic
1186219330 X:7332744-7332766 CGGGATGGAAACAGTATTTCAGG + Intronic
1188042304 X:25383063-25383085 TGGTTTGGAACTGGTCTTCCTGG + Intergenic
1190292243 X:49000768-49000790 TGGGAAGGAACCGGCCTTGCTGG - Intronic
1193957686 X:87882956-87882978 CAGGATTGGACAGGTCTTCCAGG - Intergenic
1201777255 Y:17679639-17679661 CAGGATGGAAACACTCTTCCTGG - Intergenic
1201824302 Y:18226353-18226375 CAGGATGGAAACACTCTTCCTGG + Intergenic