ID: 1174768126

View in Genome Browser
Species Human (GRCh38)
Location 20:53272912-53272934
Sequence CTGAGAATGAGGGGCTACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 190}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174768126 Original CRISPR CTGAGAATGAGGGGCTACCA AGG Intronic
901220387 1:7580351-7580373 CTGTGAATGAGGGGAACCCAGGG + Intronic
902793434 1:18784651-18784673 CTGAGCAAGAGGGGCGCCCAGGG + Intergenic
903185531 1:21626783-21626805 TTGGCATTGAGGGGCTACCAGGG + Intronic
903263855 1:22144878-22144900 CTAAGCCTGAGGGGCTACCAAGG - Intergenic
904697134 1:32336850-32336872 CTCAGAATGACTGGCCACCAAGG - Intergenic
906100288 1:43255951-43255973 CTGGGGATGAGGGGCCAGCAGGG + Intronic
906161074 1:43649629-43649651 CAGCGAATGAGGGGTTTCCAAGG + Intergenic
906688297 1:47776835-47776857 CTGAGAATCTGGGGTTGCCATGG - Intronic
906817981 1:48898947-48898969 CTGAGAGTAAGGAGGTACCATGG - Intronic
907496286 1:54846990-54847012 CTGAGAAGGAGGAGCTCCAAGGG - Intergenic
908170429 1:61499014-61499036 CTGAGAATCAGGAGTGACCAAGG + Intergenic
908863540 1:68519246-68519268 CTGAGAATAAGGGGGAACTATGG - Intergenic
909013769 1:70362158-70362180 CTGAGAAGCAGGGGTTGCCAAGG + Intronic
909251610 1:73364136-73364158 CTGAGGATGAGGGGTTAAGAGGG - Intergenic
910862808 1:91759252-91759274 CTGAGAAAAAGCGGCTGCCAAGG + Intronic
911832895 1:102577236-102577258 CTGAGAATATTGGGCTAGCAAGG - Intergenic
912864948 1:113248478-113248500 CTGAGGATGAGGGGCTTCACAGG - Intergenic
916203554 1:162294360-162294382 CTGAGAATGGAGGGATACTAAGG - Intronic
916812829 1:168320492-168320514 CTCAGACTGAGGGGCTTCCTGGG + Intergenic
918518330 1:185386916-185386938 CTGGGACTGAGGGGTTACCTGGG + Intergenic
919037423 1:192332007-192332029 CTTAGACTGAGGGCTTACCATGG + Intronic
919473309 1:198005387-198005409 GTTAAAATGAGGGGCTACCTGGG + Intergenic
920176023 1:204102469-204102491 CTGCGAATGTGGGGCTTCCTTGG + Intronic
920219662 1:204387614-204387636 CTGAGACTGAGGGGTTTCCTGGG - Intergenic
921102500 1:211941902-211941924 CTGGGAATAAGGGTCTTCCAGGG + Exonic
921277617 1:213535479-213535501 ATCAGACTGAGGGGCTCCCAGGG - Intergenic
923461965 1:234215569-234215591 CGGTGAATGAGGGGCAGCCATGG + Intronic
1063385001 10:5610878-5610900 CAGAGAATGAGGAGCGAGCAGGG - Intergenic
1066178779 10:32939224-32939246 CAGAGTATGAGGGGATAACAGGG + Intronic
1067017738 10:42770444-42770466 GTGAGCATGAGGGGCTTCCTGGG - Intergenic
1067950164 10:50727937-50727959 CTGAGGATGAGAGGCTAGCAGGG - Intergenic
1070587870 10:77780099-77780121 CTGAGCAGGGGGGGCTCCCAGGG + Intergenic
1070885488 10:79893143-79893165 CTGAGGAGGAGAGGCTAGCAGGG - Intergenic
1070899394 10:80014772-80014794 CTGAGAATGACTGACTACCTGGG - Intergenic
1071291424 10:84192077-84192099 CTGGGACTGAGGGGTTTCCAGGG - Intergenic
1072805922 10:98424041-98424063 CTGGGAGTGAGGGGCTCCCCAGG - Intronic
1073237236 10:102027694-102027716 ATGAGAATGAGGAGCTATCTGGG + Intronic
1073674063 10:105625351-105625373 CTGAGAATTAGAGGTTACCCAGG - Intergenic
1074759782 10:116658473-116658495 CTGAAAATAAGAGGCTGCCAAGG + Intergenic
1078798763 11:14621714-14621736 CTGAGAATGTGAGGTTTCCAAGG - Intronic
1079073401 11:17367707-17367729 CTGAGGATAAGGGGCTATCAGGG + Intronic
1084337927 11:68471956-68471978 GTGAGAATGAGGGGGTGTCAGGG + Intronic
1085025347 11:73233210-73233232 CTGAGCCTGTGAGGCTACCAGGG - Intronic
1088093706 11:106074549-106074571 CTGAGAAGGAGAGGCCAGCAAGG - Intronic
1088754148 11:112872052-112872074 CTGACAATGAGGCGCCAACACGG + Intergenic
1090961103 11:131557726-131557748 ATTTGAATGAGGGGCTAGCAGGG + Intronic
1091851663 12:3704374-3704396 GTGAGAAGGAGGGATTACCAAGG + Intronic
1092104932 12:5914622-5914644 TTGAGATTGAGGGACCACCAGGG - Intronic
1096220384 12:49825376-49825398 CTGAGAAGCAGGGGCTAGAAAGG + Intronic
1098583185 12:72125914-72125936 CTGAGAATCTGGGGAGACCAAGG + Intronic
1098675216 12:73282117-73282139 TTGAGAATGAATGGTTACCATGG - Intergenic
1101380674 12:104211550-104211572 CTTAGAATGATTGGCTTCCAGGG - Intergenic
1101563769 12:105885143-105885165 CTGAGAATCCTGGGATACCATGG + Intergenic
1102592053 12:113963908-113963930 CTGAGAATGAGGAGTTAGCCAGG - Intronic
1109349939 13:61166465-61166487 CTGAGAATGTGTGGACACCAAGG - Intergenic
1116159495 14:41251101-41251123 CTGAGAATCAGGTTCCACCAGGG + Intergenic
1117926554 14:60785579-60785601 CAGAGAATGTGGGGCTATGAAGG - Intronic
1121455488 14:94036189-94036211 ATGAGGCTGAGAGGCTACCAGGG + Intronic
1121463242 14:94098058-94098080 CTGAGAAGGAGAGGCTAGTATGG + Intronic
1121775226 14:96586129-96586151 CTGAGTATGAGGGACTCCCAAGG + Intergenic
1122068738 14:99191602-99191624 CTGAGAATCTGGGGCTCCTAGGG + Intronic
1122096610 14:99376973-99376995 CAGAGAATGAGGGACAGCCAAGG + Intergenic
1122284582 14:100643121-100643143 CTGAGATTGAGGTGTTACCAGGG - Intergenic
1122800613 14:104227653-104227675 CTGGGATTTAGGGGCCACCAGGG + Intergenic
1124427565 15:29574785-29574807 CTGCGTAAGAGAGGCTACCAAGG - Intergenic
1125549414 15:40534231-40534253 CTGAGAATTGGGGGCCAGCAGGG + Intronic
1126562180 15:50055926-50055948 CTGATACTGAGGAACTACCAGGG - Intronic
1132692325 16:1187185-1187207 CTGAGAATGAGGGGCCGGGAGGG + Intronic
1133425753 16:5687713-5687735 CTGAGAATGAAGGGGTTCCCAGG - Intergenic
1140473409 16:75227042-75227064 ATGAGATTGAGGGGCAAGCAGGG + Intergenic
1142410425 16:89913178-89913200 CTGAAAATGACAGGCTAGCAAGG + Intronic
1146557556 17:33839630-33839652 CTGAGAATAAGGGGTTTCCTGGG - Intronic
1148624833 17:49061431-49061453 ATGAGCATGAGGGGCTTTCAGGG - Intergenic
1149645135 17:58235392-58235414 CTGAGACTGAAGGGCTTCCCTGG - Intronic
1150742188 17:67788259-67788281 CTGACAATGAGGGGCCAGCAAGG - Intergenic
1151170511 17:72241871-72241893 CTGAGTTTGAGGGGCTTTCACGG - Intergenic
1153746142 18:8181499-8181521 CTGAGACTGAGGGGCGAAAAAGG + Intronic
1154146724 18:11872991-11873013 CTGAGACTGAGGGGTTTCCGGGG + Intronic
1155058386 18:22205602-22205624 CTGAGTTTGAGGGGCTCGCAGGG + Intergenic
1158852603 18:61510272-61510294 AGGAGACTGAGGGGCGACCAGGG + Intronic
1161669651 19:5599009-5599031 ATGAGAATTAGAGGCTCCCAAGG - Intronic
1162613408 19:11775225-11775247 CTGAAAATGAGGGCCTCCCCAGG + Intronic
1162728474 19:12703549-12703571 CTGAGAAGGAGGGCCAGCCAGGG + Intronic
1168185713 19:54698202-54698224 CTGAGAGGGAGGGTCTGCCAGGG - Intronic
924972007 2:136875-136897 CTCAGCATGAGGGGCCACCGAGG + Intergenic
925024060 2:594222-594244 TTGAGCAGGAGAGGCTACCACGG + Intergenic
927104818 2:19814585-19814607 CTGGGAATGATGGGATTCCAGGG - Intergenic
927193892 2:20534723-20534745 CTGGGACTGAGGGGCTGCCCAGG + Intergenic
929308039 2:40387967-40387989 TTGAGACTGATGGGCTACTAAGG + Intronic
929413388 2:41722531-41722553 CTCAGAATGAGGGGTTTCCCTGG + Intergenic
930092742 2:47543153-47543175 CTGTGAATAAGGAGCTACCAGGG + Intronic
936707231 2:115088984-115089006 CTGAGGATGAGGGGCCAACCTGG - Intronic
937457445 2:122054796-122054818 CTGAGAGTGAGGGGTCGCCAAGG - Intergenic
938169141 2:129059336-129059358 CTGGGCATGAGGGGATACTACGG - Intergenic
938200200 2:129366513-129366535 ATGTGAATGAGTGGCTTCCAGGG - Intergenic
938422609 2:131156570-131156592 CTGAGCATGAGGGGACACCTGGG + Intronic
940487553 2:154315219-154315241 CTGAGGAAGAACGGCTACCAAGG - Intronic
940988458 2:160073637-160073659 ATGGGAATGAAGGGCTAGCATGG + Intergenic
942141070 2:172978097-172978119 CAGAGAAAGAGAGGCTTCCATGG - Intronic
946284651 2:218693835-218693857 CTGAGACAGTGGGGCTGCCAGGG - Intronic
947573095 2:231250663-231250685 AAGAGAGTGAGGGGCTGCCAGGG + Intronic
948334345 2:237195627-237195649 CTGAGAATCATGGGATCCCAGGG - Intergenic
948579259 2:238972962-238972984 CTGGGACTGAGGGGTTTCCAGGG - Intergenic
1168810919 20:704075-704097 CAGAGAATGAGCGGCCACCTTGG - Intergenic
1174768126 20:53272912-53272934 CTGAGAATGAGGGGCTACCAAGG + Intronic
1178350953 21:31873004-31873026 CGGGGAAGGAGGGGCTACTAGGG + Intergenic
1179311234 21:40198007-40198029 CCCAGACTGAGGGGCTTCCAAGG - Intronic
1179311523 21:40200120-40200142 CCCAGAATGAGGGGCTTCCAAGG - Intronic
1180032375 21:45221331-45221353 CTGAGAAGGAGGGGACAGCAGGG - Intronic
1181084503 22:20433236-20433258 CTGAGAAGGAAGAGCCACCAAGG + Intronic
1181157699 22:20934576-20934598 CTGAGAATTTGGGGCAAACAAGG - Intronic
1183629785 22:39026074-39026096 CTGAGAAGGAGCCGCCACCATGG + Intronic
1185179708 22:49352184-49352206 CAGAGAGTGAGGGGCTGCCGAGG - Intergenic
950334437 3:12182325-12182347 ATGTCAATGAGGGGCTTCCAAGG - Intronic
950645657 3:14375058-14375080 CTGAGAATTAGGAGCTAGAATGG - Intergenic
951273088 3:20651438-20651460 CTAAGAATGATGGGCAACCCTGG - Intergenic
951527951 3:23671775-23671797 CTGAGGAGGAGGCGCTGCCAGGG - Intergenic
953215897 3:40917713-40917735 CTGAGACTGAAGAGCTACCCTGG + Intergenic
953896108 3:46803441-46803463 CTGGGAAAGAGGGATTACCAAGG + Intronic
956566680 3:70646521-70646543 CTGAGCATGGCGGGCTAACATGG + Intergenic
957920706 3:86744716-86744738 ATGAGAAACAGGGGTTACCAAGG - Intergenic
958884709 3:99712812-99712834 CTGAAACTGAGGGGTTTCCAGGG - Intronic
960409381 3:117303655-117303677 TTGAGAAGGAAGGGCTGCCATGG + Intergenic
960954788 3:123024643-123024665 CTGAGAATGAGGGTGAGCCAAGG + Intronic
960996832 3:123345705-123345727 CTGTGACTGAGGAGCCACCAGGG - Intronic
962741392 3:138364818-138364840 CAGAGCTTGAGGGGCAACCAGGG - Intronic
964653728 3:159043126-159043148 CTGAGAATAAGGGGCAACAAGGG + Intronic
965367067 3:167814009-167814031 CTGAGAATGAAGGAATACAAAGG - Intronic
966052364 3:175636251-175636273 CTGAGAATGAGTGACTCTCAGGG - Intronic
966097359 3:176220285-176220307 CTGACCATGAGGGGTTACCTGGG + Intergenic
968294397 3:197562785-197562807 CTGAGAATGAGGAGAAAACAAGG + Intronic
969691825 4:8708159-8708181 CTGAGACTGAGGTGCCAGCATGG + Intergenic
971654633 4:29328048-29328070 CTGAGAATGTGCAGCTACTAAGG + Intergenic
973165390 4:47070698-47070720 CTGAGAAGGAGTGGCTGACAAGG - Intronic
974872603 4:67661236-67661258 ATGAGATTCAGGGGGTACCAGGG + Intronic
976905045 4:90226870-90226892 CTGAGCATGATGGGGTACTAGGG + Intronic
979450673 4:120866986-120867008 CTGAGATTGAGGGGCTCACAGGG + Intronic
979924438 4:126543050-126543072 CTGAGAATTAGGAGCTTACAGGG + Intergenic
980615517 4:135217805-135217827 CTGAGAACGAGGGTCTAGCTGGG - Intergenic
981910884 4:149980575-149980597 CAGAGACTGAGGGGCTTCCCAGG - Intergenic
988254868 5:28808852-28808874 CTGAGAATGGGAGTCTACAAAGG - Intergenic
989413607 5:41148583-41148605 CTGAGAATGAGGGTCTAGTCTGG + Intronic
991173192 5:63653027-63653049 CTGAGATTGGGGTGCTACCATGG + Intergenic
992541552 5:77770512-77770534 CTGAGACTGAGGGGTTTCCCAGG - Intronic
995351998 5:111188514-111188536 CTGAGAATGATGGACCAGCATGG + Intergenic
995732666 5:115262819-115262841 CTGAGGATGAGAGGCTAGCAGGG - Exonic
996526143 5:124481861-124481883 CTGAGTATGAAGGGCTGCGAGGG + Intergenic
998184005 5:139965091-139965113 CTGACCATGAGGGGTTAACAAGG - Intronic
999016105 5:148107204-148107226 CTGAGACTCAGGGGCGATCATGG - Intronic
999065222 5:148678496-148678518 CTGAGAATGAGGAGGGCCCAAGG - Intergenic
1002968989 6:1995143-1995165 CAGAAACTGAGGGGCCACCATGG + Intronic
1003390227 6:5707323-5707345 CTGAGAATAAAGTGGTACCAGGG + Intronic
1006468091 6:34208123-34208145 CTGACAATGTGTGGCTTCCAAGG + Intergenic
1006700567 6:35969627-35969649 CTGACACTGAGGAGCTACTAGGG - Intronic
1007079680 6:39090546-39090568 CTGAGAGTGAGGTGCTGTCAGGG + Intergenic
1010606738 6:77899041-77899063 TTGAGAATGAGGGACACCCATGG - Intronic
1013421828 6:109974007-109974029 CTGAGGATGAGGGGCACCCCTGG + Intergenic
1014335571 6:120130710-120130732 CTAACAGTGAGGGCCTACCATGG + Intergenic
1019183246 6:170205763-170205785 CTCAGAATGACGGGCACCCATGG + Intergenic
1019630747 7:2048270-2048292 CGGAGAATGAGCAGCTACCTGGG + Intronic
1019771588 7:2886787-2886809 CTGAGAGGGAGGGTCTGCCAGGG + Intergenic
1023682011 7:42696828-42696850 CAGAGAGTGAGAGGGTACCAGGG + Intergenic
1024030635 7:45456857-45456879 CTGGGAATGAGAGGCTTCCTGGG - Intergenic
1024030639 7:45456875-45456897 CTGGGAATGAGAGGCTTCCTGGG - Intergenic
1024385313 7:48744509-48744531 CTGAGAGTGAGTAGGTACCAGGG + Intergenic
1027645575 7:80793825-80793847 CTGAGAAAGAGTGACTAGCACGG + Intronic
1028990600 7:97045123-97045145 CTGACAATGAGAGGCCACCATGG + Intergenic
1029510512 7:100991835-100991857 CTGAGATTGTGGAGCTATCACGG - Exonic
1034079308 7:148261698-148261720 GTGAGAGTGAGGGGCTACCAGGG + Intronic
1036437657 8:8749881-8749903 CGGAGCTTGAGGGGCTACCGTGG - Intergenic
1036527765 8:9551149-9551171 CTGAGAATGAGTGGCAGCCCAGG - Intergenic
1037674546 8:21042521-21042543 CTGAGTCTGGGGGGCTTCCAGGG - Intergenic
1038115048 8:24544146-24544168 CTGAGAATCAGGGGAGCCCATGG - Intergenic
1038650295 8:29396599-29396621 CTGAGACTGAGGGGTTTCCCAGG + Intergenic
1043438212 8:80254455-80254477 CTGAGAATGAGGGAACACTATGG - Intergenic
1043946527 8:86260281-86260303 CTAAGAATTAAGGTCTACCATGG - Intronic
1044311352 8:90696381-90696403 TGGAGAATGAGGGCCTTCCAAGG + Intronic
1047318454 8:123755467-123755489 CTGAGAAAGCAGGGATACCAAGG + Intergenic
1048398104 8:134034242-134034264 CTGAGAAGGAGGGGCAACATGGG + Intergenic
1049130195 8:140832663-140832685 GTGAGATTGAGGGGCTACTGTGG + Intronic
1049270416 8:141692752-141692774 TTGAGCATGAAGGGCTACCCAGG - Intergenic
1053698073 9:40657123-40657145 CTGAGATTGAGGGGTCAGCAGGG + Intergenic
1054309364 9:63456531-63456553 CTGAGATTGAGGGGTCAGCAGGG + Intergenic
1054408160 9:64780653-64780675 CTGAGATTGAGGGGTCAGCAGGG + Intergenic
1054441306 9:65264479-65264501 CTGAGATTGAGGGGTCAGCAGGG + Intergenic
1054488971 9:65757010-65757032 CTGAGATTGAGGGGTCAGCAGGG - Intergenic
1055003437 9:71479574-71479596 CTGAGAACGATGGGCAGCCAGGG - Intergenic
1057278904 9:93696709-93696731 CTGAGAATGGGTGGATTCCATGG + Intergenic
1060131613 9:121105618-121105640 CTGAGAAAGAGAGGCCAGCAAGG + Intronic
1060221797 9:121768032-121768054 CTGAGTAGGAGGGACTCCCAGGG + Intronic
1061986201 9:134131652-134131674 TTGGGATTGAGGGGCTGCCAGGG + Intergenic
1202780437 9_KI270717v1_random:30313-30335 CTGAGATTGAGGGGTCAGCAGGG + Intergenic
1187447836 X:19373758-19373780 CTGGGCTTGAGGGGCTGCCAGGG - Intronic
1189119204 X:38375944-38375966 CTGAGAAGGAGCAACTACCAAGG + Intronic
1189691574 X:43622964-43622986 CTGAGAATGAGGAGAAAACAAGG - Intergenic
1192699878 X:73457589-73457611 AAGAGAATGAGGGGCCAGCAAGG + Intergenic
1193646175 X:84071123-84071145 CTGAGACTCAGGGGAGACCAAGG + Intronic
1195888613 X:109668394-109668416 GTGAGAATGAGAGGTTAACAAGG + Intronic
1197872222 X:131071208-131071230 CAGAGAAAGAGGGGATGCCAGGG + Intronic
1198012488 X:132572474-132572496 CTGTGAATCAGGAGCAACCAAGG + Intergenic
1198632441 X:138655585-138655607 GTGCTAAGGAGGGGCTACCAGGG + Intronic
1199623186 X:149716773-149716795 CTGAGCATGAGATGCAACCAGGG + Exonic
1199823745 X:151476961-151476983 CTGAGAATGTGAGGAGACCAAGG - Intergenic
1200012871 X:153133126-153133148 CGGCAAATGAGGAGCTACCATGG - Intergenic
1200026730 X:153266791-153266813 CGGCAAATGAGGAGCTACCATGG + Intergenic