ID: 1174770061

View in Genome Browser
Species Human (GRCh38)
Location 20:53291179-53291201
Sequence TATCAAGAGCAGGCTGGGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 549
Summary {0: 1, 1: 0, 2: 4, 3: 54, 4: 490}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174770055_1174770061 -3 Left 1174770055 20:53291159-53291181 CCAAATACCCTGGTCAAAAATAT 0: 1
1: 0
2: 2
3: 16
4: 178
Right 1174770061 20:53291179-53291201 TATCAAGAGCAGGCTGGGAGCGG 0: 1
1: 0
2: 4
3: 54
4: 490
1174770053_1174770061 27 Left 1174770053 20:53291129-53291151 CCAATTCACGGTGAGGGGTGCTA 0: 1
1: 0
2: 0
3: 2
4: 19
Right 1174770061 20:53291179-53291201 TATCAAGAGCAGGCTGGGAGCGG 0: 1
1: 0
2: 4
3: 54
4: 490
1174770056_1174770061 -10 Left 1174770056 20:53291166-53291188 CCCTGGTCAAAAATATCAAGAGC 0: 1
1: 0
2: 1
3: 10
4: 159
Right 1174770061 20:53291179-53291201 TATCAAGAGCAGGCTGGGAGCGG 0: 1
1: 0
2: 4
3: 54
4: 490

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174770061 Original CRISPR TATCAAGAGCAGGCTGGGAG CGG Intronic
900188043 1:1342162-1342184 CAACAAGAGCAGGGTGGGTGGGG + Intronic
900561384 1:3308833-3308855 TATCATGACCACGTTGGGAGAGG - Intronic
900898541 1:5501434-5501456 AAACAAGAGCAGGCTTGGAATGG - Intergenic
901106419 1:6759814-6759836 TTGCAAGAACAGGCTGGGCGTGG + Intergenic
901256630 1:7834208-7834230 AACCTAGAGCAGGCTGGGCGTGG - Intronic
901862455 1:12083396-12083418 TATCGAGAGCAGGCCCGGAGTGG + Intronic
901890485 1:12259297-12259319 TAAAAAGAGTAGGCTGGGGGTGG - Intronic
902511520 1:16969389-16969411 CAGTAAGAGCAGGCTTGGAGGGG + Intronic
902756242 1:18550984-18551006 TCTCAAGGTCAGGCTGGGTGGGG + Intergenic
904145960 1:28391472-28391494 TACCAGGAGCTGGGTGGGAGTGG + Intronic
904219244 1:28951561-28951583 AATCGAGATCAGGCTGGGCGTGG + Intronic
904373720 1:30066477-30066499 CATGGAGAGTAGGCTGGGAGCGG - Intergenic
904564691 1:31421669-31421691 TGAAAAGAGCAGGCTGGCAGGGG - Intronic
904708583 1:32411148-32411170 TAAGAAGAACAGGCTGGGCGTGG - Intergenic
905078652 1:35297138-35297160 AAGTAAGAGCAGGCTGGGCGCGG - Intronic
905098020 1:35492223-35492245 TATCATGACCAAGCTGGGCGCGG + Intronic
905562675 1:38939964-38939986 TAGAAAGACCAGGCTGGGGGCGG - Intronic
905687353 1:39918076-39918098 TTTCAAGAACAGGCCAGGAGTGG + Intergenic
905913437 1:41669340-41669362 GATCAATAGCAGTCTGGGGGTGG + Intronic
906196796 1:43934741-43934763 GATCCATAGGAGGCTGGGAGGGG + Intronic
906338548 1:44956970-44956992 TATAAAAACAAGGCTGGGAGTGG + Intronic
906627172 1:47334387-47334409 TCTCTAGAGTGGGCTGGGAGAGG + Intronic
906964449 1:50442759-50442781 TATCAAAGGCAGGCTGGCAAGGG + Intronic
907508063 1:54936436-54936458 GATAAAGAGGAGGCTGGGTGCGG - Intergenic
908151374 1:61306138-61306160 AATCAAAAGAAGGCTGGGTGCGG - Intronic
908399310 1:63755547-63755569 AAGGAAGAGCAGGCTGGGCGCGG + Intergenic
908475444 1:64483546-64483568 TACCAAGGGCAGGCTGGGCTGGG + Intronic
908560029 1:65297136-65297158 TCTGAAGGGCAGGCTGGGATTGG + Intronic
908936606 1:69383842-69383864 TAGCAAGAGTCGGCTGGGCGTGG + Intergenic
911127473 1:94353837-94353859 GACCAAGAACAGGCTGAGAGAGG - Intergenic
912122065 1:106483616-106483638 TGTTAAAAGCAGGCTGGGTGTGG + Intergenic
912409528 1:109470603-109470625 TATAAAGAGCAGCCAAGGAGAGG - Intronic
912685533 1:111759682-111759704 AATGAAGAGCAGGCCGGGCGCGG + Intronic
913189683 1:116402984-116403006 TATCAAGATGGGGCTTGGAGAGG + Intronic
915496953 1:156288626-156288648 TAACAAGAGCAGGCCAGGTGTGG - Intronic
916626726 1:166566231-166566253 TATTAAGAGCTGTCTGGAAGAGG + Intergenic
916801041 1:168216694-168216716 TAGCAATATCAGGCTAGGAGTGG - Intergenic
918315839 1:183322113-183322135 TATCTAGCCCAGGCTGGGTGCGG - Intronic
918371828 1:183868823-183868845 TATCCAGAGCTGGCCGGGCGTGG + Intronic
921279104 1:213548370-213548392 AAAGAAAAGCAGGCTGGGAGTGG + Intergenic
921899994 1:220439822-220439844 AATCAAGAGCAGGCTGAGCATGG - Intergenic
922027183 1:221761244-221761266 TAGCAAGAGCAGGCAGGAAGGGG - Intergenic
922092629 1:222411224-222411246 GATCAAGGGCAGGGAGGGAGAGG + Intergenic
922323922 1:224511121-224511143 TATCACGAGAAGAATGGGAGCGG + Intronic
922474116 1:225895092-225895114 AATCAAGAACGGGCTGGGCGCGG + Intronic
922520477 1:226246422-226246444 TACCCAGGGCAGGATGGGAGTGG - Intronic
923168600 1:231391995-231392017 TATAAAGCACAGGCTGGGCGCGG + Intronic
923617948 1:235553211-235553233 GAGGAAGAGCAGGTTGGGAGAGG + Intronic
924068128 1:240247210-240247232 TAGAAAAAGCAGGCTGGGAGTGG + Intronic
924105852 1:240648494-240648516 TATCAAGAGAACCCTGAGAGAGG + Intergenic
924282429 1:242451856-242451878 TAGCAGGAGCATGGTGGGAGAGG - Intronic
924671183 1:246127603-246127625 TATGAAAAGGAGGCTGGGTGCGG + Intronic
1063253254 10:4297284-4297306 GATCAAAAGCAGGCTGGGTGTGG - Intergenic
1063851453 10:10196922-10196944 TACCAACAGGAGGCTGGCAGTGG - Intergenic
1063990230 10:11553602-11553624 TAGCAAGATTAGGCTGGGTGTGG + Intronic
1064142543 10:12802808-12802830 AATGAAGAGCAGGCCGGGGGCGG - Intronic
1064144799 10:12819162-12819184 TTTCCCGAGGAGGCTGGGAGAGG + Intronic
1064529628 10:16294743-16294765 TATAAAAATTAGGCTGGGAGCGG + Intergenic
1064659990 10:17597426-17597448 TATCCATTGCAGGCTGGGCGTGG - Intronic
1065345452 10:24743845-24743867 TGAAAAGAGCAGGCTGGGCGTGG - Intergenic
1067298465 10:44989529-44989551 AAGCAAGAGGAGGTTGGGAGAGG + Intronic
1067689964 10:48495519-48495541 TATTAAGAGTGGGCTGTGAGTGG - Intronic
1067784987 10:49239325-49239347 TATCTTGAGCAAGCAGGGAGAGG + Intergenic
1068120243 10:52777131-52777153 GATAAAGAGCAGGCTGAGAGGGG + Intergenic
1068978738 10:63038284-63038306 TACAAAGAGAAGGCTGGGCGCGG + Intergenic
1069526434 10:69176138-69176160 TAGCAAAAGCAGGCCGGGCGCGG + Intergenic
1069539565 10:69283488-69283510 AATAAAGAGCTGGCTGGGCGTGG + Intronic
1069541999 10:69301953-69301975 TTTTAAAAGCAGGCTGGGTGTGG + Intronic
1069979390 10:72241791-72241813 TCCCAACAGCAGGCAGGGAGTGG - Intergenic
1071430526 10:85603015-85603037 TTTCAAGAGCAGGCAGAGACAGG + Intronic
1072432304 10:95384006-95384028 GAGGAAGAGCGGGCTGGGAGGGG + Exonic
1072626421 10:97115277-97115299 AAGGAATAGCAGGCTGGGAGTGG - Intronic
1072650774 10:97293345-97293367 CCTCAAGTGCAGGCAGGGAGTGG + Intergenic
1072723075 10:97792639-97792661 AATAAACAGGAGGCTGGGAGAGG + Intergenic
1073113704 10:101078843-101078865 TAAAAAGACCAGACTGGGAGTGG - Intergenic
1073585686 10:104707822-104707844 GATAAAGAACAGGCTTGGAGTGG - Intronic
1075046910 10:119153637-119153659 AGTGCAGAGCAGGCTGGGAGGGG + Intronic
1075134689 10:119773345-119773367 TTTGAAAAACAGGCTGGGAGAGG - Intronic
1075301802 10:121331374-121331396 GAGCAAGAGGAGGCTTGGAGAGG - Intergenic
1075511634 10:123077270-123077292 AAACAAGAACAGGCTGGGCGAGG - Intergenic
1077195450 11:1277552-1277574 TATAACTAGCAGGCTGGGGGTGG + Intronic
1077517976 11:3013558-3013580 TAGCAAGTGCTGGCTGGGCGCGG + Intronic
1078133169 11:8630201-8630223 TCTCAAGAGCATGATGGGATTGG + Intronic
1078195611 11:9134401-9134423 GAGCAAGAGTAGGCAGGGAGAGG - Intronic
1078449392 11:11429053-11429075 GATAAAGAGCAGGCAGTGAGGGG - Intronic
1078938621 11:15975792-15975814 TATCAAGATCAGGGTGAGAAAGG + Intronic
1079101556 11:17545041-17545063 TATCCAGAGAAGGCCGGGCGCGG - Intergenic
1079194969 11:18317544-18317566 TATCAGGCCCAGGCTGGGCGTGG - Intronic
1080046506 11:27814146-27814168 TTTCAAGAACAGAGTGGGAGTGG + Intergenic
1081246875 11:40777976-40777998 AATCAAGATCTGGCCGGGAGCGG - Intronic
1081992969 11:47347527-47347549 GATTAGGAGCAGGATGGGAGTGG + Intronic
1082875529 11:57984544-57984566 TATCCAGAGCAGGCTGGAAGAGG + Intergenic
1083087654 11:60167536-60167558 AATCAAGAACAGCCTGGGCGTGG + Intergenic
1083338347 11:61941460-61941482 TATAAAGACCAGGCTGGGCGTGG + Intergenic
1083406990 11:62464346-62464368 TAGCAAGTTCAGGCTGGGTGCGG - Intronic
1083541108 11:63512007-63512029 TATGAAGGTCAGGCTGGGACTGG + Intronic
1083627900 11:64081310-64081332 TATGAAGTGTAGGCTGGGCGTGG - Intronic
1083892450 11:65602822-65602844 TAGCAAGAGCAAGCTGGGTGTGG + Intronic
1083983589 11:66194252-66194274 TCTGAAGTGCAGGCTGGGCGCGG - Intronic
1084745133 11:71165322-71165344 AAACAAGACAAGGCTGGGAGTGG - Intronic
1085015003 11:73168282-73168304 TGTAAAGAGCAGGGTGGGAAAGG - Intergenic
1085227899 11:74939059-74939081 AAGAAAGAGCTGGCTGGGAGTGG + Intronic
1085303306 11:75471349-75471371 TGTCAGGAGCCGGCTGGGGGTGG - Intronic
1086541160 11:87914715-87914737 TATCAGGACCTGGATGGGAGGGG - Intergenic
1086593627 11:88544789-88544811 TTACAAGAGGAGGCTGGAAGAGG + Intronic
1087607474 11:100394217-100394239 TATCAAGGGGAGGCTGGAAGAGG + Intergenic
1088048674 11:105483695-105483717 TATCCAAATCAGGCTGGGTGTGG - Intergenic
1089003269 11:115069530-115069552 AAGCATGAGAAGGCTGGGAGGGG - Intergenic
1089427750 11:118393884-118393906 TAGAAAAAGCAGGCTGGGTGAGG - Intronic
1090000055 11:122948793-122948815 CTGCAAGAGCAGGCTGGGCGCGG + Intronic
1090359010 11:126159985-126160007 TAGAAGGAGGAGGCTGGGAGGGG - Intergenic
1090784192 11:130033905-130033927 TATAAAGAGTAGGCTGGGCGTGG - Intergenic
1091070297 11:132556778-132556800 TATCAGGAGTAGGTTTGGAGAGG - Intronic
1091125562 11:133092430-133092452 ACTCAAGAGCTGGCTGGGTGTGG + Intronic
1091527731 12:1320989-1321011 TATCAACTAGAGGCTGGGAGTGG - Intronic
1091692655 12:2607500-2607522 AATGAAGGGCATGCTGGGAGTGG - Intronic
1093067745 12:14676123-14676145 CATTGAGAGCAGGCTGGGATGGG - Intronic
1093932977 12:24972632-24972654 TAGGCAGAGCAGGGTGGGAGGGG - Intergenic
1095160883 12:38913692-38913714 TTTAGAGAGTAGGCTGGGAGTGG - Intergenic
1096257051 12:50069582-50069604 AATAAAGAGGAGGCTGGGCGCGG - Intronic
1096357521 12:50953910-50953932 AATCAAGAGTATGATGGGAGAGG + Exonic
1099294452 12:80812839-80812861 AATGAAGGGCAGGCTGGGTGTGG - Intronic
1099651202 12:85430272-85430294 TTTCAAGAGCAAGCTAGGAAAGG + Intergenic
1100245201 12:92750739-92750761 GATGAAGATAAGGCTGGGAGTGG - Intronic
1100858350 12:98778184-98778206 TATGAACAGTAGGCTGGGCGTGG + Intronic
1101325978 12:103716323-103716345 TCTGGAGAGCAGGCTGGGGGAGG + Intronic
1101367517 12:104088916-104088938 AATCAAGAGCAGGTAGGGACAGG - Intronic
1102076161 12:110061824-110061846 TATGCAGTGTAGGCTGGGAGTGG - Intronic
1103385040 12:120525385-120525407 TCAAAAGAGCAGGCTGGGCGTGG - Intronic
1103394001 12:120593908-120593930 TAACAAGTGCTGGCTGGGTGCGG - Intergenic
1103611398 12:122126398-122126420 AATCAGCAGCAGCCTGGGAGAGG + Intronic
1103796018 12:123503709-123503731 TCTCAAGATCTGGCCGGGAGTGG + Intronic
1104095551 12:125554131-125554153 TATCAACAGTAGGCCGGGCGCGG + Intronic
1105414163 13:20194120-20194142 TGTGCAGAGCAGGCTGGGTGGGG + Intergenic
1105714078 13:23044101-23044123 AAACTAGAGGAGGCTGGGAGAGG - Intergenic
1106849509 13:33774586-33774608 TAATAACAGCAGGCTGGGCGCGG + Intergenic
1107907057 13:45071037-45071059 TAGCAAGAGCAGGCAAGGTGTGG + Intergenic
1108232747 13:48366826-48366848 GATTAAAAGCAGGCTGGGCGCGG + Intronic
1108540021 13:51433151-51433173 AAACAAAATCAGGCTGGGAGTGG + Intronic
1109634451 13:65096184-65096206 TATCAAGAGTGGGCTGGGCACGG + Intergenic
1110047872 13:70854194-70854216 TCTCAAGAGCCGGCTGGGCGCGG - Intergenic
1110775889 13:79407419-79407441 TAGCAAGAGCAGGGGTGGAGAGG + Intergenic
1111294812 13:86264622-86264644 TGTTAAGAGCAGACTGTGAGTGG - Intergenic
1111534631 13:89586776-89586798 TATGGAGGGGAGGCTGGGAGTGG + Intergenic
1111833101 13:93354652-93354674 TACCAACAGAAGGCTGGGTGCGG - Intronic
1112158562 13:96844955-96844977 CATGAAGAGCAGGATGGGAGTGG - Intergenic
1112299143 13:98214168-98214190 TCTGAGGAGGAGGCTGGGAGAGG - Intronic
1112408868 13:99145135-99145157 TTTAAAAATCAGGCTGGGAGCGG - Intergenic
1112670363 13:101628728-101628750 TATCAAGAGAGGGCTGGGTGTGG - Intronic
1113334071 13:109361349-109361371 TTGCAAGAGCAGCCTGGGAAAGG + Intergenic
1113369206 13:109707267-109707289 TCTCAAGAGAGGCCTGGGAGTGG + Intergenic
1114428567 14:22640809-22640831 TATCAAGAAGAGGCTGGGTGTGG - Intergenic
1114455792 14:22852851-22852873 GATTAAGGGCAGGCAGGGAGTGG - Intergenic
1114461686 14:22890187-22890209 TGGGAAGAGGAGGCTGGGAGAGG + Intergenic
1114547285 14:23512359-23512381 AATCAAAAGCAGGCAGGGAAGGG + Intergenic
1115917269 14:38329939-38329961 TACCAAGAACAAACTGGGAGGGG - Intergenic
1116283305 14:42938528-42938550 ATACAAGTGCAGGCTGGGAGCGG - Intergenic
1116332676 14:43615304-43615326 TCCCAAGATCAGGCTGGGATTGG - Intergenic
1118048667 14:62002782-62002804 TATCAAGAGCTGCCTGAGACTGG + Intronic
1118330363 14:64810386-64810408 TACCAAAATCAGGCTGGGCGTGG + Intronic
1118342226 14:64904383-64904405 GATAAAGGGCAGCCTGGGAGAGG - Intergenic
1118727103 14:68636796-68636818 ATACAAGAGCAGGCTGGGAGGGG + Intronic
1118813348 14:69291498-69291520 GACCAAGAGCAGGGTGGGTGGGG - Intronic
1119354918 14:73998298-73998320 TAGAAAGAGCAGGGAGGGAGAGG - Intronic
1119512318 14:75221199-75221221 TACAAAGAGTAGGCTGGGCGTGG + Intergenic
1120496063 14:85237492-85237514 TATAAAGAGGACACTGGGAGTGG - Intergenic
1120639375 14:86991619-86991641 TAAAAAGACCAGGCTGGGTGCGG - Intergenic
1121250605 14:92497089-92497111 TCACAAGGGCAGGCTGGGCGTGG - Exonic
1121439256 14:93938614-93938636 TGTCAAGAGCAGGCTGGTGTAGG - Intronic
1121690075 14:95871890-95871912 TAACAGGACCAGGCTGGGGGCGG + Intergenic
1121865228 14:97356585-97356607 TATCAAGAGCAGAGTAGCAGGGG - Intergenic
1121948512 14:98147186-98147208 TTTAAAGAGGAGGCTGGGGGAGG - Intergenic
1122245183 14:100397612-100397634 CATAAAGAACAGCCTGGGAGGGG + Intronic
1122444173 14:101757249-101757271 GTTCAAGAGCAGCCTGGGCGTGG - Intergenic
1122749518 14:103922215-103922237 TATGCAGAGCAGGCCGGGCGCGG - Intronic
1123020410 14:105395352-105395374 TTTCAAGAACAGCCTGAGAGTGG - Exonic
1123691219 15:22839744-22839766 TATGAAAAAAAGGCTGGGAGAGG - Exonic
1124169578 15:27360659-27360681 GAGCAGGAGCAGGCTGGAAGGGG - Intronic
1124429182 15:29591601-29591623 TAAAAAGAGAAGGCTGGGTGCGG + Intergenic
1124790673 15:32723290-32723312 AATCAAGAGCAGTCTGGGGGTGG + Intronic
1125346875 15:38727369-38727391 AATCAAGAGCACGCTGTGTGAGG - Intergenic
1125501833 15:40244686-40244708 TAGAAAAAGCAGGCTGGGTGTGG - Intronic
1125974366 15:43937975-43937997 TACCATGTGCAGGCTGGGAGCGG + Intronic
1127513683 15:59670781-59670803 TAGCAACAGAAGGCTGGGCGCGG + Intronic
1127679741 15:61281879-61281901 AATTAAGAGCTGGCTGGGTGCGG + Intergenic
1128277492 15:66365833-66365855 TATGCAGAGCAGGCTGGGCGCGG - Intronic
1128331455 15:66758281-66758303 TCTCAAGAGAAGACTGGGATGGG - Intronic
1128442729 15:67727906-67727928 TCCCAAGAGCAAGCTGGGAAAGG - Exonic
1129536853 15:76320304-76320326 TGTCCATAGCAGGCTGGGCGTGG + Intergenic
1132326410 15:100973744-100973766 TCTCAAGAGCACGCGGGCAGTGG + Intronic
1133421660 16:5651704-5651726 TATAAAAAGCAGGCAGGGATGGG - Intergenic
1133770615 16:8865516-8865538 TTTGCAGAGCAGGCTTGGAGAGG - Intronic
1134022519 16:10930877-10930899 TCTCAGGAGCAGGCTGGTGGAGG - Exonic
1134542531 16:15079098-15079120 TATGAAGAGGAGGCCGGGCGTGG - Intronic
1134911088 16:18026963-18026985 TAACCAGAGTAGGCCGGGAGCGG - Intergenic
1135032285 16:19047987-19048009 CATCAAGAGTAGGCCGGGTGCGG - Intronic
1135123935 16:19791117-19791139 TGTTAAGAGCAGACTGTGAGTGG + Intronic
1135360108 16:21805176-21805198 TATGAAGAGGAGGCTGGGTGTGG - Intergenic
1135704133 16:24659969-24659991 TATCTACTGCAAGCTGGGAGAGG + Intergenic
1135829528 16:25761102-25761124 AATCAGGAGCAAGCTGGGTGAGG + Intronic
1136023065 16:27452231-27452253 AATGAATAGGAGGCTGGGAGTGG + Intergenic
1136262698 16:29091764-29091786 TATGAAGAGGAGGCCGGGTGTGG + Intergenic
1136297812 16:29313605-29313627 TGTCAAGAGCAGTGGGGGAGTGG + Intergenic
1136524733 16:30821774-30821796 TAGAAAGAGCAGGGAGGGAGAGG - Intergenic
1137290043 16:47046303-47046325 TTTCAAGAATAGGCCGGGAGCGG + Intergenic
1137493243 16:48950547-48950569 TATCAAGGGCAAGATGGGATGGG - Intergenic
1137549566 16:49427973-49427995 CACCGAGAGCAGGCTGGGTGGGG - Intergenic
1137549579 16:49428025-49428047 CTCCAAGAGCAGGCTGGGTGGGG - Intergenic
1138874624 16:60934666-60934688 AATAAAGAGCAGAGTGGGAGAGG + Intergenic
1138964853 16:62071768-62071790 TGTGATGAGCAGGCTGGGCGTGG - Intergenic
1139641570 16:68295578-68295600 TAAGAAGAGAAGGCTGGGCGTGG - Intronic
1140017861 16:71205682-71205704 TATCAATGGCAGGGTAGGAGAGG - Intronic
1140056419 16:71529855-71529877 TCTCAAGAGGGGGCTGGGCGCGG + Intronic
1140246438 16:73254062-73254084 TACCTGGAACAGGCTGGGAGTGG - Intergenic
1141305792 16:82862710-82862732 TAACAAGAGCAGGCTAGGCTAGG + Intronic
1141958275 16:87387006-87387028 TAGAAAGAAAAGGCTGGGAGTGG + Intronic
1142828117 17:2527184-2527206 AAACAAAACCAGGCTGGGAGTGG - Intergenic
1143616720 17:8055938-8055960 GATAAAGAGGAGGCTGGAAGAGG - Intergenic
1143825725 17:9605419-9605441 TAAAAAGATCAGGCTGGGCGCGG + Intronic
1143953275 17:10650264-10650286 TAAAAAGATCAGGCTGGGCGCGG - Intronic
1144701099 17:17340812-17340834 AAACAAGAGCAGGCCGGGCGCGG - Intronic
1146258511 17:31405642-31405664 AATAAAGAGCAGGCTGGGTGCGG - Intronic
1146484118 17:33229592-33229614 TGTGAAGAGCATTCTGGGAGGGG + Intronic
1146984414 17:37201146-37201168 AGTCAACAGAAGGCTGGGAGTGG + Intronic
1147127742 17:38383832-38383854 AATATAGAGCAGGCTGGGCGCGG - Intronic
1147185035 17:38708604-38708626 AATTAAAAGCAGGCTGGGTGTGG + Intronic
1147462216 17:40580503-40580525 GACCAAGGCCAGGCTGGGAGTGG + Intergenic
1147466802 17:40616794-40616816 TGGCCAGTGCAGGCTGGGAGAGG - Intergenic
1147631427 17:41934640-41934662 TACCAGGAAAAGGCTGGGAGTGG - Intronic
1148856304 17:50580914-50580936 GAGCCTGAGCAGGCTGGGAGTGG + Intronic
1148939720 17:51197795-51197817 AATTAAGAGTAGGCTGGGTGTGG - Intronic
1149312226 17:55406102-55406124 TTTCAAAAACAGGCTGGGTGCGG + Intronic
1149808717 17:59644839-59644861 TAGGAAGAGCTGGCTGGGCGTGG - Intronic
1149811174 17:59674051-59674073 TATTAAAAGCAGGCTGGGCATGG - Intronic
1149900281 17:60470554-60470576 AATAAAGAGCAGGCTGGGCATGG - Intronic
1150424846 17:65069034-65069056 TATCTTGAGCAGCCTGGGAAAGG - Intergenic
1150454387 17:65295005-65295027 AAGCAAGAGGAGGCTGGGTGCGG + Intergenic
1150535496 17:66035128-66035150 TTTCAAGTTCAGGCTGGGCGTGG - Intronic
1150954861 17:69846367-69846389 TCTCAAGAGCAGGTTGGCTGGGG - Intergenic
1151454427 17:74217668-74217690 TCTCAGGGGGAGGCTGGGAGAGG - Intronic
1151501441 17:74492236-74492258 TTATAAGAGGAGGCTGGGAGTGG - Intergenic
1151685263 17:75642445-75642467 TGGCAATAGCAGGCAGGGAGGGG + Intronic
1151883262 17:76907339-76907361 TTACAAAAGCAGGCTGGGTGCGG - Intronic
1152430055 17:80243874-80243896 CATGAAGGCCAGGCTGGGAGGGG + Intronic
1153579734 18:6560799-6560821 TATCTAAAGCAGGCTGGGCGTGG - Intronic
1153876915 18:9382205-9382227 AAACAAGAGGAGGCTGGGCGAGG + Intronic
1155948956 18:31887353-31887375 TAGTAAGAGCTGGCTGGGCGTGG + Intronic
1161205884 19:3041315-3041337 TAGCAATGGCAGGCTGGGCGCGG - Intronic
1161803032 19:6426254-6426276 TGGCAAAAGCAGGCTGGGGGTGG - Exonic
1163253147 19:16138744-16138766 TAGCAAGGGCAGGCTGGGTGCGG - Intronic
1164083654 19:21882045-21882067 TATCAAGAGAATACTGGTAGTGG + Intergenic
1165200458 19:34139496-34139518 GTTCAAGAGAAGGCCGGGAGCGG - Intergenic
1165234726 19:34411533-34411555 AACCATGAGCAGGCTGGGCGTGG - Intronic
1166460632 19:42984960-42984982 TAGCAAGATCAGGTTTGGAGAGG - Intronic
1166878363 19:45912032-45912054 TATCAGGGGCCGGCTGGGAGGGG + Intergenic
1167516259 19:49924732-49924754 GAACTAGAACAGGCTGGGAGGGG + Intronic
1167625784 19:50588194-50588216 TTCCAAGAGCAGGCTGGGCATGG + Intergenic
1167704489 19:51071382-51071404 TAGAAAGAGCAGGGAGGGAGAGG - Intergenic
1167789283 19:51662818-51662840 TAGGAGGAGCAGGCTTGGAGTGG - Intergenic
925612821 2:5717423-5717445 TAGCAAAAGTAGGCTGGGTGTGG - Intergenic
926087893 2:10031695-10031717 AAACAAGAGCTGGCAGGGAGGGG - Intergenic
926883405 2:17574203-17574225 TATAAAGATCAGGGTGGGGGGGG - Intronic
927392256 2:22608851-22608873 TATAAAGAGCAGGCTCTGAAAGG - Intergenic
927612239 2:24552653-24552675 TATAAAGCACAGGCCGGGAGCGG - Intronic
927752702 2:25684003-25684025 TACTAAGAACAGGCTGGGCGTGG - Intergenic
929044059 2:37773508-37773530 GAGCAAGAGGAGGCTGGGAGGGG + Intergenic
929906013 2:46047174-46047196 GATTAAGAGCAGGCTGGGCCAGG + Intronic
929948800 2:46390349-46390371 TAACAAGAGCAGGTTTGGTGGGG + Intergenic
930146858 2:48016447-48016469 GATGTAGAGCAGGCTGGAAGAGG - Intergenic
931366728 2:61625761-61625783 TATAAAAAGCAGGCTGGGCCGGG + Intergenic
931378783 2:61732641-61732663 TATCTAGAACAGGCCGGGCGCGG - Intergenic
931753161 2:65348510-65348532 TATCTATAGCAGGCTGGAAGCGG + Intronic
931899946 2:66777246-66777268 AATCAAAAGCAGGCTGGGATTGG + Intergenic
932412501 2:71555603-71555625 GAACCAGAGCAGGCTCGGAGAGG + Intronic
932746111 2:74334914-74334936 TATCCTGAGGAGGCGGGGAGGGG + Intronic
932968703 2:76511192-76511214 TCTCAAGAGCAGGTGGGGACTGG + Intergenic
935202568 2:100870680-100870702 TAAGCAGAGAAGGCTGGGAGTGG - Intronic
935245474 2:101215550-101215572 TATATAGGGCAGGCTGGGTGTGG + Intronic
935568647 2:104635933-104635955 TAACAAAAGCAGGCTGGGGATGG - Intergenic
936349926 2:111704819-111704841 AAAAAAGAGCAGGCTGGGCGTGG + Intergenic
937001015 2:118467660-118467682 TGTCATGAGCAGGCAGGGAAGGG + Intergenic
938193655 2:129305108-129305130 TATCAACAGCAGAATGGAAGGGG + Intergenic
939944910 2:148397617-148397639 TATAAGGATCAGGCTGGGCGCGG - Intronic
941361311 2:164554801-164554823 TATGAAGAGCAGTCTAGGGGAGG - Intronic
941621427 2:167783633-167783655 TATTAAGCACAGGCTGGAAGAGG + Intergenic
941821738 2:169850467-169850489 GATCCAGAGCAGGCCGGGTGCGG - Intronic
942044209 2:172090073-172090095 TCTCAAGAGCTGGCTGGGTGTGG - Intergenic
943685111 2:190810143-190810165 TGTCAATGCCAGGCTGGGAGAGG + Intergenic
944224471 2:197336139-197336161 TAAAAAGAGCCGGCTGGGTGAGG - Intergenic
944504625 2:200397926-200397948 CAGCCAGAGCAGGCAGGGAGAGG + Intronic
944746759 2:202664973-202664995 TATCAAGATCAAGCTGGGTTTGG + Intronic
945231156 2:207591721-207591743 AATCAAAAGGAGGCTGGGAATGG - Intronic
946864833 2:224033599-224033621 TGGAAAGAGCAGGCTGGGAGAGG - Intronic
946932593 2:224685604-224685626 TAACAAGTGCCGGCTGGGCGCGG + Intergenic
948772620 2:240259231-240259253 GAGCAAGAGGAGGCGGGGAGCGG + Intergenic
1169241156 20:3982238-3982260 TTTCAAGAGGAGTTTGGGAGGGG - Intronic
1169272491 20:4211328-4211350 TATTCAGAGCTAGCTGGGAGCGG + Intergenic
1169911747 20:10652780-10652802 TGTCAGGAGTCGGCTGGGAGGGG - Intronic
1171992902 20:31709980-31710002 TAACAAGAGCAGGCTGTGGCTGG - Intronic
1172256999 20:33527832-33527854 TATACAAATCAGGCTGGGAGTGG - Intronic
1172975198 20:38900845-38900867 TATCAAGAGCAGGACATGAGAGG + Intronic
1173480923 20:43398764-43398786 TCTGAGGCGCAGGCTGGGAGAGG - Intergenic
1174618166 20:51852443-51852465 TCACAAGAGCAAGCTGGGTGTGG - Intergenic
1174770061 20:53291179-53291201 TATCAAGAGCAGGCTGGGAGCGG + Intronic
1175184011 20:57167603-57167625 TATTAAGAGCAGGATAGTAGAGG - Intergenic
1175224657 20:57438043-57438065 TATCATGTGCCGGCTGGGCGCGG + Intergenic
1175519509 20:59591177-59591199 TGTCAAGGGCAGGCTGGGGCTGG - Intronic
1175578699 20:60081965-60081987 CATGAAGAGGAAGCTGGGAGAGG + Intergenic
1175917307 20:62432530-62432552 GCCCAAGAGCTGGCTGGGAGAGG - Intergenic
1177147337 21:17420792-17420814 TTTCAAGGACAGGCTGGGTGCGG + Intergenic
1178259396 21:31084973-31084995 TAACAAGAGGAGGTTGGTAGGGG - Intergenic
1178310024 21:31522159-31522181 TATTAAGAGCCGGCCGGGCGTGG - Intronic
1178538293 21:33428514-33428536 AATGAAGAGGAGGCTGGGAACGG - Intronic
1178940427 21:36900894-36900916 TAGGAAGAGCAGGTTTGGAGAGG + Intronic
1178949115 21:36971536-36971558 TTTCAAGAGCCGGCTGGGCGCGG + Intronic
1179271041 21:39851170-39851192 TCTCAAGAGAGGGCTGGCAGCGG + Intergenic
1180930212 22:19585107-19585129 ATTCAAGAGCAAGCTGGTAGTGG - Intergenic
1181928060 22:26376321-26376343 CAGGAAGAGAAGGCTGGGAGGGG + Intronic
1183159838 22:36105179-36105201 CAGCAAGAGCAGGCTGGGTGTGG - Intergenic
1183160027 22:36106730-36106752 AAGCAAGAGCAGGCCGGGTGCGG - Intergenic
1183742364 22:39675869-39675891 TTGGAAGATCAGGCTGGGAGGGG + Intronic
1183996560 22:41637832-41637854 AATCAGAAGCAGGCTGGGCGCGG + Intronic
1184095840 22:42315821-42315843 TATAAAGACAAGGCTGGGCGTGG + Intronic
1184126498 22:42491118-42491140 TAGCAATAACAGGCTGGGCGTGG + Intergenic
1184381886 22:44149863-44149885 TATCATGGGCAGGCTGGGCGCGG + Intronic
1184698362 22:46151688-46151710 TATCCCAAGGAGGCTGGGAGAGG - Intronic
1184873910 22:47260455-47260477 GACCAAGAGGAGGCTGAGAGGGG + Intergenic
1185221714 22:49632368-49632390 TCTCAAGACCACCCTGGGAGAGG + Intronic
1185334400 22:50265184-50265206 TGTCCAGCACAGGCTGGGAGCGG - Intronic
1203296181 22_KI270736v1_random:44904-44926 GAGCAAGAGGAGGCTGGGAGGGG + Intergenic
949358051 3:3202553-3202575 TAGCTTGAGCAGGCTGGGTGTGG + Intergenic
949399848 3:3654564-3654586 TATAAAGAGCAGGGTGGGTGTGG + Intergenic
949857610 3:8476355-8476377 AGTCAAGGCCAGGCTGGGAGAGG - Intergenic
949929793 3:9069656-9069678 TAGCAAGAGCGGGCTGGGCGCGG + Intronic
950119657 3:10473339-10473361 TATGAAGAGCAGGCCAGGTGTGG + Intronic
951184167 3:19692959-19692981 TATCAACATCAGGCTGGGCATGG + Intergenic
951444684 3:22764874-22764896 TATTAAAAGCAGGGTGGGAGTGG + Intergenic
951810439 3:26693038-26693060 GATCAAGAGCAGGCCGGGCGCGG + Intronic
952930291 3:38354792-38354814 TATTAACAACAGGCTGGGTGTGG - Intronic
953131338 3:40142341-40142363 AATCAACAGCAGGCCGGGTGCGG - Intronic
953197214 3:40745921-40745943 AATCAAGACCAGGGTGGTAGAGG + Intergenic
953963566 3:47284625-47284647 TAAGAAGAGCAGGCTGGGCGCGG - Intronic
954896086 3:53976186-53976208 TGGCCAGGGCAGGCTGGGAGAGG + Intergenic
955348080 3:58175532-58175554 TCTCAAGAGCAGGCAGGAAATGG + Intergenic
955537906 3:59943655-59943677 TACCAAGAACAGCCTTGGAGTGG + Intronic
955627496 3:60934148-60934170 TACCCAGATGAGGCTGGGAGAGG + Intronic
955929346 3:64040378-64040400 AATCAAGGGAAGGCTGAGAGTGG - Intergenic
956094314 3:65700151-65700173 AATCAATAGCAGGCTGGGCGCGG + Intronic
956212414 3:66815247-66815269 TAACAAAAGGAGGCTGGGCGCGG + Intergenic
958804953 3:98799402-98799424 TATCAGGAGCAGGAAGGGATGGG - Exonic
959656675 3:108814016-108814038 TATTAACAGTTGGCTGGGAGTGG + Intergenic
959737188 3:109672956-109672978 TATCCAGAGATGGCTGGGTGGGG + Intergenic
960076478 3:113491328-113491350 TATCTATAGCAGGCCGGGCGTGG + Intronic
960138108 3:114125800-114125822 TTTTAACAGCAGGCTGGGCGTGG + Intergenic
960334595 3:116400765-116400787 AAACAAGATCAGGCCGGGAGTGG - Intronic
960709570 3:120513998-120514020 TATTAAGAGAAAGCTTGGAGAGG - Intergenic
960948113 3:122980822-122980844 TCTCAGGAGCAGGCGGGGAGTGG - Intronic
961003250 3:123388231-123388253 TAACCAGGGCAGGTTGGGAGGGG + Intronic
961055847 3:123788185-123788207 GATTAAGATGAGGCTGGGAGTGG - Intronic
961602686 3:128073349-128073371 CAGCAGGAGCAGGCTGGGGGCGG - Intronic
964044545 3:152307277-152307299 TATGAATAGTAGGCTGGGCGCGG - Intronic
964753340 3:160072470-160072492 AATCAAGAATAGGCTGGGTGTGG - Intergenic
964921392 3:161900583-161900605 AAACAAAAGCAGGCTGGGTGTGG + Intergenic
966760715 3:183416817-183416839 TTTAGAGATCAGGCTGGGAGTGG + Intronic
966819019 3:183910567-183910589 TGTCAAATGCAGGGTGGGAGGGG - Intergenic
967033837 3:185632523-185632545 TCTCAAAAACAGGCTGGGTGAGG - Exonic
967325865 3:188239086-188239108 GATCAGGAGCAGGATGGTAGTGG + Intronic
967336758 3:188352643-188352665 CATAGAGAGAAGGCTGGGAGAGG + Intronic
967347583 3:188475610-188475632 TATGAAAAGCAGGCCGGGCGTGG + Intronic
968861200 4:3171765-3171787 AATCAAGAAGGGGCTGGGAGTGG - Intronic
969185091 4:5468770-5468792 TATCTAGAGGAGGCCGGGCGCGG + Intronic
969210303 4:5682198-5682220 TAGCAATAGCAGGCCGGGGGCGG + Intronic
969403854 4:6975800-6975822 TATCCAATCCAGGCTGGGAGTGG + Intronic
969573610 4:8024248-8024270 CAGGAAGTGCAGGCTGGGAGGGG - Intronic
970218600 4:13784723-13784745 TACCAAAAGCAGGCCGGGCGCGG + Intergenic
970251715 4:14123360-14123382 TAGGAAGTGCAGACTGGGAGAGG - Intergenic
970418758 4:15884667-15884689 TAACAACAGTAGTCTGGGAGAGG - Intergenic
971385637 4:26138552-26138574 AATCAAGAGTTGGCTGGGAGTGG + Intergenic
972485817 4:39539401-39539423 TAGAAAGAGCAGGGAGGGAGAGG + Intergenic
972486291 4:39544088-39544110 TAGAAAGAGCAGGGAGGGAGAGG + Intergenic
973674144 4:53247567-53247589 TAACAAGATCAGGCCGGGCGCGG + Intronic
974936877 4:68419306-68419328 TTTTAAAAGCAGGCTGGGTGTGG - Intergenic
975787476 4:77907566-77907588 CATCAAGAACAGGAGGGGAGGGG - Intronic
976179160 4:82382796-82382818 TATCAAAAGGAGGCTGGGAGTGG - Intergenic
977575601 4:98670804-98670826 TACCAATAGCAGGCTGTAAGGGG - Intergenic
978101635 4:104848550-104848572 TATCAAGGTCAGGCCGGGCGTGG - Intergenic
980739695 4:136933131-136933153 TACCAGGAGCAGGAAGGGAGGGG + Intergenic
980997178 4:139790551-139790573 TATCAGGTGCAGGCGGGGAAAGG - Intronic
981111611 4:140940922-140940944 ATTCAAGAGCAAGCTGGCAGTGG - Intronic
981602156 4:146501917-146501939 TTTGAAGAGCAGGATGGTAGTGG - Intronic
983930911 4:173452359-173452381 AAGCAAGAGGAGGATGGGAGGGG + Intergenic
984767921 4:183413739-183413761 TTTCAGGAGCAGGCTGAGCGCGG + Intergenic
984894601 4:184526884-184526906 TAACAACAGCAGGCTGGGTGCGG + Intergenic
985210598 4:187588624-187588646 GATCAAGAGATGGCTGGGCGTGG - Intergenic
985513019 5:322479-322501 TGGCAAGGGCAGGCGGGGAGGGG + Intronic
986550894 5:8953732-8953754 TATCAAAAGCTGGCCGGGCGTGG - Intergenic
986785807 5:11112850-11112872 TATCATGTACAGGCTGGGCGCGG + Intronic
986823265 5:11492778-11492800 TATTAAGAAAAGGCTGGGTGTGG + Intronic
987313660 5:16704034-16704056 TATCAGGAGAAGGCTGGGTACGG + Intronic
989125516 5:38048989-38049011 TTTCAGGAGCAGGCAGGGAAAGG - Intergenic
989527976 5:42475166-42475188 AATCAAGGGCAGGCTGGGCGCGG - Intronic
989622730 5:43400792-43400814 TAAGAAGGGCAGGCTGGGTGTGG + Intronic
990670727 5:58127305-58127327 TATAAAAAGCAAGCTGGGTGAGG + Intergenic
990963472 5:61419110-61419132 TATAAAGAGGAGGCCGGGCGTGG - Intronic
993728907 5:91399642-91399664 TTTCTAAAGCAGGCTGGAAGGGG - Intergenic
993782238 5:92081507-92081529 TATCAAGTGCAGGCTGGGCGCGG - Intergenic
994092071 5:95818394-95818416 TCTAAAGAGGAGGCTGGGACGGG - Intronic
994117918 5:96081664-96081686 TCTCTGAAGCAGGCTGGGAGTGG - Intergenic
996011093 5:118482693-118482715 TCTCAGAATCAGGCTGGGAGGGG + Intergenic
996041614 5:118820229-118820251 CATCAAGAGTAGGGTGGGTGTGG - Intergenic
996083253 5:119278154-119278176 TATGAAGGGCAGTCTGGGATTGG + Intronic
996555737 5:124777339-124777361 TATCTAGAGAAGGCCGGGTGTGG + Intergenic
996577160 5:124988098-124988120 TATAAAGAGCAGCCTGAGACTGG - Intergenic
998120539 5:139573009-139573031 TATCAAGATGAGGCTGGGCGCGG + Intronic
998380125 5:141718345-141718367 TACCAAGAGTAGCCTGGGAAAGG - Intergenic
998887114 5:146706171-146706193 TAGGAGGGGCAGGCTGGGAGGGG + Intronic
999206953 5:149855824-149855846 AAACAAGAACAGGCTGGGCGCGG + Intergenic
999726812 5:154445187-154445209 GATGAAGTGAAGGCTGGGAGTGG - Intergenic
1000004757 5:157173134-157173156 AATAAAGATCAGGCTGGGCGCGG + Intronic
1000156628 5:158558727-158558749 TATCAAGTGGAGGCTCAGAGAGG - Intergenic
1000331103 5:160206141-160206163 TAATAAAAGCAGGCTGGGCGTGG + Intronic
1001651812 5:173321097-173321119 TTTCCAGAGCAGGCTGGGGTGGG + Intronic
1001711373 5:173781146-173781168 AATCAGCAGCAGGCCGGGAGCGG + Intergenic
1001977675 5:176013715-176013737 TATCAATTCCAGGCTGGGTGCGG - Intronic
1002005777 5:176233504-176233526 TCTCAATAGCAGGCTGCGTGCGG + Intergenic
1002220599 5:177677118-177677140 TCTCAATAGCAGGCTGCGTGCGG - Intergenic
1002239744 5:177830050-177830072 TATCAATTCCAGGCTGGGTGCGG + Intergenic
1002611552 5:180422107-180422129 TATCAGAAACAGGCTGGGCGCGG + Intergenic
1003059318 6:2850389-2850411 TATCATAAACAGGCTGGGCGCGG - Intergenic
1003271849 6:4614331-4614353 TATCCAGAGAAGGCAGAGAGGGG - Intergenic
1004521432 6:16364591-16364613 TATCTAGAACTGGCTGGGTGCGG - Intronic
1005004542 6:21274560-21274582 AACCAAAAGTAGGCTGGGAGCGG - Intergenic
1005022520 6:21431842-21431864 TAGGAAGAGTAGGCTGGGCGTGG + Intergenic
1005050874 6:21683002-21683024 TAACAAGAAGAGGCTGGGTGTGG - Intergenic
1005254806 6:23990057-23990079 TATAAAGAGCAGGAAGCGAGGGG - Intergenic
1005333910 6:24774768-24774790 TTCCAAGAGCAGGGTCGGAGGGG + Intergenic
1006056596 6:31389682-31389704 TATCAGAAGAGGGCTGGGAGTGG - Intergenic
1006069320 6:31486661-31486683 TATCAGAAGAGGGCTGGGAGTGG - Intergenic
1006341413 6:33449124-33449146 AGTCAGGAGGAGGCTGGGAGGGG - Intronic
1006632725 6:35440980-35441002 GATCAAAACTAGGCTGGGAGTGG - Intergenic
1006677560 6:35775408-35775430 AAGCAGAAGCAGGCTGGGAGTGG + Intergenic
1007000147 6:38304255-38304277 CATCAAAAGAAGGCTGGGTGTGG + Intronic
1007385537 6:41518044-41518066 TATGAGGAGGAGGCTGGGGGTGG - Intergenic
1008863286 6:56177501-56177523 TGTCAAGTGCAGACTGGGCGCGG + Intronic
1009543988 6:65001394-65001416 TACCAAGAGGAGTTTGGGAGTGG - Intronic
1010150277 6:72723144-72723166 TACCAAAATCAGGCTGGGCGTGG - Intronic
1010651677 6:78462986-78463008 TCTCCAAAGCAGGCTGGGCGTGG + Intergenic
1013076602 6:106777193-106777215 TATCAAGAGCATTTGGGGAGAGG - Intergenic
1015288276 6:131509224-131509246 TATGCAGAGCTGGCTGGGATTGG + Intergenic
1015551686 6:134418821-134418843 TGTCCACAGGAGGCTGGGAGAGG - Intergenic
1016837966 6:148498091-148498113 TATCAAAGGCTGGCTGGGCGTGG + Intronic
1018513678 6:164554862-164554884 CAAGTAGAGCAGGCTGGGAGAGG - Intergenic
1018859137 6:167698461-167698483 AGGCAAGAGCAGGCGGGGAGAGG + Intergenic
1020224370 7:6268458-6268480 TTACAAGAGCAGGCCGGGCGCGG - Intronic
1020741034 7:12018577-12018599 AAGCAAGAGCAGGGTTGGAGAGG + Intergenic
1020969479 7:14917124-14917146 CAACAAAAGCAGGCTGAGAGGGG + Intronic
1021226723 7:18036580-18036602 TTTCAGGCTCAGGCTGGGAGCGG - Intergenic
1022076783 7:26979147-26979169 TAACAAAAGCAGGCTGGGCGTGG - Intronic
1022256095 7:28659794-28659816 TATCAAGAGGAGGTTATGAGAGG - Intronic
1022300394 7:29097402-29097424 AATAAAGACAAGGCTGGGAGCGG + Intronic
1022707132 7:32812625-32812647 TAACAAAAGCAGGCTTGGTGTGG + Intergenic
1022915739 7:34950008-34950030 TAACAAAAGCAGGCTTGGTGTGG - Intronic
1023429946 7:40080276-40080298 TATTAAGAAAAGGCTGGGCGTGG - Intronic
1024787151 7:52921525-52921547 TATGAAGAACAGGCTGGGAGCGG + Intergenic
1025152531 7:56570411-56570433 TATTAAAAACAGGCTGGGTGCGG + Intergenic
1025900022 7:65736567-65736589 TTTCATGAGTAGGCTGGGTGTGG + Intergenic
1026308952 7:69167229-69167251 TTTCAACAACAGGCTTGGAGGGG + Intergenic
1026681904 7:72473244-72473266 TAGCAAGAACAGGCTGGGCCGGG - Intergenic
1026729708 7:72900792-72900814 ATATAAGAGCAGGCTGGGAGGGG - Intronic
1026973440 7:74481447-74481469 AAACAAAAGCAGGCTGGGCGTGG - Intronic
1027048762 7:75008282-75008304 TCTCAAGAGCAGGAGGGGAGGGG - Intronic
1027114285 7:75466313-75466335 ATATAAGAGCAGGCTGGGAGGGG + Intronic
1027554125 7:79642085-79642107 TATCAAGATAAAGTTGGGAGAGG + Intergenic
1028377631 7:90162617-90162639 TAGAAAGAGCAGGCTGAGTGTGG - Intronic
1029384257 7:100233387-100233409 TCTCAAGAGCAGGAGGGGAGGGG + Intronic
1029547261 7:101217039-101217061 CCTCAAGAGCACGCTGGGCGGGG + Intronic
1030234229 7:107241740-107241762 TATGAAGCACAGGCTGGGCGCGG - Intronic
1030583303 7:111386166-111386188 CATGTGGAGCAGGCTGGGAGTGG - Intronic
1031954336 7:127926879-127926901 TATGAAAATCAGGCTGGGCGTGG - Intronic
1034184448 7:149163814-149163836 TACCCTGACCAGGCTGGGAGTGG + Intronic
1034310450 7:150083234-150083256 TATCTAGAGGAGGCTGGGCATGG - Intergenic
1034452859 7:151146801-151146823 GATCTAGACCAGGCTGGGAATGG + Intergenic
1034796392 7:154017407-154017429 TATCTAGAGGAGGCTGGGCATGG + Intronic
1036238804 8:7065413-7065435 TCTCATGTGCAGGGTGGGAGAGG - Intergenic
1037371997 8:18190078-18190100 TGTCAATAGCAGGCTGGGTGTGG - Intronic
1037578094 8:20226705-20226727 TATCCAGAACAGGCCGGGCGCGG - Intronic
1037967352 8:23145105-23145127 TCTCCTGAGCAGGCGGGGAGGGG + Intronic
1039204062 8:35129707-35129729 TGTCAAGAGATGGGTGGGAGAGG - Intergenic
1039669547 8:39581020-39581042 TAGCAAGAGACGGATGGGAGGGG - Intergenic
1039782877 8:40804548-40804570 TATTAAGACCAGGCCAGGAGCGG + Intronic
1040952306 8:52949856-52949878 TATCAATAGTAGTCTGGGGGTGG - Intergenic
1041718798 8:60957472-60957494 TACCAAGTCCAGGCTGGGCGCGG - Intergenic
1041719258 8:60961546-60961568 TAGCGAGTGCAAGCTGGGAGTGG + Intergenic
1042820413 8:72924155-72924177 TGTCAAGCACAGGCTGGGAGAGG + Intronic
1044121656 8:88404243-88404265 TAAGAGAAGCAGGCTGGGAGCGG - Intergenic
1044880459 8:96718080-96718102 CTTCTAGGGCAGGCTGGGAGGGG - Intronic
1046821265 8:118636682-118636704 GAGCCAGAGCAGGCTGGCAGTGG + Intergenic
1047270638 8:123354549-123354571 TACAAAGAACAGGCTGGGTGCGG + Intronic
1047588136 8:126297077-126297099 TATCAATATTAGGCTGGGAGCGG + Intergenic
1048004082 8:130404565-130404587 ACTGAGGAGCAGGCTGGGAGAGG - Intronic
1048886354 8:138913053-138913075 GACCTAGAGAAGGCTGGGAGAGG + Intronic
1050488030 9:6155723-6155745 TAAGAAGAACAGGCTGGGTGTGG + Intergenic
1052500233 9:29279766-29279788 TAATAAGAGCAGTCTGGGTGTGG - Intergenic
1053191065 9:36069247-36069269 TATGAAGAGCAGGCCGGGTGCGG + Intronic
1053242082 9:36504294-36504316 TATAAAGAACAGGCTGGGGGCGG + Intergenic
1056353127 9:85771947-85771969 TATCTATATCAGGCTGGGCGCGG - Intergenic
1056387447 9:86110770-86110792 AATCAATGGCAGGCTGGGCGTGG - Intergenic
1056661141 9:88544244-88544266 GAGCAGGAGCAGGCTGGGTGGGG + Intronic
1057111041 9:92471483-92471505 GATCAAGACCCGGCTGGGTGCGG - Intronic
1057360114 9:94365615-94365637 GCTCATGAGCAGGCTGGGATGGG + Intergenic
1057585843 9:96327910-96327932 TAAGAAGTGCAAGCTGGGAGTGG - Intronic
1057601682 9:96463543-96463565 TATCTAAAGCAGGCTGGGCTCGG - Intronic
1057663226 9:97022473-97022495 GCTCATGAGCAGGCTGGGATGGG - Intergenic
1057809171 9:98244366-98244388 TATGCAGACCTGGCTGGGAGCGG + Intronic
1059172534 9:112139598-112139620 GTTCAAGACCAGCCTGGGAGTGG - Intronic
1059209842 9:112503361-112503383 TTTCAAGAGCTGGCTGGTCGCGG + Intronic
1059230411 9:112716330-112716352 AATGAATAGCAGGCCGGGAGCGG - Intronic
1060257416 9:122044817-122044839 TATCAAAAACAGGCTGGGCGAGG + Intronic
1060301600 9:122377480-122377502 TAGCAAGAGCAGGCCGGGGCGGG - Intronic
1060642178 9:125248332-125248354 TATGAAGAGCTGGCCGGGCGCGG + Intergenic
1061705342 9:132448899-132448921 TATTATGAGCAGTCGGGGAGTGG + Intronic
1061922626 9:133790464-133790486 CAGCAAGAACAGGCTGGGCGCGG - Intronic
1062454788 9:136630296-136630318 TGGCAGGTGCAGGCTGGGAGTGG - Intergenic
1185735638 X:2493557-2493579 TATGAAGATTAGGCTGGAAGAGG + Intronic
1186072899 X:5842052-5842074 GAGAAAGAGGAGGCTGGGAGAGG + Intronic
1186187996 X:7040526-7040548 TAGCAAGATCAGGTTTGGAGAGG - Intergenic
1189631396 X:42957750-42957772 GACAAAGAGCAGGCTGGGAAAGG - Intergenic
1189792746 X:44619281-44619303 TAAAAAGAGAAGTCTGGGAGGGG - Intergenic
1189924967 X:45943429-45943451 TAAAAAGAAGAGGCTGGGAGCGG - Intergenic
1190007115 X:46750638-46750660 TATGAAGATCAGGCTGGGTGTGG - Intronic
1190643332 X:52501811-52501833 TATCAAGAGCACTGTGTGAGAGG - Intergenic
1190644340 X:52511056-52511078 TATCAAGAGCACTGTGTGAGAGG + Intergenic
1190739691 X:53280829-53280851 GAGCCAGAGCAAGCTGGGAGTGG + Intronic
1191857168 X:65636444-65636466 AATGAAAAGCAGGCTGGGTGTGG + Intronic
1192175292 X:68881241-68881263 TATGGAGAACAGGCTGGGGGAGG + Intergenic
1192327333 X:70143899-70143921 GATGATGAGCAGGCTGGGCGCGG + Intronic
1193185051 X:78501951-78501973 TATCAACAGTAGGCTGGGCACGG + Intergenic
1194479825 X:94407243-94407265 TGTCAGGTGCAGGATGGGAGTGG + Intergenic
1194631077 X:96284887-96284909 GATCAAGACCAGGAAGGGAGAGG + Intergenic
1194634436 X:96327149-96327171 TATCAAAATAAGGCTGGGAGCGG + Intergenic
1195919230 X:109966132-109966154 GAAGAAGAGCAGGCTGGGATGGG + Intergenic
1196102794 X:111865222-111865244 GTTCAAGACCAGGCTGGGGGGGG - Intronic
1196229439 X:113203954-113203976 TATAAAAAGCAGGCTAGGTGTGG - Intergenic
1196710601 X:118757979-118758001 AAATAAGAGCAGGCTGGGCGCGG - Intronic
1197268894 X:124404686-124404708 TCTCCAGGGCATGCTGGGAGGGG + Intronic
1197911733 X:131490380-131490402 TATCAAGACCAGGGAGGGAGAGG - Intergenic
1200670074 Y:6077721-6077743 CAGCAAGAGCCGGCTGGGCGCGG - Intergenic
1200798423 Y:7362698-7362720 TATCTAGAATATGCTGGGAGTGG + Intergenic
1201148749 Y:11082947-11082969 AAACAAGACAAGGCTGGGAGTGG - Intergenic