ID: 1174773348

View in Genome Browser
Species Human (GRCh38)
Location 20:53321882-53321904
Sequence AGGGACTCCCCATGAAAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 141}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174773348_1174773354 10 Left 1174773348 20:53321882-53321904 CCTGATTTTCATGGGGAGTCCCT 0: 1
1: 0
2: 0
3: 20
4: 141
Right 1174773354 20:53321915-53321937 TCTGGTGGATGTGCCACAAGAGG 0: 1
1: 0
2: 1
3: 5
4: 107
1174773348_1174773350 -8 Left 1174773348 20:53321882-53321904 CCTGATTTTCATGGGGAGTCCCT 0: 1
1: 0
2: 0
3: 20
4: 141
Right 1174773350 20:53321897-53321919 GAGTCCCTGTGAGCTGGATCTGG 0: 1
1: 0
2: 3
3: 22
4: 204
1174773348_1174773351 -5 Left 1174773348 20:53321882-53321904 CCTGATTTTCATGGGGAGTCCCT 0: 1
1: 0
2: 0
3: 20
4: 141
Right 1174773351 20:53321900-53321922 TCCCTGTGAGCTGGATCTGGTGG 0: 1
1: 0
2: 1
3: 24
4: 263
1174773348_1174773355 11 Left 1174773348 20:53321882-53321904 CCTGATTTTCATGGGGAGTCCCT 0: 1
1: 0
2: 0
3: 20
4: 141
Right 1174773355 20:53321916-53321938 CTGGTGGATGTGCCACAAGAGGG 0: 1
1: 0
2: 0
3: 12
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174773348 Original CRISPR AGGGACTCCCCATGAAAATC AGG (reversed) Intronic
900149483 1:1171866-1171888 AGGGACTCCCCAGGGACAGCCGG + Intergenic
901679526 1:10904958-10904980 AGGGACTCCTCACCAAGATCTGG + Intergenic
902587298 1:17447975-17447997 AGGCACTCCCCGTAAAAAGCTGG + Intergenic
906703392 1:47876361-47876383 AGGGACTTCCCATGGCAACCTGG + Intronic
906737899 1:48150376-48150398 AGGGACGCACCTGGAAAATCGGG + Intergenic
909099494 1:71332831-71332853 AGGGGCTCTCCATGAAACTAAGG + Intergenic
910647319 1:89527280-89527302 AGAGACACCAAATGAAAATCCGG - Intronic
911531440 1:99047977-99047999 AGGGACTTCATATGAAAACCTGG - Intergenic
911859931 1:102933844-102933866 ACGGACTCACCTGGAAAATCGGG - Intronic
912775262 1:112502648-112502670 AGGGTCTTTCCATGAAAAGCCGG - Intronic
915047468 1:153030467-153030489 AGGGATTCCCCATGATAGCCAGG + Intergenic
921747108 1:218751764-218751786 TGGGACACCCCATGGCAATCGGG - Intergenic
923383613 1:233445790-233445812 AGGGCCTCCCCAGGAATGTCAGG + Intergenic
924140611 1:241019034-241019056 AGAGCCTAACCATGAAAATCTGG + Intronic
1065498746 10:26356962-26356984 ATGGACTCCCCCTCAAAATTTGG + Intergenic
1066125456 10:32337423-32337445 AGGGACACCCTGTGAATATCTGG + Intronic
1068740582 10:60464960-60464982 AGGAACTTCTCATGAGAATCTGG - Intronic
1076337049 10:129713900-129713922 GGGGACTTCCCATGAAAGTCAGG - Intronic
1076502099 10:130945408-130945430 AGGGTTTCCCCCTGAAACTCAGG - Intergenic
1076674406 10:132140706-132140728 AGGGCTTCCCCGTGAAAAGCCGG - Intronic
1076746016 10:132514939-132514961 AGGGACTCCCCATCCATGTCTGG + Intergenic
1078067749 11:8089354-8089376 AGGGACTCCCCAGTAAATACCGG - Intronic
1080925152 11:36748464-36748486 AGGTACTCCTCACGTAAATCTGG + Intergenic
1083578938 11:63813111-63813133 AGCGACTCCCGATCAAAATCCGG + Intergenic
1083685532 11:64372958-64372980 AGGGACTCCAGATGGAAATATGG + Intergenic
1087062918 11:93999769-93999791 AGGGACTGGCCATAAGAATCTGG + Intergenic
1087087871 11:94238265-94238287 ACGGACTCACCTGGAAAATCGGG - Intergenic
1087406322 11:97735356-97735378 AAGCACTCCCCTTGAAAACCAGG + Intergenic
1091528908 12:1335304-1335326 AGGCATTCCCCTTGAAAAACTGG - Intronic
1097991565 12:65840482-65840504 ATGGCCTCCCCAGGATAATCAGG + Intronic
1099308835 12:80993161-80993183 AAGTATTCCCCATGAAAATTTGG + Intronic
1102460320 12:113095786-113095808 AGAGATTTCCCATGAAAATCTGG - Intronic
1104095003 12:125548906-125548928 AGGGGCTCCCCATCAAAAAAGGG - Intronic
1106257196 13:28032387-28032409 AGGGATGCCCCATAAAAAGCTGG + Intronic
1107574279 13:41700213-41700235 TGGGACTACCCTGGAAAATCTGG + Intronic
1108042937 13:46356278-46356300 ATGGACTCCTCATGAAAAGGAGG + Intronic
1108414736 13:50186058-50186080 ACGGACTCACCTGGAAAATCGGG - Intronic
1110489158 13:76082459-76082481 AGTGAATCCTCATGAAAATATGG + Intergenic
1110623224 13:77622668-77622690 AGGGACTCACCATGCTAACCAGG - Intronic
1111214352 13:85123444-85123466 AGGGACACACCTGGAAAATCGGG + Intergenic
1112217512 13:97448760-97448782 AAGAACTCCCCATGAGAATGTGG + Intronic
1113051146 13:106213791-106213813 ACGGACTCACCTGGAAAATCGGG + Intergenic
1116831828 14:49727932-49727954 AGGCACCCACCATGAAAATATGG + Intronic
1117611066 14:57484087-57484109 AAGGACTCCACCTGAAAAACAGG + Intronic
1119097652 14:71848724-71848746 ACGGACTCACCTGGAAAATCAGG - Intergenic
1121129887 14:91436622-91436644 AGGGACGCACCTGGAAAATCGGG - Intergenic
1125086510 15:35736551-35736573 AAGGACTCCCCATATAAAACAGG + Intergenic
1126526590 15:49663023-49663045 AGGGAGTACACATGAAATTCAGG - Intergenic
1126956692 15:53940382-53940404 AAGCATTCCCCTTGAAAATCAGG + Intergenic
1130205441 15:81870918-81870940 ACGGACTCACCTGGAAAATCGGG + Intergenic
1130218365 15:81995417-81995439 ACGGACTCACCTGGAAAATCCGG + Intergenic
1134882046 16:17753499-17753521 TGGGACTCCCTCCGAAAATCCGG + Intergenic
1138842142 16:60522996-60523018 ACGGACTCACCTGGAAAATCGGG + Intergenic
1139747993 16:69089779-69089801 ACGGACTCCCTATGAAGAACTGG - Intergenic
1141994689 16:87628858-87628880 AGTGACTCCCAATGAACATTGGG - Intronic
1143204659 17:5133462-5133484 AGGGAATTCCCATGAACATCCGG + Exonic
1144875721 17:18396147-18396169 AGGGCATTCCCATGAACATCCGG + Intergenic
1145037902 17:19553963-19553985 AGGGCCTCCCCATAAATATGTGG + Intronic
1145156505 17:20548274-20548296 AGGGCATTCCCATGAACATCCGG - Intergenic
1146844001 17:36172360-36172382 AGGGAATGCCCATGAACATCCGG - Exonic
1146856305 17:36260295-36260317 AGGGAATGCCCATGAACATCCGG - Exonic
1146864312 17:36328080-36328102 AGGGAATGCCCATGAACATCCGG + Exonic
1146872214 17:36384206-36384228 AGGGAATGCCCATGAACATCCGG - Exonic
1146879576 17:36435291-36435313 AGGGAATGCCCATGAACATCCGG - Exonic
1146883504 17:36456436-36456458 AGGGCATTCCCATGAACATCCGG - Intergenic
1147067171 17:37928668-37928690 AGGGAATGCCCATGAACATCCGG + Exonic
1147075100 17:37984830-37984852 AGGGAATGCCCATGAACATCCGG - Intronic
1147078703 17:38008229-38008251 AGGGAATGCCCATGAACATCCGG + Intronic
1147086625 17:38064376-38064398 AGGGAATGCCCATGAACATCCGG - Exonic
1147094641 17:38132164-38132186 AGGGAATGCCCATGAACATCCGG + Intergenic
1147102568 17:38188339-38188361 AGGGAATGCCCATGAACATCCGG - Intergenic
1149021499 17:51971175-51971197 AGGCACTCCTCATGGAAATATGG - Intronic
1149586296 17:57789822-57789844 AGGAACACCCCAAGAAAGTCAGG + Intergenic
1149847142 17:60014806-60014828 AGGGAATTCCCATGAACATCCGG - Intergenic
1150085501 17:62271423-62271445 AGGGAATTCCCATGAACATCCGG - Intergenic
1150984404 17:70179220-70179242 GGGGACTCACCATGAATATCTGG + Exonic
1155617964 18:27743480-27743502 ATGGACTCACCTGGAAAATCGGG - Intergenic
1159739000 18:72141559-72141581 ATGGACTCACCTAGAAAATCTGG - Intergenic
1167287812 19:48608635-48608657 AGGGTTTCCCCATGTTAATCAGG + Intronic
1167430829 19:49453474-49453496 CGGGACTCCCCGCGAAAAACCGG - Intronic
926597494 2:14807301-14807323 AGAGAAACCCCAGGAAAATCAGG - Intergenic
927890171 2:26743228-26743250 AGGGTCTCCTCATGAACATGAGG - Intergenic
928667544 2:33565475-33565497 AGAAACTTACCATGAAAATCTGG - Intergenic
929002621 2:37363010-37363032 TGGGGCACCCCATGGAAATCGGG + Intronic
930402352 2:50906346-50906368 AGAGTCTTCTCATGAAAATCTGG + Intronic
931205478 2:60141441-60141463 ACGGACTCACCTGGAAAATCGGG + Intergenic
933572881 2:84034568-84034590 GGAGGCTCCCCATGAAAATCTGG + Intergenic
940641115 2:156345408-156345430 AGGCATTACCCATTAAAATCAGG - Intergenic
940983915 2:160034012-160034034 AGAGGCTCCCCAAGAAAATCTGG + Intronic
944257678 2:197640489-197640511 ACGGACTCACCTGGAAAATCGGG - Intronic
946659538 2:221984812-221984834 ACGGACTCACCTGGAAAATCGGG + Intergenic
948887219 2:240890340-240890362 AGGGAGTCTCCACGAAAAGCAGG - Intronic
1172463508 20:35137726-35137748 AGGCACCCACCATGGAAATCAGG - Intronic
1174773348 20:53321882-53321904 AGGGACTCCCCATGAAAATCAGG - Intronic
1174793746 20:53504099-53504121 ACGGACTCACCTGGAAAATCGGG + Intergenic
1178770502 21:35499519-35499541 AGGGACGCACCTGGAAAATCGGG - Intronic
1179745078 21:43439496-43439518 AGGGAGGCCCCAGGAAAAGCCGG - Intergenic
1181585451 22:23850438-23850460 AGGGACTCCCCTCGTAAATGAGG + Intergenic
1203295436 22_KI270736v1_random:39033-39055 AGGGAGTCTCCATGACAATGAGG + Intergenic
949678996 3:6490660-6490682 ACGGACTCACCTGGAAAATCGGG - Intergenic
950031939 3:9859450-9859472 AAAGACTCCCCATGGAAATAGGG - Intergenic
950965448 3:17142800-17142822 AGAGATTGCACATGAAAATCGGG - Intergenic
951917937 3:27821712-27821734 ACGGACTCACCTGGAAAATCGGG - Intergenic
952220369 3:31318179-31318201 TGGGACTCTCCCAGAAAATCAGG - Intergenic
955517264 3:59738523-59738545 AAGCACTCACCATGAAAGTCAGG - Intergenic
956105322 3:65811421-65811443 GGGGGCTCCCCATGGAGATCTGG - Intronic
960318790 3:116209154-116209176 ACGGACTCACCTGGAAAATCGGG - Intronic
962362862 3:134756260-134756282 AGGGACTCCCCATAGAGAGCTGG + Intronic
966204704 3:177394527-177394549 AGGGACGCACCTGGAAAATCGGG - Intergenic
970495987 4:16626785-16626807 AGTGACTCTCAATGAAGATCAGG + Intronic
974208396 4:58737543-58737565 AGGGACTACACAGGAAATTCGGG + Intergenic
975491392 4:74992856-74992878 AGTGACGCCAGATGAAAATCTGG + Intronic
975504951 4:75127056-75127078 ACGGACTCACCTGGAAAATCAGG + Intergenic
979960949 4:127020818-127020840 ATGGACTCACCTGGAAAATCGGG + Intergenic
980573713 4:134658375-134658397 AGGCATTCCCCTTGAAAATTAGG - Intergenic
980870601 4:138607227-138607249 AGAGGTTCCACATGAAAATCTGG + Intergenic
981636637 4:146888451-146888473 AGTGAATCCCCATGTAAAACTGG - Intronic
983341223 4:166463562-166463584 ACAGACTCCCCTGGAAAATCGGG + Intergenic
983680075 4:170343335-170343357 ATTCACTCCACATGAAAATCAGG - Intergenic
989809696 5:45658691-45658713 AGGGACGCACCTGGAAAATCGGG + Intronic
991450979 5:66750533-66750555 ACGGACGCACCTTGAAAATCGGG + Intronic
991673803 5:69073387-69073409 ACAGAATGCCCATGAAAATCAGG - Intergenic
997474881 5:134137056-134137078 AGGGGCTCCCCAGGAAGACCTGG - Intronic
997774176 5:136584548-136584570 AGGAACTCCCCAAGCAACTCAGG + Intergenic
998226377 5:140329879-140329901 AGGGAATTCCCATGAGAAACAGG + Intergenic
999060035 5:148623929-148623951 AGGAACCCTCCAAGAAAATCCGG - Intronic
1006182630 6:32163426-32163448 AGGGACTACCCATGAGAGTGGGG + Exonic
1009928847 6:70152141-70152163 AGTGAGGCCACATGAAAATCAGG + Intronic
1011650139 6:89498392-89498414 AGGCACTACCTATGACAATCTGG + Intronic
1013581385 6:111538223-111538245 AGGGACTCCCTCTGAAAAATCGG - Intergenic
1014185938 6:118434121-118434143 AAGCATTCCCCTTGAAAATCAGG + Intergenic
1015565186 6:134562949-134562971 AGAGACTCCCCATTTAAAACAGG + Intergenic
1017557748 6:155590404-155590426 ATGGACTCCCCAAGGAAATGTGG + Intergenic
1020843219 7:13247870-13247892 AGGGTTTCACCATGATAATCAGG - Intergenic
1021319706 7:19194802-19194824 ACGGACTCACCTGGAAAATCGGG - Intergenic
1022329075 7:29360635-29360657 AAGGTTTTCCCATGAAAATCGGG + Intronic
1022842195 7:34175319-34175341 ACGGACTCACCTGGAAAATCGGG - Intergenic
1022929211 7:35093206-35093228 ATGGACTCACCTGGAAAATCGGG + Intergenic
1025995347 7:66524130-66524152 AGGGACAGCCCCTGCAAATCTGG - Intergenic
1026986981 7:74560949-74560971 AGGGACAGCCCCTGCAAATCTGG - Intronic
1026986992 7:74560989-74561011 AGGGACAGCCCCTGCAAATCTGG - Intronic
1027292411 7:76728734-76728756 ACGGACTCACCTGGAAAATCGGG + Intergenic
1028198318 7:87933069-87933091 AGAGTCTCCCCATGATGATCAGG - Intergenic
1030698217 7:112609285-112609307 TGTTAATCCCCATGAAAATCAGG + Intergenic
1030979541 7:116170404-116170426 AGGGAATACTCTTGAAAATCAGG + Intergenic
1039124867 8:34190114-34190136 AGAGACTCCAAATGAATATCAGG - Intergenic
1041149212 8:54913946-54913968 AAGGTCTACCCAGGAAAATCTGG - Intergenic
1042312545 8:67393258-67393280 AGGGGCACCCCAAGGAAATCTGG - Intergenic
1043713110 8:83447392-83447414 ACGGACTCACCTGGAAAATCGGG + Intergenic
1046458611 8:114504276-114504298 ACGGACTCACCTGGAAAATCGGG + Intergenic
1046468522 8:114637044-114637066 ACGGACTCACCTGGAAAATCGGG - Intergenic
1052538401 9:29776818-29776840 AGGAATTCCCTATCAAAATCAGG - Intergenic
1053560877 9:39192948-39192970 AGTGTCTCCCCATGACAATATGG - Intronic
1054136242 9:61426007-61426029 AGTGTCTCCCCATGACAATATGG + Intergenic
1054605590 9:67174165-67174187 AGTGTCTCCCCATGACAATATGG + Intergenic
1055260160 9:74424522-74424544 ACGGACTCACCTGGAAAATCGGG + Intergenic
1062565881 9:137163802-137163824 AGGCAATCTCGATGAAAATCAGG - Exonic
1190058821 X:47198015-47198037 AGGGACTCCGCATGCAGATGAGG + Intronic
1193884618 X:86969875-86969897 ACGGACTCACCTGGAAAATCAGG + Intergenic
1198424671 X:136504804-136504826 TGGTACTCCCCACCAAAATCAGG - Intronic
1199113540 X:143961973-143961995 AAGCATTCCCCTTGAAAATCGGG - Intergenic
1200948057 Y:8865626-8865648 TGGGACACCCCATGACAGTCGGG + Intergenic