ID: 1174775451

View in Genome Browser
Species Human (GRCh38)
Location 20:53339417-53339439
Sequence GAGCCACTTTGAACCCTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 106}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174775449_1174775451 0 Left 1174775449 20:53339394-53339416 CCAGGGCATTACTGGCTGTTCCT 0: 1
1: 0
2: 0
3: 8
4: 165
Right 1174775451 20:53339417-53339439 GAGCCACTTTGAACCCTGAAAGG 0: 1
1: 0
2: 0
3: 8
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174775451 Original CRISPR GAGCCACTTTGAACCCTGAA AGG Intronic
900595995 1:3480433-3480455 GAGCCACCCTGAACCCGGATAGG - Exonic
901637421 1:10676774-10676796 GAGCCTCTGTGAAGCCTGCATGG + Intronic
903690576 1:25170524-25170546 GAGCCACCATGAAGACTGAACGG - Intergenic
907499047 1:54865195-54865217 AAGCCACTCTTTACCCTGAAGGG + Intronic
909426414 1:75530441-75530463 TGGCCCATTTGAACCCTGAAAGG - Intronic
915100963 1:153499864-153499886 TAGTCACTCTGAACACTGAATGG + Intergenic
915166645 1:153951717-153951739 GAGCCCCTTTCCACCCAGAATGG + Intronic
920053696 1:203178268-203178290 GAGGTACTTTGATCTCTGAATGG + Intergenic
920674388 1:208029231-208029253 GAGGCACTTTGTACCCTAATGGG + Intronic
922192153 1:223328819-223328841 GAGCCAAATTTAACCCTGAGTGG - Intronic
922283529 1:224147928-224147950 CAGCCACTTAAAACTCTGAATGG + Intronic
1065018889 10:21486249-21486271 GATCCACTTTGTACCCAGAGTGG - Intergenic
1065747255 10:28853800-28853822 CAGCCATTTTGAACAATGAAGGG + Intronic
1068558639 10:58486677-58486699 AAGACACTTAGAACCATGAATGG + Intergenic
1072722617 10:97790053-97790075 GAGCCACTGTGCACCTTGGAGGG + Intergenic
1077341682 11:2029049-2029071 GAGCCACCTGGAACACTCAAAGG + Intergenic
1077845166 11:6015351-6015373 GAGCCACTTTGAACCAGGGATGG - Intergenic
1080306715 11:30844566-30844588 GAGCCACTTTGAGCCCTGGCTGG + Intronic
1082274759 11:50209249-50209271 GAGGCACTTTGAAGCATGAGTGG - Intergenic
1087591358 11:100192726-100192748 GAGCAACTTTGAACCAATAAAGG - Intronic
1087706548 11:101498897-101498919 CAGCTACTATAAACCCTGAAGGG + Intronic
1091201643 11:133785113-133785135 GAGCCACTGGGGACCCTGAGTGG - Intergenic
1091301277 11:134509715-134509737 GAGCCACCTGGCACCCTGCAAGG - Intergenic
1202824668 11_KI270721v1_random:84238-84260 GAGCCACCTGGAACACTCAAAGG + Intergenic
1094854916 12:34398654-34398676 GAGGCACTTTCACCCGTGAAGGG - Intergenic
1097958824 12:65512949-65512971 GTGCCTCTTTCAACTCTGAAAGG - Intergenic
1098769208 12:74532105-74532127 GAGCCACTTTGATCTATAAAAGG - Intergenic
1099943050 12:89212918-89212940 AAGCCACTTTGTAAACTGAAAGG - Intergenic
1102308514 12:111825409-111825431 GTGCCACTTTGATGCGTGAATGG + Intergenic
1106972707 13:35162448-35162470 CAGCCACCTTGAATCCTAAAAGG - Intronic
1107230064 13:38097919-38097941 GTTCCACTTTTAACCCTCAAAGG + Intergenic
1112585455 13:100715399-100715421 CAGCCTCTTTGATCCCTGAGAGG + Intergenic
1113033336 13:106018730-106018752 GGGCCAGCTTGAACACTGAAAGG - Intergenic
1113519403 13:110928891-110928913 GAGACACTTTGCACAGTGAAGGG - Intergenic
1115862786 14:37707922-37707944 GAGTCACTCAGAATCCTGAAAGG + Intronic
1119320654 14:73728329-73728351 GAACCGCCTTGAACCCTGAGGGG - Intronic
1121077782 14:91083797-91083819 CAGCCAAGCTGAACCCTGAATGG - Intronic
1124407198 15:29403817-29403839 GAGCCCAGTTGTACCCTGAAGGG + Intronic
1125828111 15:42692845-42692867 GAGCCAATGTGATCCTTGAAGGG + Exonic
1129582818 15:76830935-76830957 GAGCCACTTTGGGCCAGGAATGG - Intronic
1129592944 15:76933207-76933229 GACCCACTTGGAACGCTGACAGG - Intronic
1130213530 15:81947891-81947913 GAGGCATTTTGGACCTTGAAGGG + Intergenic
1136775055 16:32867469-32867491 CAGCCACTCTTATCCCTGAAAGG - Intergenic
1136895563 16:33994043-33994065 CAGCCACTCTTATCCCTGAAAGG + Intergenic
1137538693 16:49347261-49347283 TGGCCACTTTGACCCATGAAGGG - Intergenic
1138134806 16:54512324-54512346 GAGCCACTTTAAGCCAGGAAAGG + Intergenic
1138329203 16:56199733-56199755 GAGAAACTTAGAAGCCTGAAAGG + Intronic
1138971321 16:62147004-62147026 AAGCAACTTTGAACCTTAAAAGG - Intergenic
1141533637 16:84663779-84663801 GAACCACAGTAAACCCTGAAGGG - Intronic
1203077473 16_KI270728v1_random:1129578-1129600 CAGCCACTCTTATCCCTGAAAGG - Intergenic
1145964664 17:28908207-28908229 GAGGCACTTTAAACACTGCAGGG - Intronic
1150495431 17:65604450-65604472 GTGCCACCTTGAATCCTGAAGGG - Intronic
1162164567 19:8743514-8743536 GAGGCACCTTGAACCCTCAAGGG - Intergenic
1162165639 19:8750982-8751004 GTGGCACCTTGAACCCTCAAGGG - Intergenic
1162166704 19:8758438-8758460 GTGGCACCTTGAACCCTCAAGGG - Intergenic
1162167770 19:8765894-8765916 GTGGCACCTTGAACCCTCAAGGG - Intergenic
1162168709 19:8772192-8772214 GTGGCACCTTGAACCCTCAAGGG - Intergenic
1162170455 19:8784956-8784978 GTGGCACCTTGAACCCTCAAGGG - Intergenic
925293846 2:2765345-2765367 GAGGCACTTCGGACCCTGCAAGG + Intergenic
926810977 2:16755219-16755241 GAGCTAGTTTGAACCCTGTGAGG - Intergenic
927939415 2:27094384-27094406 GGGCCACTAGGGACCCTGAAAGG - Intronic
928494765 2:31820414-31820436 GAGCCCCTTTGAGCCATGGATGG + Intergenic
929454652 2:42057300-42057322 CAGCCAGGTTGAACACTGAAAGG - Exonic
931228089 2:60351372-60351394 GGGCCACTTTGCACCCAGGAAGG + Intergenic
932505204 2:72222798-72222820 AAGCTACTTTGAACCCTAACTGG + Intronic
933782751 2:85813414-85813436 GAGCCCCTCTGATCCCAGAATGG - Intergenic
933940936 2:87244653-87244675 GACCCACTCTGATCCTTGAATGG + Intergenic
936352203 2:111721360-111721382 GACCCACTCTGATCCTTGAATGG - Intergenic
1169641907 20:7761636-7761658 GAGCCACTTTTAACAATCAATGG + Intergenic
1170381374 20:15763200-15763222 GAGACATCTTGACCCCTGAAGGG + Intronic
1171159568 20:22909013-22909035 GAGCCAAGATGAAACCTGAAAGG + Intergenic
1172876329 20:38166499-38166521 GATCCACTGTGAGCCCTGAGCGG + Intronic
1174775451 20:53339417-53339439 GAGCCACTTTGAACCCTGAAAGG + Intronic
1176956915 21:15116137-15116159 GAGCCACTTTGTGCCTTGATGGG - Intergenic
1184124420 22:42476956-42476978 GTGCCACTTTCACTCCTGAATGG - Intergenic
952210370 3:31223871-31223893 GAGACACTTGCAACCCTGCAGGG - Intergenic
955233564 3:57120655-57120677 GATCCACTTTGAGCACTGATTGG + Intronic
958899727 3:99871637-99871659 GAGTCACTTTGAATTTTGAAAGG + Intronic
961343621 3:126246843-126246865 GAGCCACTTCAAACCGTGAAAGG + Intergenic
962183248 3:133230860-133230882 GAGCAACTCTGAATGCTGAAGGG + Intronic
965924379 3:173959023-173959045 CAGGCACTTTGGACCCTGCAAGG + Intronic
967486794 3:190041580-190041602 TAGCTACTTTGCAACCTGAAAGG + Intronic
972068005 4:34976303-34976325 GAGTCACTTTAAGCCCTGAAAGG - Intergenic
980182092 4:129414001-129414023 GGGCCATTTTGGACCCTGACAGG - Intergenic
986431271 5:7683478-7683500 CTGCCACTTTGCACCATGAATGG + Intronic
987122617 5:14781313-14781335 CAGTCACTTTGACTCCTGAAGGG - Intronic
987639872 5:20599153-20599175 GAGCCACTGCTGACCCTGAATGG - Intergenic
988759377 5:34297030-34297052 GGGCCCCTTTGAACCCTGGCTGG - Intergenic
996026045 5:118647189-118647211 GAGCCAGTTTGGACCATGATGGG + Intergenic
997233175 5:132258091-132258113 GAGCCACTGTGGACCCGGGAAGG + Intronic
999252937 5:150193283-150193305 CACCCACTTTGAAGCATGAAAGG + Intronic
1000958835 5:167574723-167574745 GAGCCGCTTAGAATCCAGAAAGG - Intronic
1003117258 6:3291238-3291260 GGGCCACTCTGAACCCTGGATGG + Intronic
1004460805 6:15834165-15834187 TAGCCATTTTGAAACCTGGAGGG - Intergenic
1005084626 6:21992396-21992418 CAGCCACTGTGTACCCCGAATGG - Intergenic
1005839641 6:29734084-29734106 GAGCAACTGAGAACCCTGGAAGG + Intronic
1021413278 7:20352841-20352863 GAGACACTTTTTAACCTGAAAGG - Intronic
1022289970 7:28991279-28991301 GACCCACTTTGATTCCTGATGGG + Intergenic
1023035761 7:36130231-36130253 GAGCCACTGGGACCCCTGACAGG + Intergenic
1024754998 7:52518929-52518951 GAGCCTCTTTGAGCCATGACTGG + Intergenic
1027247700 7:76378517-76378539 AAGCTAGTTTGAACCCTGATGGG - Intergenic
1030652437 7:112130039-112130061 GAGCCACTTTTAACTCTGCCTGG + Intronic
1033034511 7:137861314-137861336 GAGCCATTTTGAGACATGAAGGG + Intergenic
1035843078 8:2833397-2833419 GAGCCAGTGTTGACCCTGAAGGG + Intergenic
1037686558 8:21144576-21144598 GAGCCATTATGAAACCTGAGTGG + Intergenic
1039771479 8:40692253-40692275 GGGCCACTTCAAACTCTGAAGGG + Intronic
1044816120 8:96115195-96115217 TAGCCACTATGGACTCTGAATGG + Intergenic
1046826200 8:118694778-118694800 GAGCCCCTTTGAGCCATGGATGG + Intergenic
1051869060 9:21715496-21715518 GAGCCCCTTTGAACCATGACTGG + Intergenic
1052215604 9:25962945-25962967 GAGCCATTTTAAACTGTGAAAGG + Intergenic
1058010187 9:99968511-99968533 CTGCCACTTTGAAGCCTGCAAGG - Exonic
1061235985 9:129342865-129342887 GAGCCACAGTGAACCCTGCTCGG - Intergenic
1187034647 X:15525497-15525519 TTGCCTCTCTGAACCCTGAATGG + Intronic
1199129879 X:144171893-144171915 GAGCCACCATGCACCCTGCATGG + Intergenic
1201267431 Y:12221473-12221495 GAGCCAGTTTTTACCCAGAAAGG - Intergenic