ID: 1174782152

View in Genome Browser
Species Human (GRCh38)
Location 20:53399716-53399738
Sequence GCAGCCAGGTCAGCAGCGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 4, 3: 15, 4: 189}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174782152_1174782154 -5 Left 1174782152 20:53399716-53399738 CCAGTCGCTGCTGACCTGGCTGC 0: 1
1: 0
2: 4
3: 15
4: 189
Right 1174782154 20:53399734-53399756 GCTGCTGACCAACTCTGAAGAGG 0: 1
1: 0
2: 2
3: 14
4: 120
1174782152_1174782155 -4 Left 1174782152 20:53399716-53399738 CCAGTCGCTGCTGACCTGGCTGC 0: 1
1: 0
2: 4
3: 15
4: 189
Right 1174782155 20:53399735-53399757 CTGCTGACCAACTCTGAAGAGGG 0: 1
1: 0
2: 1
3: 27
4: 166
1174782152_1174782159 22 Left 1174782152 20:53399716-53399738 CCAGTCGCTGCTGACCTGGCTGC 0: 1
1: 0
2: 4
3: 15
4: 189
Right 1174782159 20:53399761-53399783 GGTGTTTGCTCAACGTGGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 89
1174782152_1174782156 1 Left 1174782152 20:53399716-53399738 CCAGTCGCTGCTGACCTGGCTGC 0: 1
1: 0
2: 4
3: 15
4: 189
Right 1174782156 20:53399740-53399762 GACCAACTCTGAAGAGGGCTCGG 0: 1
1: 0
2: 0
3: 8
4: 134
1174782152_1174782158 17 Left 1174782152 20:53399716-53399738 CCAGTCGCTGCTGACCTGGCTGC 0: 1
1: 0
2: 4
3: 15
4: 189
Right 1174782158 20:53399756-53399778 GGCTCGGTGTTTGCTCAACGTGG 0: 1
1: 0
2: 0
3: 2
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174782152 Original CRISPR GCAGCCAGGTCAGCAGCGAC TGG (reversed) Intronic
900198631 1:1391396-1391418 GCAGCTCGGTCAGCAGAGAAGGG - Intronic
900322937 1:2093952-2093974 GGAGCCAGGCCAGCAGCTCCAGG + Intronic
901465283 1:9417340-9417362 GCAGCAGGGTCTGCAGCCACAGG - Intergenic
901525956 1:9823673-9823695 GCAGCCCGGCCAGCAGCAGCCGG + Exonic
901932900 1:12608336-12608358 GCATCCAGTTCAGAAGCCACAGG + Intronic
904490852 1:30858208-30858230 CCAGCCAGGACAGCAGAGGCGGG - Intergenic
905184788 1:36188418-36188440 GCAGCCAGGACATCAGCCATAGG - Intergenic
905397931 1:37679358-37679380 GCAGCCAGCTAAGCAGTGCCCGG - Intergenic
906196504 1:43933652-43933674 GCAGCCAGGTGAGCCCCGAAAGG + Exonic
906293474 1:44634911-44634933 GCAGCCAGGTCAGAAGGCTCAGG - Intronic
907438590 1:54464740-54464762 GAAGCTAGGTCAGCAGGGGCTGG + Intergenic
908401240 1:63774456-63774478 GCAGCGCGGCCAGCAGCGCCAGG - Exonic
910803168 1:91165186-91165208 GCAGCCAGGTCAGCCCCAGCTGG + Intergenic
914716597 1:150259450-150259472 GCAGCCAGGCTGGCAGGGACAGG - Intronic
917286050 1:173422606-173422628 TCAGCCTGGTCAGCAGTTACTGG - Intergenic
920564265 1:206960998-206961020 GCAACCAGGCCAGCAGCTCCAGG - Exonic
922472997 1:225888109-225888131 GCAGCCAGGCCAGGAGACACCGG + Intronic
922480999 1:225940079-225940101 GCAGCCAGGCCAGGAGACACCGG + Intronic
924074579 1:240320064-240320086 GCATCCAGGTTAGCAGCAACTGG + Intronic
924207974 1:241733853-241733875 GGAGCCAGGTCAGCACTGAGGGG - Intronic
924338480 1:243006211-243006233 GCAGCCAAGCCAGCAGCTCCTGG - Intergenic
924780395 1:247141903-247141925 GCTCCCAGGTCAGCAGAGAATGG - Intronic
1067473783 10:46553516-46553538 ACAGCCAGGCCAGCAGCCTCTGG + Intronic
1076136311 10:128047412-128047434 GCAGCCAGGCCAGCAGCGGCTGG - Exonic
1076371523 10:129959071-129959093 CCAGCCAGGCCTGCAGCGCCCGG - Intronic
1077141405 11:1026485-1026507 GGAGGCAGGTCAGCAGCTCCTGG + Intronic
1077370172 11:2178041-2178063 GGAGCCAGGTGAGCAGTGAGGGG + Intergenic
1077370236 11:2178287-2178309 GGAGCCAGGTGAGCAGTGAGGGG - Intergenic
1082996719 11:59261289-59261311 CCAGCCAGGTGAGCAGAGGCTGG - Intergenic
1082997138 11:59263385-59263407 CCAGCCAGGTGAGCAGGGGCTGG - Intergenic
1083303168 11:61749303-61749325 TTAGCCAGGTCAGCTGCTACAGG + Intergenic
1083622380 11:64055594-64055616 GCAGCCAGCCCAGCAGAGGCAGG + Intronic
1083718452 11:64592235-64592257 GCTGACAGGTCAGCAGGGCCAGG - Intronic
1083734314 11:64670923-64670945 GAAGCCAGGGCACCAGCCACTGG + Intronic
1083996720 11:66276628-66276650 GCAGCCAGGGCAGTAGAGGCCGG - Exonic
1084010823 11:66347437-66347459 GCAGTCCGGACAGCAGCGACAGG + Exonic
1085018615 11:73191251-73191273 GCAGACAGGTCATCAGCTTCTGG + Intergenic
1085328093 11:75623998-75624020 GCAGCCAGGCCAGCAGCGGGTGG + Intronic
1086066903 11:82755158-82755180 CCAGCCAGCTCAGCAGCTAGGGG - Intergenic
1087007632 11:93484888-93484910 GCAGCCAATGCAGCAGCCACCGG + Intronic
1088593535 11:111423049-111423071 GCAGCCAGGTCAGGAGTCACTGG - Intronic
1092062551 12:5563354-5563376 GCAGCCAGCTCAGCACCTTCAGG - Exonic
1103731913 12:123033369-123033391 GCAGCCAGGACTGCAGCAAGTGG + Intronic
1104539626 12:129651691-129651713 GAAGCAAGGACAGCAGCAACTGG + Intronic
1105851658 13:24340640-24340662 GCAGCGAGGACAACAGCGAGGGG + Intergenic
1106847090 13:33748243-33748265 GCAGGCAGGTGAGCAGGTACAGG + Intergenic
1107126430 13:36851367-36851389 GGTGACAGGTCAGCAGAGACTGG - Intronic
1107378529 13:39831083-39831105 GCAACCAGGAAAGCAGCGATTGG - Intergenic
1108176393 13:47797054-47797076 CCAGCCAGAGCAGCAGTGACTGG - Intergenic
1113841890 13:113365222-113365244 GGAGCCTGGTCAGCAGCGTGTGG + Intergenic
1114268577 14:21087763-21087785 GCAACCAGGGAAGAAGCGACAGG - Intronic
1114733365 14:25018218-25018240 GCAGGCAAGTCAGAAGCCACGGG - Intronic
1115961052 14:38836478-38836500 GGTGCCAGCTCAGCAGCGACAGG + Intergenic
1121528896 14:94638881-94638903 GCAGTCAGGGCAACAGGGACTGG - Intergenic
1122091124 14:99341270-99341292 GCAGAGAGGTCAGCAGGGATGGG + Intergenic
1122193501 14:100067200-100067222 GCTGCAAGGTCAGCAGCCATAGG + Intronic
1122413219 14:101536456-101536478 TCAGCCAGGCCAGCAGGGAAAGG + Intergenic
1122768057 14:104085259-104085281 GCAGCCAGAAAGGCAGCGACAGG - Intergenic
1122829989 14:104391176-104391198 CCACCCATGGCAGCAGCGACTGG - Intergenic
1124240221 15:28022151-28022173 ACAGCCAGGACAGCAGGGACTGG + Intronic
1127064378 15:55221862-55221884 CCAGCCAGGTCAGAGGCAACAGG + Intronic
1129393434 15:75231952-75231974 GCAGACAGGATAGCAGCGAGAGG - Intergenic
1129743065 15:77999555-77999577 GCAGCCTGGTCTGCAGAGCCAGG - Intronic
1129842415 15:78751885-78751907 GCAGCCCGGTCTGCAGAGCCAGG + Intergenic
1129903616 15:79170607-79170629 GCAGCCAGGGCTGCAGGGAGTGG - Intergenic
1130081379 15:80736970-80736992 GCAGCCATCTCAGCAGCAAGAGG - Intronic
1131403326 15:92143956-92143978 GCAGCCAGGTCACCAGAGGTGGG + Intronic
1132027873 15:98418172-98418194 GCAGCCCGGCCAGTACCGACAGG + Intergenic
1132038100 15:98503115-98503137 GCAGCCAGGAGAGGAGAGACGGG + Intronic
1132548505 16:544488-544510 GCAGCCGGGACAGCAGCACCCGG - Intronic
1135480016 16:22814449-22814471 GCACCCTGGTCAGCAGCCCCCGG + Exonic
1135716753 16:24777129-24777151 GCAGCCACAGCAGCAGCCACAGG + Exonic
1139588398 16:67919071-67919093 GCAGCCATGTGAGCAGGGATAGG + Intronic
1141143559 16:81513617-81513639 GCAGCCAGGCCAGAACGGACCGG - Intronic
1141785083 16:86194067-86194089 GCAGCCTGGTCTTCAGCGATGGG + Intergenic
1145303599 17:21657077-21657099 GCCGCCACGTCACCAGCGCCAGG + Intergenic
1145346443 17:22044772-22044794 GCCGCCACGTCACCAGCGCCAGG - Intergenic
1151182367 17:72338532-72338554 CCAGCCAGGGCAGCACAGACAGG + Intergenic
1151416921 17:73972608-73972630 GCAGCCAGACCAGGAGCCACCGG - Intergenic
1152403961 17:80086080-80086102 GCAGCCAGGTCACCTGGGCCTGG - Exonic
1155595566 18:27482021-27482043 TCAGTGAGGTCAGCAGGGACTGG + Intergenic
1156381335 18:36564135-36564157 GCAGCAGGGTCAGCAGTGGCTGG - Intronic
1157592329 18:48843234-48843256 GCAGCCCAGTCAGCAGTGCCTGG - Intronic
1158293748 18:55971220-55971242 GCAGCAAGGACAGCAGCAGCAGG - Intergenic
1160152629 18:76406656-76406678 GCAGACAGGCCAGCAGAGCCAGG - Intronic
1160494950 18:79367867-79367889 GCAGCCAGGTCATTAAGGACGGG + Intronic
1160859706 19:1232504-1232526 TCAGCCAGCTCAGCAGGGCCAGG - Intronic
1160931696 19:1573584-1573606 GCAGGCAGGACAGCAGAGACAGG + Intronic
1162043290 19:7983322-7983344 GCAGCCAGGTCAGGACTGCCAGG + Intronic
1163122799 19:15228029-15228051 GCAGCCAGGGCAGCTGGAACAGG + Exonic
1163400882 19:17091769-17091791 GCAGCCAGGGCTGCAGGGAAGGG - Intronic
1163821342 19:19498261-19498283 GAAGCCAGGGCAGCAGGGAGAGG - Intronic
1165148271 19:33745919-33745941 GGAGCCAGGACAGCAGGGGCTGG - Intronic
1165355291 19:35300235-35300257 GCATCCAGGTCAGCAGCGGCGGG - Exonic
1166231059 19:41426082-41426104 CCAGCCAGGCCAGCAGCAGCAGG + Exonic
1167009289 19:46796273-46796295 GCAGCCCGGTCACCAGCTGCTGG - Intergenic
1167193694 19:48010770-48010792 ACAGGCAGGTCAGCAGGGTCTGG + Intronic
1167251091 19:48398788-48398810 GCAGCGAGGTCTGCGCCGACAGG - Exonic
1168712631 19:58510774-58510796 GCACGCAGGTCAGCAGGCACTGG + Exonic
925166605 2:1719487-1719509 GCAGGCAGGTCGGCGGGGACCGG - Intronic
925185272 2:1842628-1842650 GCAGGCAGGTCAGGAGCCAGAGG - Intronic
926973676 2:18491857-18491879 TCACCCAGGTCAGCAGCTGCAGG - Intergenic
927854279 2:26518088-26518110 GAAGCCAGGACTGCAGCCACAGG - Intronic
936516823 2:113186194-113186216 ACAGCCAGGCCTGCAGAGACTGG + Exonic
937660656 2:124426807-124426829 GCAGCCAGGTCAGCAATTATGGG + Intronic
942122497 2:172792204-172792226 GCAGCAAGGACAGCAGCAGCTGG - Intronic
945302566 2:208227908-208227930 GCACCCAGGCCAGCAGCTGCTGG - Intergenic
946598701 2:221335327-221335349 TCAGCAGGGTCAGCAGCAACGGG + Intergenic
947526226 2:230878286-230878308 ACACCCAGGTCAGCAGAGATGGG - Exonic
947759797 2:232595639-232595661 GTGGCCAGGTCAGCAGCGACAGG + Intergenic
948739248 2:240032184-240032206 GCAGCCATGCCCGCAGCGATGGG - Intergenic
948770631 2:240249777-240249799 TCAGCCAGGTCAGCTGAGCCAGG - Intergenic
948860195 2:240749224-240749246 GCAGCCAGGATAGCAGAGCCGGG + Intronic
1169907023 20:10614595-10614617 GCAGCCAGCTCTCCAGCAACTGG - Intronic
1170969559 20:21104551-21104573 GCAACCAGGTCTGCAGCCGCTGG + Intergenic
1171439543 20:25149035-25149057 GCAGCCAGGTCGGCTGCGAAAGG + Intergenic
1171971670 20:31568870-31568892 GCAGCAAGGGCAGCAGCCAATGG - Intronic
1172125457 20:32622797-32622819 AGAGCCAGGACTGCAGCGACGGG - Intergenic
1173426817 20:42950447-42950469 GCAGCTAGGTGAGAAGGGACAGG - Intronic
1173740261 20:45395196-45395218 GCAGCCACGTGAGCAGCTCCAGG - Intronic
1174782152 20:53399716-53399738 GCAGCCAGGTCAGCAGCGACTGG - Intronic
1175795739 20:61769603-61769625 GCAGCCCGTTCAGCAGAGGCAGG - Intronic
1176056194 20:63150549-63150571 CCACCCAGGTCAGCAGGGGCTGG + Intergenic
1176133614 20:63508531-63508553 GAAGCCAGGTCGGCAGCTTCTGG - Intergenic
1176654971 21:9579880-9579902 GCCGCCACGTCACCAGCGCCAGG + Intergenic
1177125061 21:17184214-17184236 GCAGCTAAGTCAGCAGAGAGAGG + Intergenic
1179728880 21:43356236-43356258 ACAGCCAGGCCAGCAGTTACAGG - Intergenic
1182900425 22:33894021-33894043 GCATCCAGGTCTGCAGGGCCGGG - Intronic
1184673862 22:46029703-46029725 CCAGCCAGCTAAGCAGGGACGGG - Intergenic
1185031322 22:48444696-48444718 ACAGCCAGGCCAGGAGCCACTGG + Intergenic
950497152 3:13340642-13340664 GCAGCAATGTCAGCAGCGCCTGG + Intronic
952018154 3:28984465-28984487 GTGGCCAGGGCAGCAGAGACAGG - Intergenic
952773846 3:37025901-37025923 GCAGCCACTTCAGCAGGGGCTGG - Exonic
952796409 3:37243144-37243166 GCAGCGAGTTCGGAAGCGACCGG + Intergenic
953129477 3:40124503-40124525 ACAGCCAGTTCAGCAGTGACTGG + Intronic
953727715 3:45415079-45415101 GCTGCCAGCTCAGCTGTGACTGG + Intronic
954660741 3:52225566-52225588 GCAGACTGGACAGCAGCTACAGG + Exonic
956902373 3:73730150-73730172 CCAGCCAGAGCAGCCGCGACAGG - Intergenic
957625501 3:82648696-82648718 GCAGCTAAGTCAGCAGCAAGAGG + Intergenic
959834551 3:110903145-110903167 GCAGAGAGGTCTGCAGAGACTGG + Intergenic
962976385 3:140449728-140449750 GCAGCCAGACCAGCTGAGACTGG - Intronic
964883150 3:161446525-161446547 TCTGCTAGGTCAGCAGCAACTGG - Intergenic
965118502 3:164521386-164521408 GCAGCCAGGTGGGCAGCTCCAGG + Intergenic
965897045 3:173591394-173591416 TAAGCCAGGTCAGGAGTGACAGG + Intronic
968504995 4:967470-967492 GGAGCCAGGTCAGGTGCGCCAGG + Intronic
968565578 4:1310889-1310911 ACAGCCAGGGCAACAGAGACAGG - Intronic
968684985 4:1952072-1952094 GCAGGCGGGTAAGCAGCGCCCGG - Intronic
969197502 4:5574670-5574692 GCAGCCAGGTGAGAAGGTACTGG - Exonic
969343223 4:6555563-6555585 GCAGCCAGGCCTGCAGCCGCAGG + Intronic
971267442 4:25107857-25107879 GCAGCCAGGACAGCAGAGGCGGG - Intergenic
971761284 4:30769262-30769284 GCAGCCAAGTCAGCAGGAGCTGG - Intronic
973275190 4:48299668-48299690 GCAAACAGGTCAGCAGCGGATGG + Intergenic
973292530 4:48484008-48484030 GCAGGAAGGCCAGCAGCGGCAGG - Exonic
975128767 4:70811536-70811558 GCAGACATGCCAGCAGCAACGGG + Intergenic
981823617 4:148914520-148914542 GCAGCCAGGACTGCAGCAACAGG + Intergenic
992143309 5:73820649-73820671 GCATCTAGGTCAGCAGCCAGGGG - Intronic
994089018 5:95792102-95792124 GCAGGCAGGGCAGCAGCAACAGG + Intronic
997266170 5:132496503-132496525 GCAGCCGGGTCAGCAGCTACAGG + Intergenic
999737434 5:154523216-154523238 GCAACCAGCTCAGCAGAGCCAGG + Intergenic
1002612791 5:180432339-180432361 GCAGGCAGGCCAGCAGCGTTGGG - Intergenic
1002928606 6:1619133-1619155 ACACCCAGGACAGCAGCGGCTGG + Intergenic
1003330558 6:5125091-5125113 GCAGCCACGTCAGCAAGGCCAGG - Intronic
1003757329 6:9136471-9136493 CCAGCCAGGCCTGCAGTGACAGG + Intergenic
1006263545 6:32896299-32896321 GTAGCCAGGTGATCAGTGACCGG - Intergenic
1006412203 6:33880520-33880542 CCAGACGGGTCTGCAGCGACAGG - Intergenic
1011648171 6:89480372-89480394 GGAGCCAGGTCAGGAATGACAGG + Intronic
1016395643 6:143620946-143620968 GCAACCAGGTGATCAGGGACTGG + Intronic
1018349564 6:162942964-162942986 GCAGCCAGCTCAGCTGGGATTGG + Intronic
1018700487 6:166422390-166422412 GCAGCCAGGTCTGAGGCGCCTGG - Intronic
1019004551 6:168785274-168785296 GCAGACAGGGCAGCACCGTCTGG - Intergenic
1019164871 6:170091431-170091453 GCCACCAGGTCAGCAGCCCCGGG - Intergenic
1020008157 7:4793066-4793088 GCAGCCTGTGCAGCAGCGCCCGG + Intronic
1020117900 7:5486755-5486777 GCAGCGCGGTCACCAGCAACAGG + Intronic
1026290114 7:68998493-68998515 GGAGAGAGGTCAGCAGAGACAGG + Intergenic
1028752100 7:94393825-94393847 GCAGCAAGGTCAAGAGGGACCGG + Intergenic
1029270172 7:99372895-99372917 GAAGCCAGGGAAGCAGCAACAGG + Intronic
1032895833 7:136249886-136249908 GCAGCCATGTTAGCAGAGAGAGG + Intergenic
1034367298 7:150562200-150562222 ACAGCCACGACAGCAGCCACAGG - Intergenic
1034402231 7:150870165-150870187 ACAGCCAGGCCAGCAGCTACAGG - Intergenic
1036104462 8:5825045-5825067 GCAGTCCGGACAGCAGAGACAGG - Intergenic
1037817309 8:22119001-22119023 GCAGCCAGGTCAGCACTGTGTGG - Exonic
1037826980 8:22165423-22165445 GCAGCCCGAGCAGCAGCGGCAGG - Exonic
1039898041 8:41730199-41730221 GAAGCGGGGTCAGCAGCGGCTGG - Intronic
1042238768 8:66641117-66641139 GCACACAGGTCAGCAGATACAGG - Intronic
1043414394 8:80033046-80033068 GCAGCAGGGTGAGCAGCTACAGG + Intronic
1043991208 8:86757344-86757366 TCAGGCAGGTCAGCTGGGACTGG + Intergenic
1047965029 8:130040135-130040157 GCAGCCAGGAAAGCAACGAGAGG + Intergenic
1049001422 8:139827681-139827703 CCAGCCAGGACAGCAGCAAGAGG + Intronic
1049431374 8:142566849-142566871 GCTGCCAGGGCAGCAGCGCCAGG - Intergenic
1049510911 8:143026260-143026282 GCAGCCAGGTCAGGAAGGAAGGG - Intergenic
1049932485 9:470329-470351 CCAGCCTGCTCAGCAGCGAGTGG + Intronic
1050873624 9:10608449-10608471 GAAGTCAGGTCAGCAGTGCCTGG - Intronic
1052970238 9:34372884-34372906 GCAGCCAGGCCGGCGGCGGCGGG + Exonic
1053379377 9:37636269-37636291 GCAGCCAGGGCAGTAGAGGCCGG + Intronic
1053556849 9:39146231-39146253 GCAGCCTGGTCAGCACAGCCAGG + Intronic
1053820960 9:41966509-41966531 GCAGCCTGGTCAGCACAGCCAGG + Intronic
1059929710 9:119248941-119248963 GGAGGTAGGTCAGCAGCCACTGG - Exonic
1060186032 9:121564723-121564745 CCAACCACGTCAGCAGCCACTGG + Intergenic
1061075045 9:128336056-128336078 GCTGGCAGGTCTGCAGAGACTGG - Intergenic
1061754768 9:132804678-132804700 TCACCCAGAGCAGCAGCGACAGG + Intronic
1061899995 9:133668128-133668150 GCAGACAGGTCAGCATCCATGGG - Intronic
1062280839 9:135750970-135750992 GCAGGCAGGTGAGCAGCTTCAGG - Exonic
1062418682 9:136467834-136467856 ACAGCCAGGGCAGGAGTGACCGG + Intronic
1062490707 9:136803626-136803648 TGAGCCAGCTCAGCAGAGACAGG + Intronic
1062546566 9:137066247-137066269 GCGGCCTGGTGAGCAGGGACTGG - Exonic
1203632696 Un_KI270750v1:83333-83355 GCCGCCACGTCACCAGCGCCAGG + Intergenic
1198690673 X:139280759-139280781 GCAGCCAGGACACCAGTGGCTGG + Intergenic
1198872868 X:141194165-141194187 CCAGCCATGACAGCAGCCACCGG + Intergenic
1199712233 X:150477540-150477562 GCAGCCAAGGCAGCAGACACAGG + Intronic