ID: 1174784026

View in Genome Browser
Species Human (GRCh38)
Location 20:53416044-53416066
Sequence CGCAGTCAGCTCTGCAATTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 95}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174784026 Original CRISPR CGCAGTCAGCTCTGCAATTT AGG Intronic
906779927 1:48564247-48564269 CACAGTCAGCTCTGCATCTTAGG - Intronic
908442345 1:64167947-64167969 CCCAGAAAGCTCTGCAACTTTGG + Intronic
922055059 1:222034277-222034299 GGCAGTCTGCAGTGCAATTTGGG - Intergenic
922401855 1:225267672-225267694 GGCAGTCAGTTCTGAAATATAGG - Intronic
1063113715 10:3058025-3058047 GGCAGACAGCTCTGCATTCTTGG - Intergenic
1066214430 10:33272782-33272804 TGCATCCAGCTCTGCAATATAGG + Intronic
1068956652 10:62824525-62824547 CTTAATCAGCTCTGCAACTTGGG - Intronic
1069834585 10:71300722-71300744 GTCAGTCAGCTCTGCAACGTGGG + Exonic
1075162124 10:120033625-120033647 CCCAATCAGCTCTGCGTTTTGGG - Intergenic
1075803448 10:125167779-125167801 TGCAGTCAGCTCTGTTATTAGGG - Intergenic
1079541314 11:21579041-21579063 AGTAGTCAGCTCTCCAAGTTGGG + Intergenic
1085285787 11:75359705-75359727 CGCAGTCATCTCAGCAATTTGGG + Intergenic
1087536865 11:99458982-99459004 CGAAGTCAGCTTTGTAAGTTAGG + Intronic
1089180141 11:116577964-116577986 GGCATTGAGCTCTGCAAGTTAGG + Intergenic
1091173024 11:133535128-133535150 CCCGGGCAGCTCTGCAATGTTGG - Intergenic
1091206111 11:133822342-133822364 CACTGTCTGCTCTGAAATTTTGG - Intergenic
1092423326 12:8352528-8352550 AGCGGTCATCTCTGAAATTTTGG + Intergenic
1098508456 12:71282757-71282779 CCCAGACATCTCTGCAATCTCGG - Exonic
1099152965 12:79138533-79138555 ACCCGTCAGCTCTGCAACTTTGG + Intronic
1101804141 12:108048644-108048666 GGCAGTCAGATCTGCATTTCAGG + Intergenic
1103573973 12:121863277-121863299 CCCAGCCAGCTCTGCATTTCTGG + Intronic
1105573023 13:21622201-21622223 CTCAGTCAACTCTTCATTTTTGG - Intergenic
1109983137 13:69937090-69937112 CAAAGTCAGCTCTGCCTTTTGGG - Intronic
1111556956 13:89893232-89893254 TGCAGGCAGCTCAGCAGTTTAGG - Intergenic
1114040032 14:18669465-18669487 CGTAGTCAGCTCTGCCATGTAGG - Intergenic
1114045068 14:18867990-18868012 TGTAGTCAGCTCTGCCATGTAGG - Intergenic
1114119143 14:19651478-19651500 TGTAGTCAGCTCTGCCATGTAGG + Intergenic
1122641862 14:103164774-103164796 AGCAGTCAGATATGCAATTCAGG + Intergenic
1129513592 15:76142786-76142808 AGCAGACAGCTCTGCCGTTTGGG - Intronic
1129947540 15:79553051-79553073 CACACACAGCTCTGCAACTTTGG + Intergenic
1140832857 16:78767392-78767414 CGCAGTCATCTCAGCGCTTTGGG - Intronic
1142859610 17:2753237-2753259 CGCTGTCATCTCAGCACTTTGGG - Intergenic
1143877697 17:10004521-10004543 CGCAGGAAGCTCTGCCATTCTGG - Intronic
1152919366 17:83058221-83058243 CTCAGTCAGCAGTGCAATGTGGG - Intergenic
1153777861 18:8469529-8469551 CGCTCTCAGCTCTGCATCTTTGG + Intergenic
1156475172 18:37401401-37401423 GGCAGTGAGCTCTGCATTTGTGG + Intronic
1163304750 19:16471282-16471304 CGTAGGCAGCTCTGTTATTTGGG - Intronic
1165159676 19:33808655-33808677 GGCAGTCAGATCTGCAAATTGGG + Intronic
1167788687 19:51657142-51657164 CCCAGTGAGCTCAGCATTTTTGG + Intergenic
1168253401 19:55154189-55154211 CTGAGTCAGATCTGCAATCTGGG + Exonic
926132590 2:10313726-10313748 CTCTGTCAGCTCTGCAATTCAGG + Intronic
929832737 2:45360494-45360516 CAAAGCCAGCTCTGCTATTTAGG - Intergenic
937164144 2:119795667-119795689 CCCAGGCATCTCTGCAATCTTGG - Intronic
938189533 2:129263382-129263404 TGCAGTGAGCTCTGAAATTCTGG - Intergenic
938270516 2:129966127-129966149 CGTAGTCAGCTCCGCCATCTAGG + Intergenic
941006567 2:160253533-160253555 AACACTCAGCTCTGAAATTTGGG + Intronic
944121976 2:196250290-196250312 AGCAGACAGCTCTGCAAATCAGG + Intronic
944495680 2:200305861-200305883 TGCAGGCAGCTCTCCAATTCAGG - Intronic
1171067063 20:22027432-22027454 CACACTCTGCTCTGCAATTTAGG + Intergenic
1174105840 20:48161638-48161660 CGCTGACAGCTCTGCACTGTGGG - Intergenic
1174310606 20:49651022-49651044 CGCGGTGATCTCTGCATTTTGGG + Intronic
1174784026 20:53416044-53416066 CGCAGTCAGCTCTGCAATTTAGG + Intronic
1179046085 21:37846528-37846550 CCCAGTGAGGTCTGCATTTTCGG + Intronic
1180463598 22:15590604-15590626 TGTAGTCAGCTCTGCCATGTAGG - Intergenic
1180732108 22:17989785-17989807 CGTTGTCAGCCCTGCAAGTTAGG - Intronic
1181516792 22:23418776-23418798 CGTTGTCAGCCCTGCAAGTTAGG - Intergenic
1181914195 22:26266182-26266204 AGCAGTCAACTCTGCCATTGAGG - Intronic
953567018 3:44041432-44041454 TGCAGTCACCACTACAATTTTGG - Intergenic
954818563 3:53304223-53304245 AGCACTCAGCTCTCCAATCTGGG - Exonic
956049313 3:65230591-65230613 AGAAATCAGCTCTGCAATTGTGG + Intergenic
956103831 3:65796122-65796144 CTGTGCCAGCTCTGCAATTTTGG - Intronic
956449352 3:69358067-69358089 CATAGTCAACTCTGCAATTGAGG + Intronic
957438488 3:80211190-80211212 CGCTGCCTTCTCTGCAATTTTGG + Intergenic
958142814 3:89585209-89585231 CCCAGTCTGCTCTGCATGTTAGG - Intergenic
959832429 3:110880595-110880617 CACAGTAAGCTCTACATTTTTGG - Intergenic
970275135 4:14391614-14391636 CTCACTCAGCTCTGTAATATAGG + Intergenic
970948334 4:21722214-21722236 CTAAGCCAGCTCTGCATTTTGGG + Intronic
971468641 4:26994166-26994188 AGCAGTCAGATCTGCAAGTCTGG - Intronic
980744916 4:137000934-137000956 CTCAGTCCCCTCTGGAATTTGGG + Intergenic
985561195 5:586943-586965 CACAGTCAGCTCAGCATTTCTGG - Intergenic
986856830 5:11879014-11879036 TGCAGGCAGCTCTGCCATGTGGG - Intronic
988566016 5:32320565-32320587 CCCAGGCATCTCTGCACTTTTGG - Intergenic
988819651 5:34868945-34868967 CGCACTCATTTCTGCAGTTTTGG - Exonic
991525204 5:67548766-67548788 TGCAGTCAGGTCTAGAATTTCGG - Intergenic
999436340 5:151566400-151566422 GGTTGTCAGCTCTGCAATTGTGG + Exonic
1001839914 5:174866526-174866548 CACAGACAGATATGCAATTTGGG - Intergenic
1006973530 6:38073490-38073512 GGCTGTCACCTCTCCAATTTAGG - Intronic
1013597945 6:111677626-111677648 TGCAGTGAGCTCTGTAAGTTAGG + Intronic
1018793524 6:167168813-167168835 CTCAGTCATCTCTACAAGTTGGG - Intronic
1018823191 6:167389565-167389587 CTCAGTCATCTCTACAAGTTGGG + Intergenic
1019895581 7:3979934-3979956 CCAAGTCAGCTCTGTAAATTGGG - Intronic
1020394888 7:7703678-7703700 CGCAGACATCTCAGCACTTTGGG + Intronic
1023103408 7:36741133-36741155 CACTGTCAGCTCTGAAACTTAGG + Intergenic
1025279273 7:57615083-57615105 CCCACTCAGCTGTGCAAGTTTGG - Intergenic
1025305458 7:57850417-57850439 CCCACTCAGCTGTGCAAGTTTGG + Intergenic
1031837127 7:126691410-126691432 CTCAGGCATCTCTGCACTTTTGG - Intronic
1033425821 7:141243386-141243408 CGCGGTCAGCTCTGCTCTATGGG + Intronic
1034137709 7:148786920-148786942 GACAGTCAGCTCTGCACTGTTGG + Intronic
1041736126 8:61112953-61112975 TGCAGACAGTACTGCAATTTGGG + Intronic
1043082644 8:75785011-75785033 CCCAGTCAACTCTGCACTCTCGG - Intergenic
1046197530 8:110884045-110884067 TGCAGGCTGCTCTGCAACTTGGG + Intergenic
1047376153 8:124299151-124299173 AGCTGTCATCTCAGCAATTTGGG + Intergenic
1051478057 9:17530591-17530613 CTCAGTCAGTTCTGAAATTAGGG + Intergenic
1058287619 9:103199111-103199133 GGCAGTCATCACTTCAATTTGGG - Intergenic
1185939584 X:4300800-4300822 TGCAGTCATCTCTCCAATATTGG + Intergenic
1186447529 X:9644337-9644359 GGCAGTCTGCTCTGAAATCTTGG + Intronic
1187663314 X:21574292-21574314 CAAAGTCAGTTCTGCATTTTTGG + Intronic
1189765801 X:44370745-44370767 CGTGGTCAGATTTGCAATTTAGG - Intergenic
1193378174 X:80786563-80786585 TGCAGTCAGTCGTGCAATTTTGG + Intronic
1195126417 X:101813453-101813475 CGCAGGCATCTCTGCACTCTTGG + Intergenic
1199038555 X:143082296-143082318 AGAAATCTGCTCTGCAATTTGGG + Intergenic
1199371635 X:147056627-147056649 TGCAATCTGCTCTGCCATTTGGG - Intergenic