ID: 1174784689

View in Genome Browser
Species Human (GRCh38)
Location 20:53421506-53421528
Sequence CACTGCCAAAATCGAGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 88}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174784687_1174784689 -8 Left 1174784687 20:53421491-53421513 CCAGTTTTTCATCTGCACTGCCA 0: 38
1: 25
2: 19
3: 35
4: 334
Right 1174784689 20:53421506-53421528 CACTGCCAAAATCGAGTGGCTGG 0: 1
1: 0
2: 1
3: 7
4: 88
1174784686_1174784689 -7 Left 1174784686 20:53421490-53421512 CCCAGTTTTTCATCTGCACTGCC 0: 35
1: 27
2: 22
3: 86
4: 640
Right 1174784689 20:53421506-53421528 CACTGCCAAAATCGAGTGGCTGG 0: 1
1: 0
2: 1
3: 7
4: 88
1174784684_1174784689 26 Left 1174784684 20:53421457-53421479 CCTGGCATCTTGCTGGACTCAAC 0: 1
1: 0
2: 1
3: 14
4: 109
Right 1174784689 20:53421506-53421528 CACTGCCAAAATCGAGTGGCTGG 0: 1
1: 0
2: 1
3: 7
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174784689 Original CRISPR CACTGCCAAAATCGAGTGGC TGG Intronic
906341980 1:44988362-44988384 CACTGCCAAGACTGAGTGGCTGG - Intergenic
908429407 1:64041337-64041359 CTCTACCAAATTAGAGTGGCTGG - Intronic
911161853 1:94689184-94689206 TCCTGCCAAAAGCCAGTGGCAGG - Intergenic
911728879 1:101271003-101271025 CACTGCCAAGACTGAGTGGTTGG - Intergenic
913215593 1:116617385-116617407 CACTGCCGAAATGAAGAGGCAGG - Intronic
914297635 1:146344349-146344371 CACTGCCAAGACTGAGTGGTTGG - Intergenic
914527401 1:148482886-148482908 CACTGCCAAGACTGAGTGGTTGG - Exonic
914638993 1:149584242-149584264 CACTGCCAAGACTGAGTGGTTGG + Exonic
921252381 1:213310111-213310133 CACTGCCAAAAGCCAGGTGCAGG - Intergenic
923135842 1:231117960-231117982 CACTGCCAAGACTGAGTGGCTGG - Intergenic
1064416547 10:15154927-15154949 CACTGCCAAGACCGAGTGGTTGG - Intronic
1065241565 10:23710124-23710146 AACTGAGAAAATAGAGTGGCAGG + Intronic
1066041917 10:31557026-31557048 CATTGCCAAAATGCAGTGGCAGG - Intergenic
1066110140 10:32188451-32188473 CACTGCCAAGACTGAGTGGTTGG - Intergenic
1070418052 10:76208569-76208591 CAAGGCCAAAATCAAGTTGCTGG - Intronic
1072219437 10:93315386-93315408 CATTGCTAGAATGGAGTGGCTGG + Intronic
1074578145 10:114690274-114690296 CACTGCCAAGAGTGAGTGGTTGG - Intergenic
1075383143 10:122035042-122035064 CACTGCCATAAGTCAGTGGCAGG + Intronic
1076361662 10:129893986-129894008 CACTCCCCAACTCGTGTGGCTGG + Intronic
1077642272 11:3892521-3892543 CACTGCCAAGACTGAGTGGTTGG - Intronic
1082845028 11:57718168-57718190 CACTGCCAAGAGTGAGTGGTTGG - Intronic
1084174458 11:67416087-67416109 CACTCCCAAAGTCTAGGGGCTGG + Exonic
1085482957 11:76837893-76837915 CACTGCCTAAAGGGAGTGTCTGG - Intergenic
1087147965 11:94830716-94830738 GACTGCCAAAATCCAGCAGCAGG - Intronic
1087632479 11:100666809-100666831 CACTGCCAAGACTGAGTGGTTGG + Intergenic
1090396173 11:126420074-126420096 CACTGGGAACATGGAGTGGCAGG + Intronic
1093837750 12:23857411-23857433 CACTGCTACAATCTAGTGGAAGG - Intronic
1095306645 12:40646201-40646223 CACTCCCAAAATGGAATGCCTGG - Intergenic
1099136893 12:78916807-78916829 CACAGACAAAATTGAGAGGCAGG + Intronic
1105267563 13:18836369-18836391 CACTTCCCAAATGGGGTGGCCGG + Intergenic
1105412118 13:20179105-20179127 TACTGCCAAAACTGAGTGGTGGG - Intergenic
1107959009 13:45542686-45542708 CACTACCAAGCCCGAGTGGCGGG - Intronic
1108686186 13:52820871-52820893 CACTGCCAAGACTGAGTGGTTGG + Intergenic
1111666218 13:91272212-91272234 CACTGCCAAGACTGAGTGGTTGG - Intergenic
1112504307 13:99966468-99966490 CCCTGTAAAAATCGAGTGGTGGG - Intronic
1115986573 14:39108576-39108598 CACTGCCAAGACTGAGTGGTTGG + Intronic
1117649035 14:57882906-57882928 CACTGGCAAAATCAAGTCACAGG - Intronic
1118699768 14:68421828-68421850 CACTGCCAAGACTGAGTGGTTGG - Intronic
1126115468 15:45203601-45203623 CACTGACAAAATGGAATGTCAGG + Intergenic
1126323120 15:47446548-47446570 CACTATCATAATCCAGTGGCAGG + Intronic
1135197015 16:20403049-20403071 AATAGCCAAAATCGAGGGGCTGG + Intronic
1139180117 16:64737131-64737153 CACTGCCAAAACTGTGTGGTTGG + Intergenic
1141324405 16:83042216-83042238 CACTGCAAGAAGTGAGTGGCAGG + Intronic
1149724429 17:58879062-58879084 AACTGCCAAATTCCAGTGTCTGG - Intronic
1152128704 17:78462882-78462904 TGTTGCCAAAATCGAGAGGCTGG - Exonic
1158512760 18:58106189-58106211 CACTGCCCAAATCAACTGTCAGG + Intronic
925682824 2:6440854-6440876 CATTGCCAAAATCAAGTAGCTGG + Intergenic
927474083 2:23398965-23398987 CACTGCCAAGACTGAGTGGTTGG + Intronic
929461551 2:42105652-42105674 CACTGCCAAAGAAGAGTTGCAGG - Intergenic
930139800 2:47939860-47939882 CACTGCCAAGACTGAGTGGTTGG - Intergenic
932025238 2:68125600-68125622 CACTGCCAAGACTGAGTGGTTGG + Intronic
935765188 2:106359591-106359613 CAGTGCCAACACCCAGTGGCAGG - Intergenic
938214311 2:129496638-129496660 CACTGCCAAGAGTGAGTGGTTGG + Intergenic
940575292 2:155495899-155495921 CAGTACAAAAATCAAGTGGCAGG - Intergenic
1170753215 20:19171209-19171231 CATGGCCAAAATCAAGGGGCAGG - Intergenic
1171470640 20:25368403-25368425 CACTGCCAAGACTGAGTGGTTGG - Intronic
1172794958 20:37530383-37530405 CACTGCCAAGACTGAGTGGTTGG + Intergenic
1173459428 20:43231104-43231126 CACTGCCAAGACTGAGTGGTTGG + Intergenic
1174784689 20:53421506-53421528 CACTGCCAAAATCGAGTGGCTGG + Intronic
1175933217 20:62503177-62503199 CGCTGCCAAAATCCTGTAGCCGG + Intergenic
1177271802 21:18858123-18858145 CACTGCCAAGACTGAGTGGTTGG + Intergenic
1180816930 22:18795721-18795743 CACTGCCGAAATGAAGAGGCAGG - Intergenic
1181203119 22:21230066-21230088 CACTGCCGAAATGAAGAGGCAGG - Intergenic
1203223801 22_KI270731v1_random:65358-65380 CACTGCCGAAATGAAGAGGCAGG + Intergenic
1203267029 22_KI270734v1_random:21442-21464 CACTGCCGAAATGAAGAGGCAGG - Intergenic
950711531 3:14816310-14816332 CACTGTCAACATTGGGTGGCAGG - Intergenic
953658603 3:44873709-44873731 CACTGCCAAGACTGAGTGGTTGG + Intergenic
955403341 3:58609188-58609210 CACAGCCAGAAGAGAGTGGCTGG - Intronic
959719579 3:109471457-109471479 CACTGGCAAGACTGAGTGGCTGG - Intergenic
962774311 3:138644316-138644338 CACTGCCAAGACTGAGTGGTTGG - Intergenic
964440620 3:156704975-156704997 CACTGCCAGGATTGACTGGCGGG - Exonic
966253010 3:177887847-177887869 CACTGCCTAGATGGAGAGGCAGG - Intergenic
966302316 3:178493448-178493470 CACTGCCAAGACTGAGTGGTTGG - Intronic
970737023 4:19183653-19183675 CACTGCCAAAATCGATTAATTGG + Intergenic
973073428 4:45894137-45894159 CACTGCAAAAATCTTGTGGCGGG - Intergenic
979734233 4:124062837-124062859 CACTGCCAAGACAGAGTGGTTGG + Intergenic
989564902 5:42892444-42892466 CACTGCCAAGACTGAGTGGTTGG - Intergenic
992966690 5:82009727-82009749 CACTGCCAAGACTGAGTGGTTGG - Intronic
993214317 5:84999941-84999963 CACTGCCAAGACTGAGTGGTTGG - Intergenic
1001330165 5:170756298-170756320 CACTGGCAAAATCAAGTCCCTGG - Intergenic
1001645517 5:173278855-173278877 CACTGCCAAGCTAGAGAGGCTGG + Intergenic
1005043561 6:21620753-21620775 AGCTGCCCAAATCCAGTGGCAGG - Intergenic
1005355245 6:24976828-24976850 CACTGCCAAGACTGAGTGGTTGG + Intronic
1006074213 6:31519611-31519633 CACTGCCAAGACTGAGTGGTTGG - Intergenic
1007654965 6:43446334-43446356 CAGTGCCACAATGCAGTGGCTGG + Exonic
1008515794 6:52318051-52318073 CATGGCCAAAATCGAGGTGCAGG - Intergenic
1009042043 6:58190796-58190818 CACTTCCCAGATGGAGTGGCTGG - Intergenic
1009956619 6:70462849-70462871 CACTGCCAAAATAAAGTAACTGG - Intronic
1011593396 6:88992909-88992931 CACTGCAGAAATAGGGTGGCAGG + Intergenic
1033760823 7:144434954-144434976 CACTGCCAAAACTGAGTGGCTGG - Intergenic
1042110662 8:65377965-65377987 CACTGCCAAGACTGAGTGGTTGG + Intergenic
1049974577 9:849365-849387 CTCTGCCAAGATAGAATGGCAGG - Intronic
1050634630 9:7598225-7598247 CACTGCCAAGACTGAGTGGTTGG + Intergenic
1055464337 9:76549410-76549432 CACTGCCAAGACTGAGTGGTTGG - Intergenic
1057384810 9:94597855-94597877 CACTACAGAAATAGAGTGGCTGG + Intergenic
1187999245 X:24963863-24963885 CGCTGCCAAAACAGACTGGCAGG - Intronic
1195089393 X:101443808-101443830 CACTGCCAAGATTGAGTGGTTGG - Intronic