ID: 1174790049

View in Genome Browser
Species Human (GRCh38)
Location 20:53469691-53469713
Sequence TCTCTTTCTCTATCTTTCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174790049_1174790057 -6 Left 1174790049 20:53469691-53469713 CCCAAGAAAGATAGAGAAAGAGA No data
Right 1174790057 20:53469708-53469730 AAGAGAGAGGGAGGAAGGGAGGG No data
1174790049_1174790061 9 Left 1174790049 20:53469691-53469713 CCCAAGAAAGATAGAGAAAGAGA No data
Right 1174790061 20:53469723-53469745 AGGGAGGGAGGAAGGAAGGAAGG No data
1174790049_1174790062 29 Left 1174790049 20:53469691-53469713 CCCAAGAAAGATAGAGAAAGAGA No data
Right 1174790062 20:53469743-53469765 AGGACCCAAGAAAGATAGAGAGG No data
1174790049_1174790059 1 Left 1174790049 20:53469691-53469713 CCCAAGAAAGATAGAGAAAGAGA No data
Right 1174790059 20:53469715-53469737 AGGGAGGAAGGGAGGGAGGAAGG No data
1174790049_1174790056 -7 Left 1174790049 20:53469691-53469713 CCCAAGAAAGATAGAGAAAGAGA No data
Right 1174790056 20:53469707-53469729 AAAGAGAGAGGGAGGAAGGGAGG No data
1174790049_1174790058 -3 Left 1174790049 20:53469691-53469713 CCCAAGAAAGATAGAGAAAGAGA No data
Right 1174790058 20:53469711-53469733 AGAGAGGGAGGAAGGGAGGGAGG No data
1174790049_1174790060 5 Left 1174790049 20:53469691-53469713 CCCAAGAAAGATAGAGAAAGAGA No data
Right 1174790060 20:53469719-53469741 AGGAAGGGAGGGAGGAAGGAAGG No data
1174790049_1174790063 30 Left 1174790049 20:53469691-53469713 CCCAAGAAAGATAGAGAAAGAGA No data
Right 1174790063 20:53469744-53469766 GGACCCAAGAAAGATAGAGAGGG No data
1174790049_1174790055 -10 Left 1174790049 20:53469691-53469713 CCCAAGAAAGATAGAGAAAGAGA No data
Right 1174790055 20:53469704-53469726 GAGAAAGAGAGAGGGAGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174790049 Original CRISPR TCTCTTTCTCTATCTTTCTT GGG (reversed) Intronic