ID: 1174790063

View in Genome Browser
Species Human (GRCh38)
Location 20:53469744-53469766
Sequence GGACCCAAGAAAGATAGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 397
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 364}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174790049_1174790063 30 Left 1174790049 20:53469691-53469713 CCCAAGAAAGATAGAGAAAGAGA 0: 1
1: 4
2: 31
3: 273
4: 1871
Right 1174790063 20:53469744-53469766 GGACCCAAGAAAGATAGAGAGGG 0: 1
1: 0
2: 1
3: 31
4: 364
1174790050_1174790063 29 Left 1174790050 20:53469692-53469714 CCAAGAAAGATAGAGAAAGAGAG 0: 1
1: 3
2: 45
3: 391
4: 1544
Right 1174790063 20:53469744-53469766 GGACCCAAGAAAGATAGAGAGGG 0: 1
1: 0
2: 1
3: 31
4: 364

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174790063 Original CRISPR GGACCCAAGAAAGATAGAGA GGG Intronic
901648344 1:10728564-10728586 GAAGCCAAGAAAGAAAGAGTTGG - Intronic
902191768 1:14768582-14768604 GGTCACAAGAAAAATAGGGAGGG - Intronic
902554461 1:17238818-17238840 GGACCCAAGAAACAGAGAGTGGG - Intronic
904482035 1:30800177-30800199 GGAAGAAAGAAAGAAAGAGAAGG + Intergenic
904607970 1:31708843-31708865 GGACCTACGAAAGAGAGAGCTGG - Intergenic
904917249 1:33979145-33979167 GAACCTCAGAAAGACAGAGAAGG - Intronic
904962299 1:34343555-34343577 GCACCCAGGAATGATACAGAGGG + Intergenic
904991842 1:34599334-34599356 TTGCCCAAGGAAGATAGAGAGGG - Intergenic
905393618 1:37653377-37653399 GGACCCCAGAGAGGGAGAGATGG + Intergenic
906077077 1:43059712-43059734 GGGATCAAGAAAGAAAGAGAAGG + Intergenic
906882675 1:49609400-49609422 GGAAGAAAAAAAGATAGAGATGG + Intronic
907508968 1:54944287-54944309 GCAGGCAAGAAAGAGAGAGAGGG - Intergenic
908014709 1:59819042-59819064 TGACCCAAAAAAGACAGACAGGG - Intronic
908499495 1:64729175-64729197 GGCACCAAGAAAGAATGAGATGG + Intergenic
910211917 1:84802115-84802137 GGAACCGAGAAAGATAGTGAGGG - Intergenic
910761377 1:90735828-90735850 AGAGCCAAGAAGGAAAGAGATGG - Intergenic
911787124 1:101965127-101965149 GGACCCCAGGAAAATACAGAAGG + Intronic
912243867 1:107940459-107940481 GGACATTTGAAAGATAGAGAAGG + Intronic
912944959 1:114077261-114077283 GAACTCAGGAAAGATAGAGGAGG + Intergenic
913074903 1:115333759-115333781 GGAATGAAGAAAGAGAGAGAGGG - Intronic
913162324 1:116155429-116155451 GGAAGCAAGAAAGAAAGAGAAGG + Intergenic
913331818 1:117674028-117674050 AGACCCACAAAACATAGAGATGG + Intergenic
914094913 1:144536938-144536960 TGATGCAAGAAAGAGAGAGAGGG + Intergenic
914303610 1:146396960-146396982 TGATGCAAGAAAGAGAGAGAGGG - Intergenic
914349288 1:146826460-146826482 GGACCCAAGGAAGATCAAGGTGG + Intergenic
914967281 1:152271259-152271281 GGAGAAAAGCAAGATAGAGAAGG + Intergenic
914969087 1:152290854-152290876 GGAGAAAAGCAAGATAGAGAAGG - Intergenic
915002619 1:152607470-152607492 GGACCCAAGAAACATCAAGGAGG - Intergenic
915551670 1:156638816-156638838 GGAGAGAAGAAAGAGAGAGAGGG - Intergenic
916150813 1:161787540-161787562 GGGTCCAAGAAGGGTAGAGAGGG - Intronic
916473100 1:165142802-165142824 GGAACAAAGAAAGGAAGAGAGGG - Intergenic
916904087 1:169262728-169262750 GGACCCATGCAAGACTGAGAAGG + Intronic
917320600 1:173777394-173777416 GGACAAAAGAAAGAAAGAAAGGG - Intronic
917472234 1:175335639-175335661 GGACACAAAAAGGAGAGAGATGG + Intronic
917621086 1:176796756-176796778 GGAAGAAAGAAAGAAAGAGAAGG - Intronic
917968814 1:180194633-180194655 GGACCCCAGTAGGCTAGAGAGGG - Intronic
918513808 1:185340230-185340252 GGAAGCAAGAAAGAGGGAGAAGG + Intergenic
919845997 1:201642574-201642596 GGAAGGAAGAAAGAAAGAGAAGG - Intronic
919846120 1:201643269-201643291 GGAAGAAAGAAAGAAAGAGAGGG - Intronic
920217922 1:204374660-204374682 GGACCCTATAAAGAGAGAGGAGG - Intronic
920682343 1:208082780-208082802 GAACTCAACAAAGACAGAGAGGG - Intronic
923901210 1:238327654-238327676 AGACCAAAGAAAGAAAGAGGGGG + Intergenic
924892011 1:248293498-248293520 AGACACAAGATAGATAGTGATGG - Intergenic
1062879419 10:966134-966156 AGAGGCAAGGAAGATAGAGAAGG + Intergenic
1063384049 10:5604846-5604868 GAAAGCAAGAAAGAAAGAGAAGG + Intergenic
1063721828 10:8590688-8590710 ATACCCAAGAAGAATAGAGAAGG - Intergenic
1065061924 10:21910907-21910929 GGAAGAAAGAAAGAGAGAGATGG + Intronic
1067404661 10:46010714-46010736 GGACCCATGTAAGGTAGAGGAGG - Exonic
1068129260 10:52877031-52877053 GCACCTAAGAAAGACAGAGAGGG - Intergenic
1068323934 10:55459182-55459204 GGACCCTAAATAAATAGAGAGGG + Intronic
1068789614 10:61012957-61012979 GGAGAGAAGAAAGATATAGAAGG - Intergenic
1069022226 10:63501885-63501907 GGTCCTAAGAAAGAAAAAGAAGG + Intergenic
1069299776 10:66891665-66891687 GAAAGCAAGAAAGAAAGAGAGGG + Intronic
1072282413 10:93878838-93878860 GGACACAATAAAGAGAGAAATGG + Intergenic
1072348194 10:94529684-94529706 GGACCCAAGAAAATGGGAGAAGG + Intronic
1074283352 10:112074237-112074259 GGAACCAAGAAAATCAGAGATGG + Intergenic
1074283656 10:112077791-112077813 GGACTCAGGAAAGAGTGAGAGGG + Intergenic
1074586235 10:114769540-114769562 GGAAGGAAGAAAGAAAGAGAAGG + Intergenic
1077317656 11:1926536-1926558 GGACCCAAGAAGGAACAAGAGGG + Intronic
1077493336 11:2872241-2872263 GGACCCAAGAAATGCAGAGAGGG + Intergenic
1078972902 11:16435816-16435838 GCAACCAGGAAAGAAAGAGAAGG - Intronic
1079946923 11:26755121-26755143 GGACACATGAAAGATAGAAAGGG + Intergenic
1080251682 11:30240590-30240612 GTCCCCAGGAAAAATAGAGAAGG - Intergenic
1081511143 11:43774733-43774755 TGATCCAAGTAAGATACAGAGGG + Intronic
1081752962 11:45525072-45525094 AAAGCCAAAAAAGATAGAGAAGG - Intergenic
1081757904 11:45557678-45557700 GGACCCAAGCCAGAAAGAGGAGG - Intergenic
1083168688 11:60908802-60908824 GCACCCAGGAAAGACGGAGATGG + Intergenic
1083387002 11:62318482-62318504 GTGCTCAAGAAAGAGAGAGAAGG - Intergenic
1089472297 11:118730912-118730934 GCACCCCAGAAAGGTGGAGAAGG + Intergenic
1089541283 11:119190472-119190494 AGACCCCAGAAAGAGAGAGAGGG + Intronic
1089776909 11:120844137-120844159 GGACCCAGGGCAGACAGAGAGGG + Intronic
1089981002 11:122772482-122772504 GGAAGGAAGAAAGAGAGAGAGGG + Intronic
1090452745 11:126821025-126821047 AGTCCCAAGAGAGATAAAGAGGG - Intronic
1090555883 11:127875128-127875150 GAGCCCAAAAAAGGTAGAGATGG - Intergenic
1091409107 12:227612-227634 GCACCCAAGACAGATGGCGAAGG + Exonic
1091990255 12:4949453-4949475 GGACCCTGGAAAGAAAGACACGG + Intergenic
1092442213 12:8515715-8515737 GGAAAAAAGAAAGAAAGAGAGGG - Intronic
1092503108 12:9066529-9066551 GGATCCAAGGGAGATTGAGACGG - Intergenic
1092789495 12:12059294-12059316 GCACCCCAGAAAGGTGGAGAAGG - Intronic
1093654453 12:21678403-21678425 GAAAGCAAGAAAGAGAGAGAGGG - Intronic
1093669333 12:21854016-21854038 GGGCCCAAGAAAGAAGGAGCTGG + Intronic
1094286696 12:28801891-28801913 GGTCCCTAGGAAGATAAAGAGGG + Intergenic
1095528301 12:43154285-43154307 GGAAGAAAGAAAGAAAGAGAAGG + Intergenic
1095690218 12:45080317-45080339 GGAGCCAGCAAAGGTAGAGAAGG + Intergenic
1095853283 12:46832607-46832629 GGACCCAGGAAAGAGGGAGCAGG - Intergenic
1100877035 12:98973364-98973386 TGCCCCAAGAAAGATACAGGTGG - Intronic
1101087116 12:101247791-101247813 ATACCTAAGAATGATAGAGAGGG + Intergenic
1102802273 12:115746486-115746508 GGCACAAAGAAAGACAGAGAAGG - Intergenic
1103926602 12:124426862-124426884 GGACCCAGGGAAGACACAGAGGG + Intronic
1104694316 12:130852039-130852061 GGACCCAAGACAGATGGGAATGG + Intergenic
1105642102 13:22276179-22276201 GGAATCTAGAAAGATAGAAAAGG + Intergenic
1106846113 13:33739500-33739522 GAACCTAAGAAAAATAAAGATGG + Intergenic
1107174953 13:37389178-37389200 GTACCCAAGAAGAATGGAGATGG + Intergenic
1107602015 13:42023181-42023203 TGACCCAAGAAGGACAAAGATGG + Intergenic
1107788476 13:43977713-43977735 GGACGGAAGAGAGAGAGAGAGGG - Intergenic
1109223370 13:59663707-59663729 AGACAAAAGAAAGAGAGAGAGGG + Intergenic
1110275216 13:73634949-73634971 GCACCCAAGAAGGATGGACATGG - Intergenic
1110317113 13:74122065-74122087 GGACACCAGAGAGAAAGAGAAGG + Intronic
1110348566 13:74478631-74478653 TGACCCAGGAAAGCTAGTGATGG + Intergenic
1111034600 13:82655964-82655986 GGAACCAATCAAGAGAGAGAAGG + Intergenic
1112149171 13:96737917-96737939 GGAGGCAAGAGAGAAAGAGAAGG - Intronic
1112802091 13:103124014-103124036 TGGCCCAAGGAAGATGGAGAGGG - Intergenic
1113917859 13:113884859-113884881 GGAACCAAGGGAGACAGAGATGG - Intergenic
1114271199 14:21101338-21101360 GGAGCCATGGAAGATAGAGCTGG + Exonic
1116434925 14:44886270-44886292 GGAGCAAAGAAAGAGAGAGGAGG + Intergenic
1116640774 14:47459531-47459553 GGAAGGAAGAAAGAAAGAGAAGG - Intronic
1117661081 14:58005661-58005683 GCAGCCAAGACAGACAGAGAGGG - Intronic
1117952901 14:61100611-61100633 TGAGCCTCGAAAGATAGAGAAGG + Intergenic
1118738564 14:68721158-68721180 TAACCCAATAAAGAAAGAGATGG + Intronic
1119561120 14:75590684-75590706 AGAAGCAAGAAAGAGAGAGAGGG - Intronic
1121160287 14:91732426-91732448 GGACTTAAAAAAAATAGAGAAGG + Intronic
1122607194 14:102954694-102954716 AGAACCAAGAAAGAAAGAGTGGG + Intronic
1123019020 14:105388955-105388977 GGCCCCAGGAAAGATCCAGAGGG - Intronic
1124993664 15:34701342-34701364 GCACCCTAGAAAAATAGAGGAGG + Intergenic
1126038838 15:44571450-44571472 GGACCGAGAAGAGATAGAGAAGG + Intronic
1126367195 15:47906452-47906474 GGAAGCAAGAAAGAAAAAGAAGG - Intergenic
1126499748 15:49332344-49332366 AGACACAGGAAAGAAAGAGAGGG + Intronic
1126528495 15:49685766-49685788 GTACCCTAGGAAGATAGAAAAGG - Intergenic
1128535053 15:68484327-68484349 GGAGGAAAGAAAGAAAGAGAAGG + Intergenic
1128727921 15:70001454-70001476 GGAGGGAAGAAAGAGAGAGAGGG + Intergenic
1128809596 15:70561234-70561256 GGAGCCATGAAAGCTAGTGATGG + Intergenic
1130071814 15:80653386-80653408 GCACCCAATAAGGACAGAGAAGG + Intergenic
1130657766 15:85804100-85804122 GGAACAAAGAAAGAGAGTGAGGG + Intergenic
1131162542 15:90116968-90116990 GGATTCTACAAAGATAGAGAGGG + Intergenic
1131306877 15:91252770-91252792 GGAAACAAGAAAGGGAGAGAGGG - Intronic
1135206292 16:20487126-20487148 GAACACAAGAAAGAAAGAGAGGG + Exonic
1135212627 16:20536787-20536809 GAACACAAGAAAGAAAGAGAGGG - Exonic
1135522478 16:23188016-23188038 GGACCAGAGAGAGAGAGAGAAGG - Intronic
1135545798 16:23365433-23365455 GGAAGAAAGAAAGAAAGAGAAGG + Intronic
1137676606 16:50306690-50306712 GGACCTTGGAAAGAGAGAGACGG + Intronic
1138011078 16:53380665-53380687 GGACACAAGACACATACAGAGGG + Intergenic
1139049988 16:63112761-63112783 GGACACAAGAAAAAGAGGGAAGG + Intergenic
1139465530 16:67151946-67151968 GGGACCAAGAAAGAGAGAGCTGG - Intergenic
1139984748 16:70889094-70889116 GGACCCAAGGAAGATCAAGGTGG - Intronic
1140413169 16:74753735-74753757 GGACAGAAGAAAAATGGAGATGG - Intronic
1140771259 16:78205925-78205947 GAACAAAAGAAAGAAAGAGAAGG - Intronic
1141318084 16:82980364-82980386 GGACCAAAGAAAGGTGGTGAAGG + Intronic
1144369315 17:14574958-14574980 GGACCCCAGAAAGTTGGCGATGG - Intergenic
1145268071 17:21390014-21390036 GGGCCCGAGAAAGAGAGAGAAGG - Intronic
1146570283 17:33946650-33946672 GGAGCAAAGAGAGATGGAGAAGG + Intronic
1147196028 17:38767179-38767201 GGACCCAAGGAGGAAAGAGTGGG + Exonic
1147790385 17:43010807-43010829 GGACACAAGGAATACAGAGATGG + Intronic
1147901589 17:43789802-43789824 GGACCTAAGAAAGGGAAAGAAGG - Intergenic
1149031907 17:52093193-52093215 GAAACCAAGCAACATAGAGATGG + Intronic
1150219382 17:63487462-63487484 GGGCTCAGGAAAGACAGAGAAGG - Intronic
1150325832 17:64256559-64256581 GGCACCAAGAAAGAAAGAAAAGG - Intronic
1150523117 17:65890497-65890519 GATCCCAAGAAAAGTAGAGATGG - Intronic
1150524603 17:65908909-65908931 GGTCCCAAGAAAGACCAAGATGG + Intronic
1151350500 17:73529019-73529041 GGACTCAAGAAAGACAGAAGAGG - Intronic
1151377899 17:73703980-73704002 GGAAGAAAGAAAGATAGAGAAGG - Intergenic
1153354947 18:4124264-4124286 GGACCCTAGAAGGATGGAGGTGG + Intronic
1153951186 18:10059042-10059064 GGACACCAGGCAGATAGAGAAGG - Intergenic
1154969160 18:21389913-21389935 GGACCCAACAAAAATAGGCAAGG + Intronic
1156314722 18:35957923-35957945 GAACGGAAGAAAGAGAGAGAGGG + Intergenic
1157383319 18:47240440-47240462 AGACCCAAGTCAGATAGATAAGG - Intronic
1158383872 18:56966862-56966884 GGATTCAAGAAGGACAGAGAGGG + Intronic
1159253099 18:65907580-65907602 TGACGCAAGAAAGATAAAAATGG + Intergenic
1161131606 19:2592946-2592968 GGACGGAAGAAAGAAAGAAAGGG + Intronic
1162565199 19:11442122-11442144 GGATCCTAGTAAGATAGGGATGG + Intronic
1162650855 19:12087921-12087943 GGACTCGAGAAAGATAGCAAAGG + Intergenic
1162905584 19:13821538-13821560 GGACAAAAAAAAGAGAGAGATGG - Intronic
1163186530 19:15642699-15642721 GGCCCCAAGAGAGATAGAGCAGG + Intronic
1163218213 19:15896316-15896338 GGACCCAAGAGAGATAGAGCAGG - Intronic
1163342934 19:16721458-16721480 GGACCCAGGAAAACGAGAGAAGG + Intronic
1164457809 19:28423157-28423179 GCACCAAAGAGAGAGAGAGAGGG + Intergenic
1165438329 19:35809155-35809177 AGAGCGAAGAAAGAAAGAGAGGG - Intronic
1166649367 19:44560107-44560129 GGAGAAAAGAAAGATAGAGAAGG + Intergenic
1167760304 19:51442711-51442733 GGAGACAAGAAAGAAAGAAAAGG - Intergenic
1167857649 19:52255812-52255834 GGAAAGAAGAAAGAGAGAGAGGG + Intergenic
925556671 2:5138404-5138426 GGACAGAAGAGAGAGAGAGAGGG - Intergenic
925576818 2:5368913-5368935 TCACCCAAGAAAGAAAGAAAAGG - Intergenic
925920416 2:8634143-8634165 GGACGCAAGGAACAGAGAGATGG - Intergenic
926415013 2:12641160-12641182 GGAAAGAAGAAAGAAAGAGAAGG + Intergenic
928273894 2:29881441-29881463 GGATGCAAGAAAGATAGATGGGG + Intronic
928376125 2:30776208-30776230 GGCTCCAAGCAAGATAAAGAAGG + Intronic
928537561 2:32255119-32255141 AGACCCCAGAAGGAGAGAGATGG - Intronic
929578045 2:43064939-43064961 GAACCCAAGACATAGAGAGAAGG + Intergenic
930029937 2:47052203-47052225 GGCCCCAAGAAAGAGAGGGCTGG + Intronic
930255675 2:49087344-49087366 GGAAACAAGAAAGCCAGAGAGGG + Intronic
931244856 2:60483870-60483892 GCAACCAAGAAAGAAAAAGAAGG - Intronic
931999582 2:67872348-67872370 TGACCCATGAAAGATGGAGATGG + Intergenic
935685183 2:105676761-105676783 GGAAGAAAGAAAGAAAGAGAGGG - Intergenic
936504479 2:113094417-113094439 GTGCCAATGAAAGATAGAGAGGG + Intergenic
936766702 2:115858954-115858976 GAACCCAAGAAACATAAAAAAGG - Intergenic
937107193 2:119327613-119327635 GGAAGCAAGAGAGAGAGAGAGGG - Intronic
937235064 2:120426167-120426189 GGACAAAAAAAAGACAGAGATGG - Intergenic
937841231 2:126526613-126526635 GGAACCCAGAATGAAAGAGATGG - Intergenic
937916731 2:127102986-127103008 GGCCCCAAGATGGACAGAGATGG + Intronic
938695515 2:133831981-133832003 GGACTCAAGGAAGCCAGAGATGG - Intergenic
939665303 2:144944451-144944473 GGAACAAGGAAAGCTAGAGAAGG - Intergenic
940525413 2:154807891-154807913 GAACCCAAGAGGGATAGAGTGGG - Intronic
940584458 2:155627803-155627825 TGACCCAAGAAAGATCAACAAGG + Intergenic
940867503 2:158831727-158831749 GAACCCAAAGAAGATGGAGAAGG + Intronic
941220688 2:162776532-162776554 GGACAAGAGAAAGAAAGAGAAGG + Intronic
941278970 2:163526224-163526246 GGGCTCAAGGAAGGTAGAGATGG + Intergenic
941468470 2:165857092-165857114 GGAGGCAGGAAAGTTAGAGAAGG + Intergenic
942446042 2:176079845-176079867 GGAGCCAGAAAAGAGAGAGAAGG + Exonic
942855880 2:180547047-180547069 GGAATCAAGAGAGAGAGAGAGGG - Intergenic
943418694 2:187638129-187638151 AGACCAAAGAAAGAAAGAAAGGG + Intergenic
943444727 2:187970557-187970579 GGAAGCAAGAAAGAGAGAGGAGG + Intergenic
944010335 2:194966748-194966770 GGAGTCTAGAAAGAAAGAGATGG + Intergenic
944293093 2:198030310-198030332 GCAAGCAAGAAAGACAGAGATGG - Intronic
944467997 2:200023309-200023331 GGATCAAACAAAAATAGAGAAGG - Intergenic
944601301 2:201306225-201306247 GAACAAAAGAAAGAGAGAGAAGG + Intronic
944694412 2:202188212-202188234 GGACCCAAAAGCGAGAGAGAAGG + Exonic
944716613 2:202381371-202381393 GGACCCCAGAAAGAGACACATGG - Intronic
945108120 2:206336508-206336530 CTACCCAGGAAAAATAGAGAGGG + Intergenic
945836302 2:214839386-214839408 GAATCTAAGAAAGATGGAGATGG + Intergenic
946581107 2:221128945-221128967 GGAAGCAAGAGAGAGAGAGAAGG - Intergenic
947543361 2:230993544-230993566 GGTCCCAAGAAGCAGAGAGAGGG - Intergenic
947559452 2:231134509-231134531 GGTCTTAAGAAAGATAGAGAGGG + Intronic
948303857 2:236932162-236932184 GGACCAGAGAAAGAAAGAGCTGG + Intergenic
948566337 2:238889522-238889544 GGACCCAAGAAACACAGGGATGG - Intronic
948599766 2:239101561-239101583 GGACCCTAGGAAGGCAGAGAGGG - Intronic
1169187603 20:3631875-3631897 GAAGCCAAGAAAGACTGAGAAGG + Intronic
1169325615 20:4673186-4673208 GAACGAAAGAAAGAAAGAGAAGG - Intergenic
1169991357 20:11506600-11506622 GGTGGCAAGAAAGAGAGAGAAGG - Intergenic
1170603332 20:17858559-17858581 GCACCCAAGAAGGAGAGAGAAGG - Intergenic
1170700966 20:18703012-18703034 AAACCCAAGAAAGATGAAGACGG - Intronic
1170974364 20:21148688-21148710 GTCCTCAAGAAAGATTGAGATGG + Intronic
1171721388 20:28566893-28566915 GGAACTAAAAAAGATATAGAAGG + Intergenic
1173430598 20:42983873-42983895 GGACCCATGGGAGATGGAGATGG - Intronic
1174790063 20:53469744-53469766 GGACCCAAGAAAGATAGAGAGGG + Intronic
1175372258 20:58499820-58499842 AGACTCAAGAGAGACAGAGAGGG - Intronic
1178546425 21:33496459-33496481 GGACCCAGGAGAGAGAGAGAGGG - Intergenic
1178885063 21:36478807-36478829 GGACCCAGGCAAAATAGAAAAGG - Intronic
1179401923 21:41092105-41092127 GCACCCAAGGAGGATAGACAAGG + Intergenic
1180294931 22:10925553-10925575 GGAACTAAAAAAGATATAGAAGG + Intergenic
1181019593 22:20092352-20092374 GCACCCAAGGAAGACAGAGCTGG - Intronic
1182699545 22:32224321-32224343 GGACCCAAAAAAGAGAACGATGG + Exonic
1183461172 22:37951635-37951657 CGAAGCAGGAAAGATAGAGAAGG - Intronic
1184359631 22:44007225-44007247 GTACCCAGGAAAGATGGGGAGGG + Intronic
1184586577 22:45452166-45452188 GGAGCCAAGTGAGAGAGAGAAGG - Intergenic
1184705691 22:46211679-46211701 GAAAGCAAGAAAGAGAGAGAAGG - Intronic
1184965010 22:47965334-47965356 GGGCCCAAGAAAGACAGCGGAGG + Intergenic
949540846 3:5031022-5031044 GGAGAAAAGAAAGAGAGAGAGGG + Intergenic
949540853 3:5031056-5031078 GGAGAAAAGAAAGAGAGAGAGGG + Intergenic
951639018 3:24813453-24813475 GGAAAGAAGAAAGAAAGAGAAGG - Intergenic
952484836 3:33799300-33799322 TGGCCCAAGAAAGACAGTGATGG - Intronic
954440006 3:50516614-50516636 GGCCCCAAGAAGGAGAGGGAGGG - Intergenic
956299371 3:67753237-67753259 TAACACAAGAAAGCTAGAGAGGG - Intergenic
956951164 3:74284896-74284918 GGAGGAAAGAAAGATAAAGAAGG + Intronic
957779617 3:84801930-84801952 GAAGCCAAGGAAGATGGAGAGGG - Intergenic
958065102 3:88534714-88534736 TGATCCAAGAAAAATAGAGTAGG - Intergenic
958098987 3:88984549-88984571 GGAAACAAGAAAGATAGGGAAGG - Intergenic
958162868 3:89838989-89839011 GCCCCCAAGGAAGATAGAGAAGG + Intergenic
958182784 3:90082164-90082186 GGACCAAAGAATGATAGATGTGG + Intergenic
958694870 3:97514338-97514360 GGAGGCAAGAAACACAGAGAAGG - Intronic
959391339 3:105778179-105778201 GGACTCAATAAAAATATAGAGGG + Intronic
959525199 3:107368688-107368710 GGAGCAAAGAAAGAAGGAGAGGG + Intergenic
959669636 3:108961522-108961544 GGACCCAGAGCAGATAGAGATGG - Intronic
960014433 3:112871093-112871115 GGACACAAGAAACATAAAAAAGG - Intergenic
960141626 3:114156927-114156949 GGAAGAAAGAAAGAAAGAGAAGG - Intronic
960208743 3:114934097-114934119 GGACCTAAGAGAGACAGAAAAGG - Intronic
960245423 3:115394871-115394893 GGAAACAAAAAAGAGAGAGATGG - Intergenic
960460970 3:117935611-117935633 GCACCCAAGAGAGAAAGTGAAGG + Intergenic
960480228 3:118179113-118179135 ACACCCATGAAAGAGAGAGAGGG + Intergenic
960684906 3:120286132-120286154 GGAAGAAAGAAAGATAGACAAGG + Intergenic
962207880 3:133450046-133450068 GGAAGAAAGAAAGAGAGAGAAGG + Intronic
964133778 3:153320375-153320397 GGTCTCAAGTAAGACAGAGAAGG + Intergenic
964544595 3:157820002-157820024 GGACTGAAGAAACACAGAGAAGG + Intergenic
964757161 3:160098625-160098647 CAACCCAAGGCAGATAGAGAAGG + Intergenic
965851865 3:173037237-173037259 GTACCCAAAAAAGGCAGAGAGGG - Intronic
966592344 3:181696510-181696532 GGACGAAAGAAAGGTAAAGAGGG - Intergenic
966708720 3:182948357-182948379 GGACCAGAGAAGGGTAGAGAAGG + Intronic
967073579 3:185982806-185982828 GGACCCAAGAGAGGCACAGAAGG + Intergenic
968059766 3:195718586-195718608 GGACCAAAAAAATCTAGAGAAGG + Intergenic
968195072 3:196699750-196699772 CAAACCAAGACAGATAGAGAGGG - Intronic
969593532 4:8135129-8135151 GCACAAAAGAAAGATAGAAAAGG + Intronic
970200716 4:13601726-13601748 GGTCCCAAAAAAGAAACAGAGGG - Exonic
970382600 4:15523161-15523183 GGACAAAGGAAAGAGAGAGAAGG - Intronic
971711889 4:30123270-30123292 GGACCAGAGAAAAATTGAGAAGG - Intergenic
972456749 4:39262900-39262922 GTCCCCAAGAAAGAAAGAAATGG - Intronic
973614655 4:52666283-52666305 GGAAGAAAGAAAGAGAGAGAGGG + Intergenic
974387585 4:61222713-61222735 GCAGTCAAGAAAGATAGAAAAGG + Intronic
974515446 4:62902253-62902275 ACACCAAAGAAAGATAGAAATGG + Intergenic
976500919 4:85788018-85788040 GCAGCCAAGAAAGGAAGAGAAGG + Intronic
977421554 4:96807168-96807190 GGCCCAAAGAAAGAAAGAGAAGG + Intergenic
977451715 4:97207191-97207213 GGAGCAAAGGAAGAAAGAGAGGG + Intronic
977783566 4:101006818-101006840 TGAAGCAAGAAAGAGAGAGAGGG - Intergenic
978401130 4:108332258-108332280 GAACCTAAGAGAGAGAGAGAGGG - Intergenic
978785606 4:112606207-112606229 AGACAGAAGCAAGATAGAGATGG - Intronic
981517397 4:145624814-145624836 GGACCCATGTAAGGTAGAGGAGG - Intronic
981557199 4:146008232-146008254 GGAAGGAAGAAAGAGAGAGAGGG - Intergenic
984408085 4:179359179-179359201 GGAGAGAAGAAAGAAAGAGATGG - Intergenic
985223626 4:187734870-187734892 GGAACCAAGAAATTAAGAGAGGG - Intergenic
985709355 5:1419689-1419711 GGAGCCAAGGAAGAGAGAGGAGG - Intronic
985842870 5:2322012-2322034 AGACACAAGAAAGAGAGAGATGG + Intergenic
988423305 5:31032899-31032921 GGAAGCAAGAGAGAGAGAGACGG - Intergenic
988713267 5:33799701-33799723 GCAGCAAAGAAAGAAAGAGATGG - Intronic
989218612 5:38930312-38930334 GGACCCACGAAGGTAAGAGAGGG - Intronic
990342629 5:54838759-54838781 TGACCAAATAAAGATAAAGAGGG + Intergenic
990827615 5:59919698-59919720 GGGCCGAAGAAAAATAGGGAGGG - Intronic
990926229 5:61027653-61027675 GGAGGGAAGAAAGAAAGAGAGGG - Intronic
990939979 5:61192266-61192288 GGACCCAAGAAACAGAGACAAGG + Intergenic
992110267 5:73486267-73486289 GGAAGAAAGAAAGAAAGAGAGGG - Intergenic
993188646 5:84652895-84652917 TGACTCAAGAAATATACAGAAGG + Intergenic
994302149 5:98159070-98159092 GGACCCAGGAAAGAAGGTGAAGG - Intergenic
994775485 5:104032624-104032646 GCCCCCAAGAAAGGCAGAGAGGG - Intergenic
995040835 5:107586318-107586340 AGACCAAAGAAAGAAAAAGATGG + Intronic
995054613 5:107745452-107745474 GGAACCAGGGAAGTTAGAGATGG - Intergenic
996471015 5:123860362-123860384 GAACCAAAGATAGAAAGAGAAGG + Intergenic
996606989 5:125334885-125334907 GGATCCTAGAAAGAAACAGATGG + Intergenic
997348453 5:133211049-133211071 AGAACAAAGATAGATAGAGAGGG - Intronic
997579139 5:135006218-135006240 GGACCCATGACAGCTAGAGTTGG - Intronic
997863777 5:137443316-137443338 GGACCAAAGAAAGAGGGAGGAGG - Intronic
999138435 5:149339860-149339882 GGGCCACAGAAAGAGAGAGAGGG + Intronic
1000907459 5:166979571-166979593 GGAAACAAGAAAGAAAGAAAAGG - Intergenic
1000924008 5:167171705-167171727 AGACCCAAGGGAGACAGAGAGGG + Intergenic
1004106053 6:12668339-12668361 GCCCCCAAGAAAGGCAGAGAAGG - Intergenic
1004364402 6:14999682-14999704 GGAAGGAAGAAAGATAGGGAGGG - Intergenic
1005583493 6:27254385-27254407 GAGCCAAACAAAGATAGAGAAGG - Intronic
1006898446 6:37485031-37485053 GGACCCAGGATAGATACAGGGGG + Intronic
1006927677 6:37666739-37666761 GGACATAAGAGAGATATAGAAGG + Intronic
1007256566 6:40533807-40533829 GGACCAAGGAAAGAGAGGGAAGG + Intronic
1008681936 6:53881674-53881696 GGAACCTAGAAAGATAAAAATGG + Intronic
1009844926 6:69122437-69122459 AGACCAAAGAAAGAAAGATAAGG + Intronic
1009950675 6:70392062-70392084 GGAGAGAAGAAAGAGAGAGAAGG - Intergenic
1010451381 6:76007480-76007502 AGACCAAAGAAAGAAAAAGATGG - Exonic
1010720503 6:79277998-79278020 GGAAGAAAGAAAGAAAGAGAAGG + Intergenic
1013617277 6:111856716-111856738 GGAGCCAAGAGAGTTAGAGATGG - Intronic
1013689640 6:112626352-112626374 GTATTCCAGAAAGATAGAGAAGG - Intergenic
1014257250 6:119173704-119173726 TGACAAAAGCAAGATAGAGACGG + Intergenic
1015512635 6:134053737-134053759 GAAGCCAAGAAAATTAGAGAAGG - Intergenic
1016825751 6:148387049-148387071 GAAAGCAAGAAAGAAAGAGAGGG - Intronic
1017618874 6:156274362-156274384 GCACCCAAGGAAGAAACAGACGG - Intergenic
1017961595 6:159226947-159226969 GGTCCCATGAAAGATACTGATGG - Intronic
1018464307 6:164029249-164029271 GTACCCCAGAGAGAGAGAGATGG - Intergenic
1019121004 6:169803358-169803380 GAACACAAGACAGCTAGAGAAGG + Intergenic
1019912538 7:4109561-4109583 GGACCCAAGGGACACAGAGAAGG - Intronic
1020181966 7:5929627-5929649 CTAGACAAGAAAGATAGAGAGGG - Intronic
1020300968 7:6795309-6795331 CTAGACAAGAAAGATAGAGAGGG + Intronic
1021252186 7:18343698-18343720 GAATCCAAGAAAAGTAGAGAAGG - Intronic
1021475028 7:21051049-21051071 GAAGTAAAGAAAGATAGAGAGGG + Intergenic
1021931693 7:25587185-25587207 GGAGCTAAGAAAGCTTGAGATGG - Intergenic
1022529711 7:31059445-31059467 GGACCCAAGAGAGAGAGCCAGGG + Intronic
1023612084 7:41981560-41981582 GGACCCTAGAAAGAAAGGGAAGG + Intronic
1026232278 7:68495899-68495921 GGACCCAGGAAAGTCAGAGATGG - Intergenic
1026490004 7:70855030-70855052 GGCCCAAAGAAAGAGAGAGATGG + Intergenic
1026555330 7:71403676-71403698 GCACCCCAGAATGCTAGAGAAGG + Intronic
1027223986 7:76232702-76232724 GGAGCCAAGAGAGGTAGAGGAGG + Intronic
1027252180 7:76405914-76405936 GGAGGCAAGAAAGGGAGAGAGGG - Intronic
1027407791 7:77880456-77880478 GAGCCCAAGAAAGACAAAGAAGG - Intronic
1028976470 7:96920295-96920317 GGAAGGAAGAAAGAAAGAGAAGG - Intergenic
1028979468 7:96951346-96951368 AGGCCCAAGAAAGACAGAAAAGG + Intergenic
1029323186 7:99783413-99783435 GGACCCAAGGAGGATAAGGAAGG - Intronic
1031944116 7:127820677-127820699 GGAAAAAGGAAAGATAGAGAGGG - Intronic
1032446507 7:131988585-131988607 GGAAGCAAGAGAGAGAGAGAGGG - Intergenic
1032856126 7:135834950-135834972 GGACCCCTGAAAGAAAGAGATGG - Intergenic
1033527326 7:142229246-142229268 GGACCTAAGAAAGAGAAAAATGG - Intergenic
1034309911 7:150078296-150078318 GGACCCAAGCAACAGATAGACGG - Intergenic
1034348424 7:150401197-150401219 GGACCTAAGAAAGATGGTGTAGG + Intronic
1034796937 7:154022325-154022347 GGACCCAAGCAACAGATAGATGG + Intronic
1036073414 8:5467787-5467809 GGAAGGAAGAAAGAAAGAGAAGG - Intergenic
1038961427 8:32524418-32524440 GGAACCAAGAGAGAAAAAGATGG - Intronic
1039796603 8:40920884-40920906 AGACCCAAGAAAGAGAAAAAAGG + Intergenic
1042324258 8:67512325-67512347 TGACCCAAGACAGAGAGAAAAGG + Intronic
1043399898 8:79873799-79873821 GGACCCAAGAAAGAAAGGCAGGG + Intergenic
1043618682 8:82160416-82160438 GGAACCAATAAAGAGAGAGGGGG - Intergenic
1043618697 8:82160529-82160551 GGAACCAATAAAGAGAGAGGGGG - Intergenic
1044299991 8:90572772-90572794 GGAAGGTAGAAAGATAGAGAAGG + Intergenic
1045646454 8:104304443-104304465 GCATCCAAGACAGACAGAGAGGG + Intergenic
1047277946 8:123419819-123419841 GGACTCAAAAAAGGGAGAGAGGG - Intronic
1047616595 8:126567759-126567781 GGGAACAAGAAAGAGAGAGAGGG - Intergenic
1047697089 8:127414869-127414891 TGACCTAAGAAAGAGAGAGCAGG - Exonic
1048317087 8:133370361-133370383 CGACCGTGGAAAGATAGAGATGG + Intergenic
1049313585 8:141947049-141947071 GGATGCAAGGCAGATAGAGAAGG - Intergenic
1050763102 9:9097832-9097854 AGAGCCTTGAAAGATAGAGATGG + Intronic
1051275390 9:15393499-15393521 GGACGTAAGAAAGGAAGAGAGGG - Intergenic
1052801786 9:32975121-32975143 GCAACCAAGAAAGAGAAAGAAGG + Intronic
1053469014 9:38332383-38332405 GGACAGAAGCAAGAGAGAGAAGG + Intergenic
1054881703 9:70151069-70151091 GGACTCAAGGAACAGAGAGAAGG - Intronic
1055609905 9:78011305-78011327 AGACCCAAGACAAATAGGGAAGG + Intronic
1059767840 9:117400668-117400690 GGCCCCAGAAAGGATAGAGAAGG + Intronic
1059803437 9:117773548-117773570 GGAAGAAAGAAAGAGAGAGAGGG - Intergenic
1060240436 9:121898274-121898296 GGACGCTAGAAAGGGAGAGACGG + Intronic
1060673297 9:125489768-125489790 GCAGCCAAGAAAGAAAGAGAAGG + Intronic
1060688575 9:125635381-125635403 GGAGCTAAGAAAGAAAAAGATGG - Intronic
1060882698 9:127129517-127129539 GGTCCCAGGAAAGATAAACAAGG - Intronic
1061368265 9:130183665-130183687 GGAAGGAAGAAAGAGAGAGAAGG - Intronic
1061949716 9:133929522-133929544 GGACCCAAGGCTGATAGACAAGG + Intronic
1185545794 X:943106-943128 GGTACCAAGAAAGAGAGAGAGGG + Intergenic
1185592004 X:1283412-1283434 GGAAGGAAGAAAGAGAGAGAGGG - Intronic
1186278142 X:7962486-7962508 GAACCCAAGAAAGATGGCAAAGG - Intergenic
1186414213 X:9369457-9369479 AGAACCAAGAAAAAAAGAGAAGG - Intergenic
1187101391 X:16196500-16196522 GGAAGCAAGAGAGAGAGAGAGGG - Intergenic
1187400724 X:18957631-18957653 GGAACCAAGCAAAAAAGAGAAGG - Intronic
1187737770 X:22322156-22322178 GGTCCCGAGAAAGGAAGAGAAGG - Intergenic
1190684991 X:52864933-52864955 GCAAACAAGAAAGATAAAGAAGG + Intronic
1192117209 X:68422769-68422791 GGAAGAAAGAAAGAGAGAGAGGG + Intronic
1195617561 X:106924810-106924832 GGAAAGAAGAAAGAGAGAGATGG - Intronic
1195640932 X:107174125-107174147 GGAAGAAAGAAAGAGAGAGAGGG - Intronic
1197297637 X:124738511-124738533 GTACAAAAGATAGATAGAGAAGG + Intronic
1199697383 X:150352473-150352495 AGGTCCAAGAAAGATAGACATGG - Intergenic
1200042489 X:153380085-153380107 GGCCTCAAGAGAGAAAGAGATGG + Intergenic
1201650530 Y:16279969-16279991 GGAACAAAGAAAGAGAGAAAAGG - Intergenic
1201800659 Y:17951575-17951597 GGAAGCTAGAAAGAAAGAGATGG - Intergenic