ID: 1174790063

View in Genome Browser
Species Human (GRCh38)
Location 20:53469744-53469766
Sequence GGACCCAAGAAAGATAGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174790049_1174790063 30 Left 1174790049 20:53469691-53469713 CCCAAGAAAGATAGAGAAAGAGA No data
Right 1174790063 20:53469744-53469766 GGACCCAAGAAAGATAGAGAGGG No data
1174790050_1174790063 29 Left 1174790050 20:53469692-53469714 CCAAGAAAGATAGAGAAAGAGAG No data
Right 1174790063 20:53469744-53469766 GGACCCAAGAAAGATAGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174790063 Original CRISPR GGACCCAAGAAAGATAGAGA GGG Intronic