ID: 1174791915

View in Genome Browser
Species Human (GRCh38)
Location 20:53486841-53486863
Sequence CTGGGGCTGGGGAGGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4625
Summary {0: 1, 1: 9, 2: 60, 3: 616, 4: 3939}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174791915 Original CRISPR CTGGGGCTGGGGAGGGAGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr