ID: 1174791993

View in Genome Browser
Species Human (GRCh38)
Location 20:53487503-53487525
Sequence GTTTGTAACAGGAAAGTGGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 226}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174791986_1174791993 26 Left 1174791986 20:53487454-53487476 CCACCGAAGAAAAGTAATGACTG 0: 1
1: 0
2: 1
3: 9
4: 86
Right 1174791993 20:53487503-53487525 GTTTGTAACAGGAAAGTGGGGGG 0: 1
1: 0
2: 2
3: 10
4: 226
1174791987_1174791993 23 Left 1174791987 20:53487457-53487479 CCGAAGAAAAGTAATGACTGAGA 0: 1
1: 0
2: 0
3: 34
4: 372
Right 1174791993 20:53487503-53487525 GTTTGTAACAGGAAAGTGGGGGG 0: 1
1: 0
2: 2
3: 10
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174791993 Original CRISPR GTTTGTAACAGGAAAGTGGG GGG Exonic
900703126 1:4060310-4060332 GGTTGAAAAAGGAAAGGGGGAGG + Intergenic
901514411 1:9735341-9735363 GTGTGTAACCAGAAAGTGTGGGG - Intronic
902665523 1:17935060-17935082 GTTTTAAAAAGGGAAGTGGGAGG - Intergenic
906119208 1:43376820-43376842 GTTTGGAGCAGGAAAGAGAGAGG + Intergenic
906905969 1:49892787-49892809 GTATGAAACAGAAAAGTGTGAGG - Intronic
909531397 1:76685549-76685571 GAGAGTAACAGGAAAGTAGGAGG - Intergenic
910354924 1:86342751-86342773 GTTTAGAACAGAAAAATGGGTGG - Intergenic
911820200 1:102409376-102409398 CTTTGTAACATAAAAGTGGAAGG + Intergenic
911981399 1:104571419-104571441 GGTTGTAACTGGAAAGAGGCTGG + Intergenic
916668665 1:166990754-166990776 ATTTGTATCAGGAAAGTGCCAGG + Intronic
918635326 1:186767192-186767214 CTTTTTTACAGGAAAGTGTGAGG - Intergenic
919865413 1:201778740-201778762 GCTGGGAATAGGAAAGTGGGTGG - Intronic
920807624 1:209250051-209250073 GTTTATAAAAAGAAAGGGGGAGG + Intergenic
920999617 1:211030317-211030339 GTTTTTAAAAAGAAAGTAGGAGG + Intronic
921474202 1:215586352-215586374 ATTTGTAATAGGAAGGTGGATGG + Intronic
922201656 1:223407880-223407902 TTTTGAAAAAGAAAAGTGGGAGG + Intergenic
923930162 1:238685189-238685211 GTTTTTAACATGAAGGTGAGAGG - Intergenic
923964469 1:239121783-239121805 GTTTGTCAGAGGAATGTGGTTGG + Intergenic
924795490 1:247289488-247289510 GTTTAGAACAGAAAAATGGGTGG - Intergenic
1063467784 10:6258902-6258924 TGTGGTAACAGGAAAGTTGGTGG - Intergenic
1064490941 10:15856430-15856452 ATTTGTAGCAGTACAGTGGGTGG - Intronic
1065738727 10:28777387-28777409 GAGGGTAGCAGGAAAGTGGGGGG - Intergenic
1066071445 10:31818565-31818587 GTTTTTAATCGGAAAATGGGAGG - Intronic
1067358154 10:45550399-45550421 GTTTGTAACAGAAAAATCGAAGG + Intronic
1067465649 10:46497033-46497055 TTTTGTAGCAGGGAAGAGGGGGG - Intergenic
1067621538 10:47887573-47887595 TTTTGTAGCAGGGAAGAGGGGGG + Intergenic
1070707187 10:78648241-78648263 GTTAGGAACAGGAAGGTGGAAGG - Intergenic
1071104284 10:82076552-82076574 GTTTGTATCAGGGGGGTGGGTGG + Intronic
1071739692 10:88343129-88343151 GCTTTGAACAGGAAAGTGAGTGG + Intronic
1072206115 10:93206692-93206714 GTAAGGAACAGCAAAGTGGGAGG + Intergenic
1076924339 10:133474809-133474831 GTCAGTAACGGGAAACTGGGTGG + Intergenic
1077522523 11:3044808-3044830 CTTTGAAACAGGGATGTGGGAGG + Intronic
1078081224 11:8206117-8206139 CTTTGTCTCAGGAAAATGGGAGG - Intergenic
1080940885 11:36916613-36916635 GCTTGTAACTTGAAAGTGTGAGG + Intergenic
1083583791 11:63841564-63841586 GGTTGTGAGAGGAAAATGGGTGG - Intronic
1088351038 11:108887961-108887983 TTTAGTAACTAGAAAGTGGGGGG - Intronic
1090081747 11:123618283-123618305 GTTAGAAACAGGCAAGTGTGGGG - Intronic
1096115571 12:49052903-49052925 GTGTGTAGCAGGTAAGTGGTGGG - Exonic
1098965281 12:76781523-76781545 GTTTGTTACTCGAGAGTGGGTGG + Intronic
1101793437 12:107951528-107951550 GTTTGAAGCAGGAAAGAGGCTGG - Intergenic
1102708577 12:114905210-114905232 GTTTCTGACAGGAAAGTTGAAGG - Intergenic
1106340883 13:28825271-28825293 GTTTGTCATAGGAAAGAGGCTGG + Intronic
1106736189 13:32589861-32589883 GGTTGTAACAGAACAGTGTGAGG - Intronic
1107282369 13:38751408-38751430 GTTTGTGAAAGGAAAAGGGGAGG - Intronic
1110987433 13:81988122-81988144 GTTTTTAAGAAGGAAGTGGGAGG - Intergenic
1111784745 13:92772169-92772191 GTTGGAATCAGGGAAGTGGGAGG - Intronic
1112171321 13:96975741-96975763 GTTTGCACCAGGGAACTGGGGGG - Intergenic
1115148065 14:30249821-30249843 GTTTGTCTCAGGAAAGTTTGAGG + Intergenic
1115268936 14:31530063-31530085 ATCTGTAACAGGAAGGTGAGGGG - Intronic
1117197490 14:53354888-53354910 ATATGTAACTGGAAAGTGGCAGG - Intergenic
1118942056 14:70347361-70347383 GTATAGAACAGGAAAATGGGTGG - Intronic
1120459145 14:84771657-84771679 TTTTGTAGCAGGCAAATGGGAGG + Intergenic
1121629134 14:95409851-95409873 GCTTTGAAAAGGAAAGTGGGTGG - Intronic
1121638131 14:95467451-95467473 GCTTGTACCAGGAAGCTGGGTGG - Intronic
1123025237 14:105420827-105420849 GTCTTTCACAGGAAGGTGGGGGG + Intronic
1125801206 15:42449090-42449112 GTGTGGGAAAGGAAAGTGGGGGG + Intronic
1127141674 15:55984268-55984290 ATTAGTAGCAGGAAAGTGGAAGG + Intronic
1128438218 15:67677048-67677070 GATGTTAACAGGAAAGTGTGAGG - Intronic
1128892265 15:71342034-71342056 GTCTGTAACAGGAGATGGGGAGG + Intronic
1129383427 15:75182478-75182500 GTTTCAAACAGGAATGGGGGTGG + Intergenic
1130541325 15:84822569-84822591 TTTTGTATCAGGAAAGGAGGAGG + Intronic
1130968521 15:88715034-88715056 GTTTGTTGAAGGAAAGTGGCGGG - Intergenic
1133343797 16:5056447-5056469 GTTTTTATCAGGAAAGGGCGAGG + Intronic
1135743708 16:24998173-24998195 GTCAGGGACAGGAAAGTGGGAGG + Intronic
1135840768 16:25874031-25874053 GTTTGGAAGAGGAAAGCGTGAGG - Intronic
1136046544 16:27619706-27619728 GTAGGTATCTGGAAAGTGGGTGG - Intronic
1136225121 16:28855185-28855207 GTTTGCAAAACGAAAGTGGGGGG - Intronic
1137540980 16:49361450-49361472 CCTTGTAACAGTAAAGTGGGTGG + Intergenic
1137929840 16:52576375-52576397 GTTTGTGATAGGAATCTGGGGGG + Intergenic
1140400305 16:74666015-74666037 CTTTATAACAGGAAAAAGGGAGG + Intronic
1141742047 16:85899975-85899997 GTTTAAAAAAAGAAAGTGGGGGG - Intronic
1141981546 16:87553277-87553299 GTTTGTAGGAGGAAAGGGAGTGG + Intergenic
1142067048 16:88068646-88068668 GTCTGTGGCAGGAACGTGGGTGG + Intronic
1143409266 17:6698613-6698635 CTTTGTAACAGGGAAGTAGGGGG - Intronic
1143653095 17:8276372-8276394 GTTTGTTACATGAAGGTGAGTGG + Intergenic
1147620099 17:41860659-41860681 GTTTGTTGCATGAAAATGGGTGG - Intronic
1149964648 17:61150026-61150048 TTTCCTAACAGGAAAGGGGGTGG + Intronic
1157149746 18:45204918-45204940 GTTTGTATGAAGAAAGAGGGAGG + Intergenic
1158453269 18:57585983-57586005 GTTTGCATCAGAAACGTGGGAGG + Intronic
1159144369 18:64434471-64434493 TTTTGTAACAGGAAATATGGGGG + Intergenic
1160042941 18:75362005-75362027 GTGTGTTGCAGGGAAGTGGGGGG + Intergenic
1164908169 19:31984587-31984609 GTTTGGAGGAGGAAAGTGGTAGG - Intergenic
1165400978 19:35599997-35600019 GTTTGTACCAGCTACGTGGGAGG + Intergenic
1167248067 19:48385720-48385742 GTTTGTGGAAGGAAGGTGGGGGG + Intronic
1167441470 19:49511875-49511897 CTTTGTAGCAGGAGTGTGGGCGG + Intronic
927399353 2:22693171-22693193 GTTTAAAAAAGGAAATTGGGAGG + Intergenic
928227890 2:29469372-29469394 ATATCTAACAGGAAAGTGGCAGG + Intronic
928263969 2:29794159-29794181 CTTTATAACATGAAAGTGCGAGG - Intronic
928985861 2:37181049-37181071 GTAAATAACATGAAAGTGGGAGG + Intronic
933167964 2:79095916-79095938 GTTTAGAACAGAAAAATGGGTGG + Intergenic
935101302 2:99998355-99998377 GGTTTCAACATGAAAGTGGGGGG + Intronic
935600953 2:104920921-104920943 GCTTGGAACATGAATGTGGGGGG - Intergenic
936885631 2:117307952-117307974 GTTTGTAGTAGCAAAGTGGTAGG + Intergenic
939362888 2:141196760-141196782 GTTTGGAACAGGAAGATGGTAGG - Intronic
939496590 2:142933954-142933976 GTTTAGAACAGAAAAATGGGTGG + Intronic
940357127 2:152755448-152755470 GGATGGAACATGAAAGTGGGTGG - Intronic
941728567 2:168890412-168890434 GTTTGAAATCGGAAAGTTGGCGG - Exonic
942682046 2:178487124-178487146 GTTACTAAAAGGTAAGTGGGGGG + Intronic
944455942 2:199894113-199894135 GTTTGTAAAATCAAAGTGGTGGG - Intergenic
944594618 2:201249797-201249819 GTTAATAACGGGAAAGTGTGGGG - Intronic
945768528 2:214010868-214010890 GTGAGTAAAAAGAAAGTGGGAGG + Intronic
946167720 2:217875646-217875668 TTTTGAAAGAGGAAAGAGGGAGG - Intronic
946605453 2:221399454-221399476 GTTTGTAGGAGTGAAGTGGGTGG - Intergenic
947673996 2:231961348-231961370 CCTTGTAACAGGAAAGGGGCCGG + Intronic
948534687 2:238637210-238637232 AGTTATAACAGGAAAGTTGGAGG - Intergenic
1169804275 20:9543382-9543404 TTTCCTAACAGGAAAGTGAGTGG - Intronic
1170511274 20:17079554-17079576 CTGTGTATCAGGAAAGTTGGTGG + Intergenic
1170559852 20:17547608-17547630 GTTTGTAAAAAGAAATTGGATGG + Intronic
1173856365 20:46252880-46252902 GTTTGGAAAGGGAAAGTAGGCGG + Intronic
1174590647 20:51641969-51641991 CTTTATGAGAGGAAAGTGGGAGG + Intronic
1174791993 20:53487503-53487525 GTTTGTAACAGGAAAGTGGGGGG + Exonic
1175631463 20:60541519-60541541 GTAAGTAACAGGAAAATGGTGGG - Intergenic
1177079750 21:16624008-16624030 GGTTGCAACAGGAAAATGGGAGG - Intergenic
1177656210 21:24020403-24020425 GTGTGGAAGAGGAATGTGGGGGG + Intergenic
1181298094 22:21858290-21858312 TTTTGTAACTGTAAAGAGGGAGG + Intronic
1183120087 22:35723595-35723617 CTTGTTAACAGGCAAGTGGGGGG - Intronic
1183137201 22:35900360-35900382 GGTTGTAAGAGGATAGCGGGGGG + Intronic
1183999688 22:41663981-41664003 GTAAGGAACAGCAAAGTGGGAGG - Exonic
1184918865 22:47591498-47591520 GTTTGTAACAACAAAGTGAGGGG + Intergenic
1185296299 22:50056990-50057012 GGTGGTTACAGGAAACTGGGAGG + Intergenic
1185415977 22:50710468-50710490 GTTTGTACCAGGAATGTGCTGGG + Intergenic
949559847 3:5190782-5190804 GTTTGTAAGTGGCAAGTGTGAGG - Intronic
950279534 3:11694734-11694756 GTTTGCAAGATGAAAGTGGAGGG + Intronic
950693966 3:14683405-14683427 GTTAGTAATAGGAATGTGCGAGG + Intronic
950728405 3:14934912-14934934 TTTTGTAAAAGGAAACTGGCAGG + Intergenic
950796234 3:15512526-15512548 GTTTATAAATGCAAAGTGGGTGG + Intronic
950879570 3:16312235-16312257 GTTTTGAACAGGGAAGTGTGTGG - Intronic
951807414 3:26661655-26661677 GTTTATAACAGGAAAGAATGGGG - Intronic
953169569 3:40495183-40495205 GTTTGTGACTGGCCAGTGGGTGG + Intergenic
955340009 3:58117959-58117981 TAATGTAACAGGAAAGTGTGAGG - Intronic
955411719 3:58659732-58659754 GTTTGGGAAAGGAAACTGGGAGG + Intronic
958531339 3:95335367-95335389 GTTTGCTACTGGAAAATGGGTGG + Intergenic
962172929 3:133121801-133121823 GTTTGTAAGAAAAAAGTAGGAGG + Intronic
963346747 3:144104019-144104041 GTTTGTGACAGGAAAGGGAATGG + Intergenic
963741854 3:149088662-149088684 GTTTGTGACTGGGAAGTGGCTGG - Intergenic
963741931 3:149089504-149089526 GTTTGTGACTGGGAAGTGGCTGG - Intergenic
964721836 3:159775256-159775278 GCTTCTATCAGGAAAGTGTGTGG + Intronic
964756991 3:160097386-160097408 GTTTGTGACTGGAGACTGGGCGG - Intergenic
965539343 3:169856806-169856828 TCTTGGAACAGTAAAGTGGGAGG - Exonic
965872496 3:173278592-173278614 GTTTAGAACAGAAAAATGGGTGG - Intergenic
966352439 3:179045351-179045373 GTTTGTAACAGCAAAAAAGGTGG + Intronic
967662925 3:192135239-192135261 CTCTGTATCAGGGAAGTGGGTGG + Intergenic
968901173 4:3432648-3432670 GTTTGTGGCAGGAGGGTGGGTGG + Intronic
969099192 4:4756281-4756303 GTATCTCACAGGAATGTGGGAGG - Intergenic
970793956 4:19890548-19890570 GTTTAGAACAGAAAAATGGGTGG - Intergenic
973052238 4:45610370-45610392 GTTTAGAACAGAAAAATGGGTGG - Intergenic
974244676 4:59299576-59299598 GCCAGTAACAGGAAAGTAGGTGG + Intergenic
974950537 4:68579607-68579629 GTTTAGAACAGAAAAATGGGTGG - Intronic
974958924 4:68675126-68675148 GTTTAGAACAGAAAAGTGGGTGG - Intergenic
975320267 4:73002283-73002305 GTAATTCACAGGAAAGTGGGTGG + Intergenic
975564696 4:75741889-75741911 GTTTTTAACAAAAAAGTGGCCGG - Intronic
981102620 4:140846599-140846621 GTTTGTAGCATGTAAGTGAGTGG + Intergenic
981812885 4:148795367-148795389 GCTGATAACAGGAAAGTAGGCGG + Intergenic
982768300 4:159372515-159372537 GTAAGTATCAGGAAAGGGGGTGG + Intergenic
982816743 4:159895201-159895223 GTTTTTAACAGGACAGTGAAAGG + Intergenic
983043612 4:162959076-162959098 GTCAGTGACAGGGAAGTGGGAGG - Intergenic
983991680 4:174127655-174127677 GTGGGTTACAGGAAAGTGGAAGG - Intergenic
985240208 4:187923086-187923108 GGTTGTAACAGGAAACAGTGTGG - Intergenic
986179813 5:5383145-5383167 GTTTATAACAGAAAAGTGGGGGG - Intergenic
986785615 5:11111520-11111542 GGTTGTCCCAGGAAAGTGAGGGG + Intronic
987826730 5:23039602-23039624 CTTTATATCAGGAAAGTGGAAGG + Intergenic
989823327 5:45822578-45822600 GTCAGTAACAGTAAAGTGGGTGG - Intergenic
989987001 5:50712811-50712833 GTTTAAAACAGGAAAGAAGGAGG + Intronic
990147018 5:52773505-52773527 CTGTGTGACAGGAAAATGGGTGG + Intergenic
990185244 5:53204042-53204064 GTTTAGAACAGAAAAATGGGTGG - Intergenic
991007102 5:61840167-61840189 GTTTCTAAAAAGAAAGGGGGGGG - Intergenic
992001379 5:72439626-72439648 GGATGTCACAGGCAAGTGGGAGG - Intergenic
992382730 5:76254904-76254926 ATTTGTACCAGGAAAAGGGGTGG - Intronic
995038667 5:107563922-107563944 GTTTGTACCAGGAAGGTAGAGGG - Intronic
996607057 5:125335575-125335597 GTTTCTCACAGGAAAGTGAGAGG + Intergenic
997296409 5:132771629-132771651 GTTTGTGCCAGGAACATGGGTGG - Intronic
997707714 5:135974079-135974101 GTTGGAAACAGGGAAGTAGGGGG - Intergenic
998186037 5:139980852-139980874 ATTTGGGACAGGAAAGTAGGAGG - Intronic
999353765 5:150904554-150904576 ATTAGTAACAGGGAAGTGAGAGG - Intronic
999722911 5:154412119-154412141 CTCTGCAACAGGAAATTGGGTGG + Intronic
1000435695 5:161205412-161205434 GTTTTTAAGATGAAAGGGGGCGG - Intergenic
1000662991 5:163959205-163959227 GGTTGAAAAAGGAAAGAGGGAGG - Intergenic
1000726767 5:164781556-164781578 GTTTTTAACATGAAAGTGGTTGG + Intergenic
1000992424 5:167924635-167924657 CTTTGTCAAAGTAAAGTGGGAGG + Intronic
1001050707 5:168411780-168411802 CTTTGTTACAGGACAGTTGGGGG + Intronic
1005312024 6:24567898-24567920 GTTTCTAAGGGGAAATTGGGAGG - Intronic
1005352329 6:24948825-24948847 GTTTGAAATAGGAGAGTGGCTGG - Intronic
1006577128 6:35054756-35054778 GTTTGAAACAGGGAATGGGGAGG + Intronic
1006900001 6:37493828-37493850 CCTTGTCTCAGGAAAGTGGGAGG + Intronic
1008585066 6:52941240-52941262 TTATGTAACAGGAAAGAGGAAGG + Intergenic
1009231714 6:61071009-61071031 CTTTGTAACTGGGTAGTGGGCGG + Intergenic
1011038299 6:83001615-83001637 GATGGTAACAGGAAAGCGGAAGG + Intronic
1014665551 6:124232628-124232650 GATTCAATCAGGAAAGTGGGGGG - Intronic
1014706829 6:124758207-124758229 GTTTGTAACAGGAAAGTCAAGGG - Intronic
1017160869 6:151364850-151364872 GTTTGTAAGAGAAAAATGTGTGG - Exonic
1017490347 6:154939443-154939465 CTTTGTAACAGAAGTGTGGGTGG - Intronic
1021239113 7:18178546-18178568 GTTACTAAAAGGAAAGAGGGTGG - Intronic
1021282831 7:18741060-18741082 CTCTGTAACATGAAAGTGGAAGG + Intronic
1021979275 7:26038811-26038833 GTGGGATACAGGAAAGTGGGTGG - Intergenic
1023665373 7:42517668-42517690 GTTTGTTACAGGATAGAGCGGGG + Intergenic
1024432161 7:49301575-49301597 GTTTGTATCAGGCAAGTGCCAGG + Intergenic
1024750242 7:52456395-52456417 CTTTGAAACAGTAAAGTGTGGGG - Intergenic
1024857399 7:53797422-53797444 GTTTGTAAATGGAAAGTGTATGG - Intergenic
1029888613 7:103902018-103902040 GTTTGCAACAGCACAGTGTGGGG + Intronic
1030272351 7:107684348-107684370 GTTTCTACCAGGAAAGGGAGTGG + Intronic
1030334183 7:108306618-108306640 GTTTGAAAAAGATAAGTGGGAGG - Intronic
1031380838 7:121084141-121084163 GTTAGTAACAGGATATTAGGGGG - Intronic
1032285884 7:130538197-130538219 GTCTGGAAGATGAAAGTGGGAGG + Intronic
1033049006 7:137987283-137987305 ATCTGTAACTGGAAAGAGGGAGG + Intronic
1033242177 7:139689636-139689658 GTTTGTAATAGGAAAGTTCCAGG - Intronic
1033907357 7:146221981-146222003 GTTTGTGAAAGGAAGGAGGGAGG + Intronic
1034408493 7:150922739-150922761 GTTGGTAATACGAAATTGGGAGG + Intergenic
1035000827 7:155610994-155611016 GGATGTAGCAGGAGAGTGGGAGG - Intergenic
1035986336 8:4435970-4435992 GTTTGTGACAGAAAAGTAGATGG - Intronic
1037110339 8:15158042-15158064 GTTTGCCAAAGGAAAGGGGGTGG - Intronic
1038957366 8:32482277-32482299 GCATATAACAGGAAATTGGGAGG + Intronic
1039516699 8:38139859-38139881 GATTTTCACAGGAAAGGGGGTGG - Exonic
1040098295 8:43471375-43471397 GTGTGTAAAAATAAAGTGGGAGG + Intergenic
1040374204 8:46807307-46807329 GTTTTTAACAGAAAAGAGGACGG - Intergenic
1041146364 8:54880638-54880660 TTTTTAAAAAGGAAAGTGGGGGG - Intergenic
1041754679 8:61300916-61300938 GTTTATAAGAAGAAAGTGGTAGG - Intronic
1041889646 8:62855116-62855138 GTAAGGAACAGCAAAGTGGGAGG + Intronic
1042158189 8:65866550-65866572 GTTTAGAACAGAAAAATGGGTGG - Intergenic
1042877140 8:73449736-73449758 GGTTGTAACAAGAAAGGGGTGGG - Intronic
1045758103 8:105569787-105569809 GTTTGTCACTGGAACGTGTGAGG - Intronic
1046221732 8:111225869-111225891 GTTTGTTACAGGAAAGTGGCTGG + Intergenic
1046927632 8:119809210-119809232 GTCTGTAACATGAAAGTGCAAGG - Intronic
1048650240 8:136468093-136468115 TTGTGTAACAGGACATTGGGTGG - Intergenic
1048829594 8:138463396-138463418 AATTGTATCAGGAAAGGGGGTGG + Intronic
1050330591 9:4541505-4541527 GTGTGAAAGAGGAAAGAGGGAGG + Intronic
1053040800 9:34869583-34869605 ATTTGTAAGGGTAAAGTGGGAGG - Intergenic
1054798773 9:69326014-69326036 GTGGGTGGCAGGAAAGTGGGAGG + Intronic
1060466742 9:123913431-123913453 GGATTTAACAGGAAGGTGGGAGG + Intronic
1060873266 9:127059893-127059915 GTTTGAAGCAGGAGACTGGGAGG - Intronic
1186441571 X:9591545-9591567 GGTTATAACAGGTAAGGGGGTGG + Intronic
1188019750 X:25144262-25144284 GTTTTTCCCAGGAAAGGGGGAGG - Intergenic
1191172118 X:57458867-57458889 GTTTGAAACACAAAACTGGGAGG + Intronic
1192282417 X:69700393-69700415 GTTTAGAACAGAAAAATGGGTGG + Intronic
1192697021 X:73428056-73428078 GTCTTTAACAGGAACATGGGTGG - Intergenic
1194916969 X:99719167-99719189 GTAAGGAACAGCAAAGTGGGAGG + Intergenic
1195869333 X:109469790-109469812 CTGTGTAAGAGGAAGGTGGGAGG + Intronic
1196003525 X:110811480-110811502 GTTTATAAGAGGAAAGGAGGTGG + Intergenic
1198084941 X:133273565-133273587 GTTACTAAAAGAAAAGTGGGTGG - Intergenic
1199681898 X:150230883-150230905 GTAAGGAACAGCAAAGTGGGAGG + Intergenic