ID: 1174797564

View in Genome Browser
Species Human (GRCh38)
Location 20:53534991-53535013
Sequence ACTGTGACATTTAGTGCTAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174797561_1174797564 -1 Left 1174797561 20:53534969-53534991 CCCCTGGGGAAAGAAAGAAATGA No data
Right 1174797564 20:53534991-53535013 ACTGTGACATTTAGTGCTAACGG No data
1174797562_1174797564 -2 Left 1174797562 20:53534970-53534992 CCCTGGGGAAAGAAAGAAATGAC No data
Right 1174797564 20:53534991-53535013 ACTGTGACATTTAGTGCTAACGG No data
1174797563_1174797564 -3 Left 1174797563 20:53534971-53534993 CCTGGGGAAAGAAAGAAATGACT No data
Right 1174797564 20:53534991-53535013 ACTGTGACATTTAGTGCTAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174797564 Original CRISPR ACTGTGACATTTAGTGCTAA CGG Intergenic
No off target data available for this crispr