ID: 1174798741

View in Genome Browser
Species Human (GRCh38)
Location 20:53544593-53544615
Sequence CTCCAGCAGTGGTTCTTGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174798741_1174798744 -10 Left 1174798741 20:53544593-53544615 CCACTCAAGAACCACTGCTGGAG No data
Right 1174798744 20:53544606-53544628 ACTGCTGGAGGCTGCTCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174798741 Original CRISPR CTCCAGCAGTGGTTCTTGAG TGG (reversed) Intergenic
No off target data available for this crispr