ID: 1174799536

View in Genome Browser
Species Human (GRCh38)
Location 20:53551637-53551659
Sequence AAGGTTATAAAGCTGGCGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174799536_1174799539 3 Left 1174799536 20:53551637-53551659 CCATGCGCCAGCTTTATAACCTT No data
Right 1174799539 20:53551663-53551685 CATGTTCCTTAACCACTCAAAGG No data
1174799536_1174799542 27 Left 1174799536 20:53551637-53551659 CCATGCGCCAGCTTTATAACCTT No data
Right 1174799542 20:53551687-53551709 TCAGTTTCCTCACCTGAAAAAGG 0: 5
1: 61
2: 339
3: 1197
4: 2720

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174799536 Original CRISPR AAGGTTATAAAGCTGGCGCA TGG (reversed) Intergenic
No off target data available for this crispr