ID: 1174801794

View in Genome Browser
Species Human (GRCh38)
Location 20:53570076-53570098
Sequence CATGCTCCTGTATCTGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 161}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174801794_1174801797 8 Left 1174801794 20:53570076-53570098 CCAGCTCCAGATACAGGAGCATG 0: 1
1: 0
2: 2
3: 14
4: 161
Right 1174801797 20:53570107-53570129 CTACTACTGATCAGTTGTAATGG 0: 1
1: 0
2: 1
3: 8
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174801794 Original CRISPR CATGCTCCTGTATCTGGAGC TGG (reversed) Intronic
900499183 1:2991836-2991858 CAGGCTGCTGTTTCTGGACCTGG - Intergenic
900520776 1:3104589-3104611 CATGCTCCTGGATGTGTAGGCGG - Intronic
903257520 1:22112887-22112909 CATGCTCCTGTATGGGGAGGAGG + Intergenic
903342157 1:22661257-22661279 CATGGTCCTCAAGCTGGAGCAGG + Exonic
905461111 1:38123568-38123590 CATCCTGCTGTGTCTGGAGTAGG + Intergenic
906288646 1:44604784-44604806 CAGGCTCTTGTACCTGGAGCTGG + Intronic
907276239 1:53318022-53318044 CAGACTCCTGTGCCTGGAGCTGG - Intronic
908559677 1:65293050-65293072 CTTGGGCCTGTGTCTGGAGCTGG + Intronic
911533680 1:99076080-99076102 CCTGCCACTGTATTTGGAGCTGG - Intergenic
918991130 1:191698331-191698353 CCTGCTCCTTTATCTGCATCTGG - Intergenic
923507028 1:234612739-234612761 CCTGCTCCTGTGTGTGGAGGAGG - Intergenic
924204933 1:241702604-241702626 CCTGTTCCTGCATCTAGAGCAGG + Intronic
1062764175 10:48681-48703 TGTGCTCGTGGATCTGGAGCCGG - Exonic
1063382245 10:5592750-5592772 CATGGTCCTATGTCAGGAGCTGG + Intergenic
1067525753 10:47037447-47037469 CTTGATCCTGTTGCTGGAGCAGG - Intergenic
1067729354 10:48798874-48798896 CCTGGTCCTGGATCTGAAGCTGG + Intronic
1067843358 10:49699576-49699598 CATGCTCCTTGATCAGAAGCAGG - Intronic
1069176792 10:65300185-65300207 CATGCTACTGTGTCTGAAGAGGG + Intergenic
1069859339 10:71460769-71460791 CCTGCTCCTGAATGTGGAGTTGG + Intronic
1071172623 10:82885274-82885296 GATGCTCCTGTAGCTGAAACAGG + Intronic
1071293941 10:84205891-84205913 CATACACCTCTCTCTGGAGCTGG - Exonic
1074153764 10:110781270-110781292 AATCCTGCTGTAGCTGGAGCAGG - Exonic
1075616214 10:123892228-123892250 CATGCTACTGTTTCAGGAACTGG + Intronic
1076900624 10:133335823-133335845 CCGGCTCCTGTCTCTGGGGCGGG + Intronic
1077407794 11:2390471-2390493 CAACCTCCTGTATCTGGAGCTGG + Exonic
1079617616 11:22514405-22514427 CAAGTTGCTGTATCTGGGGCTGG + Intergenic
1082225946 11:49706830-49706852 CATGCTCATGTATGTAGACCTGG + Intergenic
1083764888 11:64836952-64836974 GAAGCTCCAGTGTCTGGAGCAGG - Exonic
1084016893 11:66389000-66389022 CATGCTCATGAATTGGGAGCTGG + Intergenic
1085528484 11:77177560-77177582 CATGCTGCTGGAAGTGGAGCGGG + Exonic
1086623154 11:88912909-88912931 CATGCTCATGTATGTAGACCTGG - Intronic
1089613193 11:119681077-119681099 CATGGAACTGTATCTGGAGTGGG - Intronic
1089842078 11:121427166-121427188 CATTCTCCTGTTTCTGGAGGAGG + Intergenic
1090231833 11:125112388-125112410 CAGGCTGCTGGAACTGGAGCTGG + Intergenic
1090490043 11:127152320-127152342 CATTCTCCTGTCTCTGGGGAAGG + Intergenic
1091347819 11:134867091-134867113 CAGGCTCCTGTAAGTGGTGCTGG + Intergenic
1092248827 12:6880151-6880173 GATGCCACTGAATCTGGAGCTGG + Intronic
1095102923 12:38202138-38202160 TGTGCTCGTGGATCTGGAGCTGG + Intergenic
1103067339 12:117910480-117910502 CCTGCTCCTGTATAAGGATCAGG + Intronic
1105383090 13:19905539-19905561 CCTGCTCCGGTATCTGGCCCTGG - Intergenic
1107925022 13:45250653-45250675 CATTCTCCTGTATCTGCCTCTGG - Intronic
1110419174 13:75286055-75286077 CATTCTCCTTTACCTTGAGCTGG + Exonic
1113076877 13:106475472-106475494 CATGCTCCTGGCTTAGGAGCCGG + Intergenic
1113440087 13:110322174-110322196 CCTGCTCCTTCATCTGGAGCTGG - Intronic
1118302215 14:64625936-64625958 CCTTCTTCTGGATCTGGAGCAGG + Intergenic
1118877234 14:69795979-69796001 CAGGCTGCTGGAGCTGGAGCAGG + Intronic
1119389085 14:74278134-74278156 CCTGCTTCTGGCTCTGGAGCTGG - Intergenic
1121230726 14:92355673-92355695 GATTCTCCTGAAACTGGAGCAGG - Intronic
1122873418 14:104651672-104651694 TCTGCTCCTGTACCTGGTGCTGG - Intergenic
1125884610 15:43219450-43219472 CATGCTGCAGTGGCTGGAGCTGG - Intronic
1126180851 15:45783808-45783830 CAAGCTCCTGTCTCTGTGGCCGG - Intergenic
1128358229 15:66943298-66943320 CAGGCGCCTGTCTCTAGAGCAGG - Intergenic
1129542591 15:76363081-76363103 ACTGCTCTGGTATCTGGAGCAGG - Intronic
1130259809 15:82346179-82346201 TATGCTCGTGTTTCTGGAGGAGG - Intronic
1130268914 15:82433257-82433279 TATGCTCGTGTTTCTGGAGGAGG + Intronic
1130281422 15:82522830-82522852 TATGCTCGTGTTTCTGGAGGAGG + Intergenic
1130472795 15:84239013-84239035 TATGCTCGTGTTTCTGGAGGAGG + Intronic
1130480286 15:84353584-84353606 TATGCTCGTGTTTCTGGAGGAGG + Intergenic
1130491483 15:84434545-84434567 TATGCTCGTGTTTCTGGAGGAGG - Intergenic
1130503098 15:84513585-84513607 TATGCTCGTGTTTCTGGAGGAGG - Intergenic
1130595090 15:85243647-85243669 TATGCTCGTGTTTCTGGAGGAGG + Intergenic
1131403868 15:92147545-92147567 CTTGCTCCTGAATCTGTAACTGG + Intronic
1132854758 16:2039719-2039741 CGTGCTCGCGTGTCTGGAGCAGG - Intergenic
1133903734 16:10001587-10001609 CATGCTCTTGTATCTTTAGAAGG + Intronic
1135405036 16:22191283-22191305 CTTGCTCCTGCCTCTGGACCCGG + Exonic
1135639089 16:24104769-24104791 GAGACTCCTGTAGCTGGAGCTGG + Intronic
1142440478 16:90094551-90094573 TGTGCTCGTGGATCTGGAGCCGG + Intergenic
1142635694 17:1256195-1256217 CATGCTCATGTATGTCCAGCAGG + Intergenic
1144029095 17:11303975-11303997 TCTGCTCCTGGATATGGAGCCGG - Intronic
1145394930 17:22487390-22487412 CATGCTGCTGTGTGGGGAGCCGG - Intergenic
1151126410 17:71850067-71850089 CTTGCTCATGTATCTGCAGATGG + Intergenic
1151686029 17:75647156-75647178 CTGGCTCCTGTATCTAGAGCGGG + Intronic
1152283957 17:79401801-79401823 CAAGCTGCTGTATCTGGAGCCGG - Intronic
1152512294 17:80798557-80798579 CATCCTGCTGACTCTGGAGCAGG - Intronic
1152957086 18:49006-49028 TGTGCTCGTGGATCTGGAGCCGG - Exonic
1153417408 18:4862703-4862725 CATGCTCCTGTACCTTCAGAAGG + Intergenic
1154069115 18:11137108-11137130 CATGATTCTGTATTAGGAGCAGG + Intronic
1155421980 18:25665731-25665753 CATGGTCATGGACCTGGAGCGGG - Intergenic
1158485813 18:57864834-57864856 GATGAACCTGGATCTGGAGCTGG - Intergenic
1160125688 18:76169464-76169486 CATGCTCCTGTGTCGGCAGCAGG - Intergenic
1160604985 18:80043537-80043559 CAGGCTCCTGTCTCTGGGGAGGG + Intronic
1161395389 19:4042689-4042711 CATGAGCCAGGATCTGGAGCCGG - Intergenic
1162659975 19:12161274-12161296 CACACTCCTGGAGCTGGAGCTGG - Intergenic
1163431901 19:17273225-17273247 CCTGCAGCTGTATCTGGAGTGGG + Intronic
1164583103 19:29447296-29447318 AATGGACCTGTCTCTGGAGCAGG + Intergenic
1165113003 19:33513060-33513082 CACGCTCCCGAATCTGCAGCAGG + Intronic
1165355311 19:35300295-35300317 CCTGCTCCTGGAGCTGGAGGAGG + Exonic
1166053947 19:40277588-40277610 CAGGCCCATGTAGCTGGAGCCGG - Intronic
1168118111 19:54236793-54236815 CATGCTCCTCTTTCTGGGCCTGG - Intronic
925267272 2:2574854-2574876 GAAGCCCCTGTCTCTGGAGCAGG + Intergenic
927269754 2:21193451-21193473 CATTCTTCTGTATGTGGAACAGG + Intergenic
927741782 2:25576846-25576868 AATGCTCCTTCATCTGGTGCTGG + Exonic
927925420 2:27009864-27009886 GCAGCTCCTGTATCTGGAGTTGG + Intronic
932503245 2:72203692-72203714 CATTCTCCAATATCAGGAGCAGG - Intronic
932592479 2:73075640-73075662 CCTGCTCCTGCAGCGGGAGCGGG - Exonic
932773953 2:74516021-74516043 GCTGCTCCTGCATCTGCAGCAGG + Exonic
933247372 2:79990689-79990711 CATGCACCTGTATTTGAAGATGG + Intronic
942813422 2:180023411-180023433 CATGCTCCTTTTTCTGGAATGGG - Intergenic
943591535 2:189803657-189803679 TATGACCCTGTGTCTGGAGCAGG - Intronic
946349025 2:219135985-219136007 CATGTCCCTGTATCTAGACCTGG - Intronic
946364309 2:219239138-219239160 GATGCACCTATATCTGAAGCAGG - Exonic
948569809 2:238910839-238910861 CACGCTTCTGTATCAAGAGCGGG - Intergenic
948785617 2:240350976-240350998 CATGCGCCTGGACCTGGTGCTGG - Intergenic
1173005028 20:39133661-39133683 CATGCTCCTGGGTCTGTAGGCGG - Intergenic
1174144355 20:48440729-48440751 CATGAGCCTATATCTGGAACTGG + Intergenic
1174801794 20:53570076-53570098 CATGCTCCTGTATCTGGAGCTGG - Intronic
1175170353 20:57076017-57076039 GATTCCCCTGTATCTGAAGCTGG + Intergenic
1176407825 21:6431034-6431056 CACACATCTGTATCTGGAGCGGG - Intergenic
1178678199 21:34648750-34648772 CATTCTCCTGGTTCTTGAGCCGG + Intergenic
1179375657 21:40848010-40848032 CATTCTTCTGTATTTGGAGGGGG - Intergenic
1179683316 21:43039365-43039387 CACACATCTGTATCTGGAGCGGG - Intergenic
1182944966 22:34313353-34313375 CATGCTGCTGTACAAGGAGCTGG + Intergenic
1184490514 22:44805844-44805866 CATGCTCCTATTTTTGAAGCGGG + Intronic
1185080645 22:48707748-48707770 CATGCTTCCGTGTCTGGAGGGGG + Exonic
1185151718 22:49167609-49167631 CAAGCTCCTGTCTCTGCACCTGG - Intergenic
1203236662 22_KI270732v1_random:9017-9039 CATGATGCTGTAACTGGAACTGG + Intergenic
950465022 3:13148607-13148629 CAAGCACCAGTCTCTGGAGCTGG + Intergenic
953531209 3:43741215-43741237 CAAGCTGCTGTGACTGGAGCAGG + Intergenic
954125135 3:48523797-48523819 CAGGCTCCAGTCTCTGGACCAGG + Exonic
954424114 3:50434387-50434409 CATTCTCCTGTACCTCGAACAGG + Exonic
954665484 3:52249194-52249216 CATCCTCCTGTAGCTCCAGCTGG - Exonic
956194404 3:66637456-66637478 CATGCTTCTCTAGGTGGAGCAGG - Intergenic
957579986 3:82059199-82059221 CATGCTCATGAATCTGGCTCGGG + Intergenic
961090566 3:124107662-124107684 AATGCTGCTGTGTCTGGAGGAGG + Intronic
963280070 3:143375629-143375651 CTTGCTCATGTGTCTGGAGTTGG - Intronic
965324186 3:167281514-167281536 CTGTCTCCTGTATCTGCAGCTGG + Intronic
966413948 3:179670107-179670129 CATGCTTTTGCATCTGGAGAGGG + Intronic
967174982 3:186854569-186854591 TGTGCTCCTGCATCTGGAGGTGG + Exonic
968424441 4:512910-512932 CATAATCCTCTATCGGGAGCTGG + Intronic
971648643 4:29241763-29241785 AATGCTCCTGAATCAGGAACTGG + Intergenic
973405201 4:49724217-49724239 CATGCTCTAGTATCTGGAAGTGG + Intergenic
973822135 4:54671056-54671078 AATGCTCCTGTTACTGTAGCTGG + Intronic
974366748 4:60960034-60960056 AAGGCTACTGTATCTGAAGCTGG - Intergenic
985441354 4:189984321-189984343 TGTGCTCGTGGATCTGGAGCCGG - Intergenic
987202826 5:15594512-15594534 CATGCTCCTGTTTCTAGCCCTGG - Intronic
991247479 5:64523251-64523273 CGTGCCCCTGGATCTGAAGCAGG + Intronic
994406460 5:99351998-99352020 CATGCACCTGCATCTGGATAAGG + Intergenic
997454123 5:134004914-134004936 CAGGCTCCTGTGTCTGCTGCCGG - Exonic
997662427 5:135599781-135599803 CCTGATCCTGTATAAGGAGCTGG + Intergenic
1002361750 5:178677568-178677590 TATGCTCCTGTAACAGTAGCTGG + Intergenic
1006110908 6:31744597-31744619 CATGCTGCTGTCTCTGGGGAGGG + Intronic
1007682637 6:43645113-43645135 CCTCCTGCTGTCTCTGGAGCTGG + Exonic
1007761024 6:44133807-44133829 CATGCTCCTGCCTCTGAAGCAGG - Intronic
1008213383 6:48753795-48753817 CATGCTTCTGTAACTGGAGTAGG + Intergenic
1010253531 6:73732991-73733013 CATGCTCCTGTCTCTGTACCTGG + Intronic
1011624043 6:89269154-89269176 CATGCTCTTGTTGCTGGCGCTGG + Exonic
1016349755 6:143154567-143154589 AATACTTCTGTATCTCGAGCAGG + Intronic
1017986324 6:159445973-159445995 CATGCTGCTGTAGGTGGAGCTGG + Intergenic
1018174160 6:161164501-161164523 CAGGGTCCTGTTTCTGGAGCAGG + Intronic
1022150095 7:27593915-27593937 CATTCTCCTGTCTCTGTTGCTGG - Intronic
1022176862 7:27879638-27879660 CATGACCCTATATCTTGAGCAGG - Intronic
1023882852 7:44330225-44330247 TCTGCTCCTGCATCTGGCGCTGG + Intronic
1028637004 7:93000268-93000290 CATAAACATGTATCTGGAGCTGG - Intergenic
1031528194 7:122846960-122846982 CATGTTCCTGGATCTGCTGCCGG - Intronic
1032675623 7:134127562-134127584 CATGCACCGCTATCAGGAGCTGG + Exonic
1032894816 7:136238462-136238484 GATGCTCCTGTATTTGAACCTGG - Intergenic
1034266692 7:149784540-149784562 CATCCTCCAGGCTCTGGAGCAGG - Intergenic
1036736414 8:11321582-11321604 CATGCTCCTCAACCTAGAGCTGG + Intronic
1037386423 8:18347566-18347588 CATTCTCCTCTGCCTGGAGCAGG - Intergenic
1039847813 8:41338196-41338218 CATCCTCATGTATCTGGAGGGGG - Intergenic
1042027056 8:64435074-64435096 CATTGTTCTGTGTCTGGAGCAGG - Intergenic
1049337376 8:142093640-142093662 CAGGCTCCTGTCTGTGGAGGGGG - Intergenic
1049409446 8:142465927-142465949 CACGCTCCTGTCTCATGAGCAGG - Intronic
1049588356 8:143442112-143442134 ACTGCTCCTGTACCTGGGGCTGG + Intronic
1049785862 8:144450378-144450400 CCTACTTCTGTATCTGGAACAGG + Exonic
1050792543 9:9492413-9492435 CATGCTGCTGGATTTGGTGCTGG - Intronic
1054779296 9:69151701-69151723 CTTGCTCCTGGAGCTGCAGCCGG - Intronic
1055707540 9:79022757-79022779 CATGCCACTGAATGTGGAGCTGG - Intergenic
1056763152 9:89428702-89428724 CATGGTCCTGTAGGTGGGGCCGG - Intronic
1057949204 9:99356480-99356502 CATGCTCGTGGAGCTGGGGCTGG + Intergenic
1059679189 9:116569822-116569844 CATGCTCCAGTTTCTGGGTCTGG - Intronic
1059989178 9:119848520-119848542 CAGGCTCATGTTTCTGAAGCTGG - Intergenic
1062149617 9:135010949-135010971 CATGCTCCTGGTTCCGTAGCAGG + Intergenic
1062741081 9:138175623-138175645 TGTGCTCGTGGATCTGGAGCCGG + Intergenic
1203770493 EBV:47645-47667 CAGGCTCCTGGATCTGGGGCTGG + Intergenic
1189870929 X:45381933-45381955 CATGCTGCTGCAGCTGGTGCTGG - Intergenic
1197675357 X:129324191-129324213 AATCCTCCTGTATCTGAAGCAGG - Intergenic
1201711101 Y:16993060-16993082 AATGCTTGTGTATCTGGAGTTGG - Intergenic