ID: 1174801865

View in Genome Browser
Species Human (GRCh38)
Location 20:53570846-53570868
Sequence ACCAGGCTCCTGCCTCTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 1, 2: 2, 3: 22, 4: 325}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174801862_1174801865 5 Left 1174801862 20:53570818-53570840 CCTGGATCTTTGCAGACCTAGGA 0: 1
1: 0
2: 0
3: 8
4: 99
Right 1174801865 20:53570846-53570868 ACCAGGCTCCTGCCTCTCACAGG 0: 1
1: 1
2: 2
3: 22
4: 325

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174801865 Original CRISPR ACCAGGCTCCTGCCTCTCAC AGG Intronic
900014666 1:139617-139639 ACCAAGCTCATGACTCTCAATGG - Intergenic
900502605 1:3013868-3013890 ACCAGGCTCCCGCCTCTCACTGG + Intergenic
900670513 1:3850986-3851008 ACCCTGCTCATGCCTCTCCCAGG - Intronic
901044196 1:6385787-6385809 ACCAGGCTCCTGCTCCTCCTAGG + Exonic
901448085 1:9320107-9320129 TCCAGGCGTCTGCTTCTCACCGG + Intronic
902374533 1:16024079-16024101 GGCAGGCTCCTGCCCCTCTCTGG + Intronic
902379474 1:16045843-16045865 GGCAGGCTCCTGCCCCTCTCTGG + Intronic
903466088 1:23553748-23553770 AGCAGGTTCCTGCCCCTCTCTGG + Intergenic
903736739 1:25534586-25534608 CCCAGGGTCCTGCCTGGCACAGG + Intergenic
903822038 1:26110904-26110926 ACCGCGCTCCTGCCGCTCTCGGG - Intergenic
904300421 1:29550205-29550227 AGCAGGCTCCTGCCTCTGCCTGG + Intergenic
904490548 1:30856267-30856289 ACCAGGCTCGTGCCTATGGCAGG - Intergenic
904910335 1:33929868-33929890 AACAGGCTCCTCCTTGTCACAGG + Intronic
904927150 1:34058148-34058170 CCCAGGCTCCTGCATCACATAGG + Intronic
905201984 1:36321969-36321991 CCCAGGCTCCTGCCACGCAGGGG - Intronic
905460304 1:38118516-38118538 CCCAGGGTGCTGCCTCTGACAGG + Intergenic
905809178 1:40899424-40899446 ACCAGCCTCCTCCCTGTCTCTGG - Intergenic
905925572 1:41747078-41747100 ATCCTGCTGCTGCCTCTCACAGG - Intronic
907426073 1:54380104-54380126 TCCAGGCTCCTCCCTCTCCTAGG + Intronic
907513305 1:54978345-54978367 TTCCTGCTCCTGCCTCTCACTGG - Intergenic
907550534 1:55301191-55301213 GCCTGGTTCCTGCCTCTCTCCGG + Intergenic
908897970 1:68922754-68922776 ACCATTATTCTGCCTCTCACAGG - Intergenic
909090849 1:71223618-71223640 GCCAGACTCCTGCCCCTCATAGG - Intergenic
911401449 1:97379784-97379806 TTCAGTCTCCTGTCTCTCACTGG - Intronic
912159699 1:106966756-106966778 ACCAGGCTCATTCCTGTCACAGG + Intergenic
912160173 1:106973236-106973258 ACCAAGCTCTTGCCTCCCTCGGG + Intergenic
912746183 1:112247462-112247484 ACATGGCAGCTGCCTCTCACTGG - Intergenic
915578940 1:156801795-156801817 ACAGGGCTCCTGCATCCCACAGG + Intergenic
919772506 1:201171379-201171401 CCCAGCCTCCTGCCCCTCCCTGG - Intronic
920656802 1:207882734-207882756 ACAAGGCTTCTTCCTCTCTCGGG + Intergenic
922100023 1:222472193-222472215 CCCGGCCTCCTGCCTCTCAAAGG - Intergenic
922100228 1:222473021-222473043 CCCGGCCTCCTGCCTCTCAAAGG - Intergenic
922419445 1:225449659-225449681 ACCCGGCCCCTCCCTCTCTCTGG + Intergenic
923517494 1:234709833-234709855 ACCAGGCTCAGGCCTCCCTCAGG + Intergenic
924619824 1:245650892-245650914 GCCCGGCACCTCCCTCTCACGGG + Intronic
1062952174 10:1512787-1512809 ACACAGCTCCTGCATCTCACTGG - Intronic
1063478737 10:6351670-6351692 ACCAGGCTCCTTCTTGCCACAGG - Intergenic
1063536889 10:6892117-6892139 ACCAGGCTCCAGGCTAACACTGG - Intergenic
1064183635 10:13141379-13141401 ACCTGGCTCTTGCCTTTCCCTGG - Intergenic
1065450066 10:25847967-25847989 ACCAGGAAACAGCCTCTCACAGG - Intergenic
1066987008 10:42476353-42476375 TCAAGGCTCCTGCCGCTCCCGGG - Intergenic
1068054404 10:51993581-51993603 GCCAGGATTCTGGCTCTCACTGG + Intronic
1069890061 10:71646989-71647011 TCCAGGCGCCTGCCCCTCTCTGG - Intronic
1069932067 10:71889596-71889618 TCCAGGCTCTTTCCTCTCTCAGG - Intergenic
1069984921 10:72276511-72276533 ACTTAGCTCATGCCTCTCACTGG + Intergenic
1070156721 10:73839902-73839924 AAGGGGCACCTGCCTCTCACCGG - Intronic
1071294812 10:84211805-84211827 CCCAGGCTCCTGTCCCTCCCAGG - Intronic
1072913321 10:99522221-99522243 ACCCGGCTCCTAACACTCACAGG + Intergenic
1073443040 10:103564148-103564170 ACCACATTCCTGCCTCTCAGCGG - Intronic
1074192067 10:111146713-111146735 TGGATGCTCCTGCCTCTCACAGG - Intergenic
1074773982 10:116752927-116752949 ACAAAGCTCCTGCCTCACTCAGG - Intergenic
1074927702 10:118090799-118090821 CCCACGCTCCTCCCTCTCACTGG - Intergenic
1075845924 10:125544946-125544968 ACCCGGCTGCTCCGTCTCACAGG + Intergenic
1075919896 10:126201901-126201923 ACTAGCCTGCTGCCTCTCTCTGG - Intronic
1076550986 10:131278072-131278094 TCCCGGCTCCTGCCTCCCCCCGG + Intronic
1076673871 10:132137687-132137709 ACCAGGGTCCTGCTGCTCTCCGG - Intronic
1076765822 10:132632502-132632524 GCCTGGTTCCTGCCTCTCAGAGG - Intronic
1076858269 10:133127911-133127933 ACCAGGCTCCACCCTCTGCCTGG + Intronic
1078406409 11:11073964-11073986 ACCTGGCTGCTGCCTCACATGGG + Intergenic
1078567184 11:12426367-12426389 ACCATGCTCCAGCCACACACTGG - Intronic
1079769996 11:24446576-24446598 ATCTGTCTCCTGCCTCTCCCTGG + Intergenic
1082259880 11:50070738-50070760 ACCCAGCTTCTGCCTCACACTGG - Intergenic
1082261407 11:50078307-50078329 CCCCAGCTCCTGCCTCTCATCGG - Intergenic
1082975131 11:59063412-59063434 CCCAGGCTCCTGCCGCACGCGGG + Intergenic
1082979558 11:59107149-59107171 CCCAGGCTCCTGCCGCGCACGGG + Intergenic
1083729573 11:64645456-64645478 GCCTGTCTCCTGCCTCTCCCAGG - Intronic
1084146860 11:67269644-67269666 GACAGGCTCCTGCATCTGACGGG - Intronic
1084438280 11:69156687-69156709 TCCTGGCCCCTGCCTCTCAGTGG - Intergenic
1084867975 11:72075417-72075439 ACCAGCCTCCTGCCCCTCAAAGG + Intronic
1087801883 11:102513311-102513333 ACATGACCCCTGCCTCTCACAGG + Intergenic
1087847714 11:102992191-102992213 AACAGGCTCTTCTCTCTCACTGG + Intergenic
1090429504 11:126634379-126634401 CACAGGCTCCTGGCTCTCACTGG - Intronic
1090694486 11:129224611-129224633 GCCAGGCTCCTGGCTTTCAGTGG - Intronic
1091618410 12:2067199-2067221 TCCTGGCTCCTGCATCCCACTGG - Intronic
1091700334 12:2654844-2654866 ACCGGGATCCTGCTTCTGACAGG - Intronic
1092070446 12:5627323-5627345 ACCAGGATCCTGGCTCTCTGGGG - Intronic
1092136102 12:6148364-6148386 ACCAGGCCACATCCTCTCACAGG + Intergenic
1093073959 12:14737605-14737627 ACCAGGGATCTGCCTCTCATTGG + Intergenic
1094028694 12:25986235-25986257 TCCAGGCTCCTGCACTTCACAGG + Intronic
1094217112 12:27954434-27954456 ACAAGGCTCCTGCCTTTAAAAGG + Intergenic
1094614226 12:32021973-32021995 GTTAGGCTCCTGCCTCCCACGGG + Intergenic
1098482162 12:70976393-70976415 ACACGGATCCTGCCTCTCAGTGG - Intergenic
1099230166 12:80014275-80014297 ACCAGGCTCCTATCCTTCACAGG - Intergenic
1100515292 12:95321712-95321734 CCCTGGCTCCCGCCTCTCCCAGG + Intergenic
1102197718 12:111036315-111036337 ACCCAGCCCCTGCCTCTCCCCGG - Intronic
1102596244 12:113994636-113994658 ACCTGGCCCATGCCTCTCTCTGG - Intergenic
1102697946 12:114814807-114814829 CTCAGGCTCCTGCCTCCAACAGG - Intergenic
1103967299 12:124647970-124647992 ACCATTATCCTGCCTCCCACCGG + Intergenic
1106032739 13:26017521-26017543 CCCAGCCTCCTGCCTCCCTCTGG - Intronic
1106100781 13:26694111-26694133 GCCAGGCTCCTTCCTCACAGAGG + Intergenic
1107365647 13:39671085-39671107 GTCAGGCTCCTGCATGTCACTGG - Intronic
1112431971 13:99358175-99358197 ACCAGACTCCTGTCTGCCACTGG - Intronic
1113613118 13:111661939-111661961 GCCCGTCTCCTGCCTCCCACAGG + Intronic
1113911839 13:113845350-113845372 AAGAGACTCCTGCCTCTCCCAGG + Intronic
1117108141 14:52420088-52420110 CCCAGGCTCTTTCCTCTCCCTGG + Intergenic
1118039735 14:61903830-61903852 ACCAAGCTCCTGCCACTGGCTGG - Intergenic
1119167378 14:72505999-72506021 ATCAAGTTCCTGCCTCCCACTGG - Intronic
1119668468 14:76500754-76500776 ACCAGGCAGCTGCACCTCACTGG + Exonic
1120206131 14:81589508-81589530 AGCAGCCTCCTCCCACTCACTGG - Intergenic
1121099575 14:91241286-91241308 ACCAGCTTCCTGCCACTCACAGG + Intronic
1122309044 14:100783190-100783212 TCCCCGATCCTGCCTCTCACGGG - Intergenic
1122780796 14:104142608-104142630 ACCAGGCTGCAACCTCCCACAGG - Intronic
1122781834 14:104147013-104147035 ATCAGGCCCCTGCCTCCCAGCGG - Intronic
1122860950 14:104582165-104582187 CCCAGGCTGCTGCCTCTGCCTGG - Intronic
1125094807 15:35838877-35838899 GCCAGGCTACTGCCACTTACTGG - Intergenic
1125541474 15:40472106-40472128 ATCAGCCTCCAGCCTCTCATAGG - Exonic
1125909150 15:43420850-43420872 ACCAGGCTCATGCCTGTGATGGG - Intronic
1127563657 15:60165459-60165481 GCCAAGCACCTGCCTATCACAGG + Intergenic
1127898972 15:63327216-63327238 ACCAGGCATCATCCTCTCACTGG - Exonic
1128219902 15:65961703-65961725 ACCCAGCTCCAGCCTCTCTCTGG - Intronic
1128520058 15:68369333-68369355 ACCAGGCTCCATCCTCTGCCAGG - Intronic
1129472500 15:75763372-75763394 ACCAGCCTCCTGCCCTCCACAGG + Intergenic
1129724475 15:77894507-77894529 AGCAGGCTGCCACCTCTCACTGG + Intergenic
1130653509 15:85775835-85775857 GCCAGGCTGCTGCCTTTCAATGG + Intronic
1131748788 15:95482459-95482481 ACCCTCCTCCTGCCTCTCCCGGG + Intergenic
1131873478 15:96782506-96782528 CCCTGTCTCCTGCCTCTGACTGG + Intergenic
1132495480 16:261291-261313 AACAGGAGCCTGCCTGTCACAGG + Intronic
1132759654 16:1502506-1502528 ACAGGGCTGCTGCCTCTCCCGGG + Intronic
1134297942 16:12963127-12963149 CCCAGGCTCCTGCTTCCCTCAGG - Intronic
1136998339 16:35207228-35207250 ACCTGGGTCGGGCCTCTCACGGG - Intergenic
1137029054 16:35505830-35505852 ACCTGGGTCGGGCCTCTCACGGG - Intergenic
1139412284 16:66773506-66773528 ACCAGGTTCCCTCCTATCACAGG + Intronic
1139459383 16:67109860-67109882 CCCAGGCTCCTCCCTCGCGCTGG + Intergenic
1139543822 16:67639252-67639274 TGCAGGCTGCTGCCTTTCACAGG + Intergenic
1141036845 16:80633928-80633950 CCCAGTCTCCAGCCTCACACAGG + Intronic
1141898667 16:86975756-86975778 CCTAGGCTCCTGCATCTCCCCGG - Intergenic
1142158212 16:88542618-88542640 ACCAGGCTCCTCCCTGTCTCCGG - Intergenic
1142448993 16:90162805-90162827 ACCAAGCTCATGACTCTCAATGG + Intergenic
1142457702 17:65657-65679 ACCAAGCTCATGACTCTCAATGG - Intergenic
1142458103 17:69077-69099 ACCAAGCTCATGACTCTCAATGG - Intergenic
1143088262 17:4433226-4433248 GACACCCTCCTGCCTCTCACAGG + Intergenic
1143731429 17:8885018-8885040 CCCAGGGTCCTGCCTCTCCAGGG + Intronic
1143731443 17:8885067-8885089 CCCAGGGTCCTGCCTCTCCAGGG + Intronic
1143731457 17:8885116-8885138 CCCAGGGTCCTGCCTCTCCAGGG + Intronic
1144281298 17:13729733-13729755 GCCAGGCTCCTGACTCTTAAGGG - Intergenic
1145062501 17:19741984-19742006 AGCAGGCCCGTGCCTCTCACCGG + Exonic
1146257532 17:31400338-31400360 GGCAGGCTCCTGCCTCTGCCTGG - Intronic
1146632272 17:34479438-34479460 ACCAGGCTCCAGCCTCCCTGCGG + Intergenic
1146729759 17:35183405-35183427 GCCATGTTCCTGCCTCCCACAGG + Exonic
1147447813 17:40485492-40485514 TCCAGGCTCCCGCCTCCCAGGGG - Intronic
1147696998 17:42362885-42362907 ACCAGGCTCCTGCCTGCCACTGG + Intronic
1147741536 17:42673369-42673391 ACCACTCTCCTGGCTCTCCCTGG + Intronic
1147847988 17:43418797-43418819 AACAGGCTCCTGCCTCAAAAAGG - Intergenic
1148563543 17:48619962-48619984 ACCAGGCTCCTGCCCCATCCTGG - Intronic
1148740898 17:49891616-49891638 GCCAGTTTCCTGCCTCTCATTGG - Intergenic
1149777939 17:59372709-59372731 ACAAGGCTCCTGCCTCTCTTAGG - Intronic
1151497376 17:74466911-74466933 CCCTGGCTCCTTCCTCTCCCAGG - Intronic
1151929698 17:77224502-77224524 ACCGGCCTCTTGCCCCTCACTGG - Intergenic
1152073021 17:78143485-78143507 TCCAAGGTCCTGCCTGTCACTGG - Intergenic
1152268212 17:79308511-79308533 ACCTGGCTTCTGCCTCTTAGCGG + Intronic
1152584719 17:81183770-81183792 CCCAGACCCCTGCCGCTCACAGG - Intergenic
1152747607 17:82048603-82048625 GCCAGGTGCCTGCATCTCACTGG + Exonic
1153025552 18:669250-669272 CCCAGGGTCCTGCCTCCCTCAGG - Intronic
1153719746 18:7889766-7889788 AGCAGGGACCTGCCCCTCACTGG - Intronic
1153964901 18:10170572-10170594 ACCAGACTTCAGCCACTCACAGG - Intergenic
1158518340 18:58149252-58149274 ACCAAGGTCCAGCCTCTCCCAGG - Intronic
1159019932 18:63135173-63135195 ACCTGCCTCCTGCATGTCACTGG + Intronic
1160097625 18:75889858-75889880 ACCATGCTCCTGCCTCTTCTGGG - Intergenic
1160327720 18:77966424-77966446 CCCAGGCTCCTGTCCCTCAGAGG - Intergenic
1160591350 18:79946501-79946523 AGCAGGCTCCTGCACCACACAGG - Intronic
1160648214 19:204997-205019 ACCAAGCTCATGACTCTCAATGG - Intergenic
1161082771 19:2319740-2319762 CCCAGCCTCCAGCCTCGCACCGG - Intronic
1161218151 19:3105020-3105042 CCCAGGTTCCTGCCTCAGACTGG - Intronic
1161455860 19:4369503-4369525 CCCAGCCCCCTGCCTCTCACAGG + Intronic
1161490764 19:4559930-4559952 TCCAGGCCCCAGCCTCTCCCTGG + Intergenic
1161605633 19:5213296-5213318 CCATGGCTCCTGCCTCCCACAGG + Intronic
1162988678 19:14288380-14288402 ACCTGTCTTCTGCCTCTCCCTGG - Intergenic
1163114568 19:15181189-15181211 ATCAGGCTCCGCCCCCTCACAGG + Intronic
1164586583 19:29479758-29479780 CCCAGGGTCCTGGCACTCACAGG + Intergenic
1165316805 19:35060796-35060818 TCCAGTCCCCTGCCCCTCACAGG + Exonic
1165946948 19:39449274-39449296 ACCTGGCTCCTCCCTCCCAGTGG - Intronic
1167425418 19:49427611-49427633 GTCCGGCTCCTGCCCCTCACCGG - Exonic
1168059313 19:53882451-53882473 ACCAGGATCCTGCCTTTCTTGGG - Exonic
1168539866 19:57201343-57201365 TCCAGGCAGCTGCCTCTCCCTGG + Intronic
925130079 2:1488490-1488512 ACCCGGCTCCTGCCTTTCCCAGG + Intronic
925571635 2:5318609-5318631 TACTGGCTCCAGCCTCTCACTGG + Intergenic
925869342 2:8255474-8255496 ACAAGGATCCTGCCTTTCTCAGG - Intergenic
926680943 2:15663611-15663633 CCCAGGCACCTAACTCTCACAGG - Intergenic
926812146 2:16764530-16764552 TCCAGACTTCCGCCTCTCACAGG - Intergenic
927941234 2:27104189-27104211 CCCAGTCTCCTGCCTCCCAGAGG + Intronic
928178384 2:29050540-29050562 ACAAGCATCCTGCCTCTCAGGGG + Intronic
929005222 2:37387206-37387228 ACCAGGCTCCTCCATCTTTCTGG + Intergenic
930722779 2:54653916-54653938 TCAAGGCTCCTGCTTCTCTCTGG - Intronic
931625090 2:64250228-64250250 ATCAGGCTCCTTCCTACCACAGG - Intergenic
932025745 2:68130765-68130787 GCCAGCCTCCAGCCTCTCTCGGG - Exonic
932266206 2:70369026-70369048 ACCCGGATCCTGTCTCTGACAGG + Intergenic
932719647 2:74129744-74129766 AACAGACTCCTGCCTCTCTCTGG - Intergenic
932834662 2:75025175-75025197 GGGAGGCACCTGCCTCTCACAGG - Intergenic
934936793 2:98471548-98471570 GCCATGCTGCTGCTTCTCACAGG + Intronic
935127849 2:100239846-100239868 GCCAGGCTCCTTTCTCCCACAGG + Intergenic
936858945 2:116993075-116993097 ACCAGGTTCTTGCCATTCACTGG - Intergenic
937315874 2:120931858-120931880 ACCATGCTGCTGCCCATCACTGG - Intronic
937813292 2:126222393-126222415 ACCAGGCAGCTGTTTCTCACTGG + Intergenic
938110281 2:128559741-128559763 GCAAGGCTCCTGCCTGTCTCAGG - Intergenic
939001962 2:136747027-136747049 ACCAGCCTCCTGGCCTTCACGGG - Intergenic
939219415 2:139282114-139282136 ACCAGGCTCCAGGCTCATACTGG - Intergenic
940064537 2:149612371-149612393 ACCTGGCTCCTTCTTCTCCCAGG - Intergenic
940104906 2:150088813-150088835 CCCATGCTCCTGCTTCTCAAAGG - Intergenic
940802280 2:158145799-158145821 ACCAGGCTCCTGGCTGGTACTGG - Intergenic
946905383 2:224411022-224411044 ACCAGGCTCCCACCTGCCACAGG - Intergenic
947461084 2:230305789-230305811 GCCAGGTTCCCGCCCCTCACAGG + Intronic
947544748 2:231002877-231002899 ACCAAGCCCCGGCCTCTCAAGGG + Intronic
948367831 2:237469963-237469985 AGCAGGTTCCTGCCTTTCACAGG + Intergenic
948761871 2:240197340-240197362 ACCAGACTCCTGCTGCCCACAGG + Intergenic
948982424 2:241501178-241501200 ACCAGCCACCTGCTCCTCACAGG + Intronic
948990451 2:241551350-241551372 CCCAGGCCCCGGCCTCTCTCTGG - Intergenic
1169204059 20:3730329-3730351 ACCAGCTTCCTGCATCTCCCTGG - Intergenic
1169251017 20:4061118-4061140 ATCAGTTTCCTTCCTCTCACAGG - Intergenic
1171186518 20:23127472-23127494 CCCAGGCTCATGGCTCCCACTGG - Intergenic
1171517702 20:25750844-25750866 ACCTGGGTCAGGCCTCTCACAGG - Intergenic
1172792184 20:37513376-37513398 GCCAGCCTCCTGCCCCACACTGG - Intronic
1174196286 20:48774990-48775012 AGCAGGTTCCTGTCTCCCACTGG - Intronic
1174801865 20:53570846-53570868 ACCAGGCTCCTGCCTCTCACAGG + Intronic
1175408444 20:58750633-58750655 CCCTGGGTCCTGCCTTTCACTGG - Intergenic
1179920741 21:44505934-44505956 ACCAAGCTCCTGCCTCCAGCAGG - Intronic
1180109270 21:45640475-45640497 CCCAGGCTCCTGCCCTGCACAGG - Intergenic
1180138499 21:45876569-45876591 TTCATGCTCCTGCCTGTCACAGG - Intronic
1180163600 21:46009042-46009064 AGCAGGCTCCTGCCTCTTCCTGG + Intergenic
1180599649 22:17007772-17007794 ACCTGGACCCTGTCTCTCACTGG + Intronic
1180914189 22:19473923-19473945 CCCAGTCTCCTGCCTCACACAGG + Intronic
1182675412 22:32035504-32035526 ACCAGGCTCCTGAAGCTCTCTGG - Intergenic
1183082894 22:35468133-35468155 ACCAGTGTCCTGCCTGACACTGG + Intergenic
1183571317 22:38655829-38655851 CCCTGGGTCCTGCCCCTCACTGG + Intronic
1183958738 22:41398122-41398144 ACCAGGCTCCTGACTCAGAGGGG - Exonic
1184191088 22:42895001-42895023 ACCAGGATTCTGGTTCTCACAGG - Intronic
1184386806 22:44181391-44181413 GCCAGGCCCCTTCCTCTCCCGGG - Intronic
1184938113 22:47739871-47739893 CCCAGCCTCCTGCCCCACACTGG - Intergenic
1185234646 22:49704879-49704901 AGCAGGCACCTCCCTCTCCCAGG - Intergenic
949491107 3:4589880-4589902 ACCAGGCCCCTGCCTGCCTCTGG + Intronic
950111595 3:10422151-10422173 CCCTGGCTCCTGCCTCTCTGGGG + Intronic
950475767 3:13214030-13214052 ACCCGGCTCCTTCCTCTGATAGG + Intergenic
950493048 3:13317857-13317879 AGCAGGCGCCTGCCTCACCCAGG + Intronic
952252848 3:31671396-31671418 ACCAGGCTCCTTCCTACCCCAGG - Intronic
955065796 3:55532901-55532923 ACAAGGTCCCTGGCTCTCACAGG + Intronic
956045269 3:65189527-65189549 ACCACCCTCCTTGCTCTCACTGG + Intergenic
956304123 3:67805340-67805362 ACCAGACTGCTGCCTCTCTCAGG - Intergenic
956414695 3:69013651-69013673 AACCGGCTACTGCCGCTCACCGG + Exonic
956481238 3:69675796-69675818 TCCAGGCTCCAGCCCCTCCCAGG - Intergenic
959496391 3:107057450-107057472 ACCATGCTCTTCCCTCTCCCTGG - Intergenic
959578177 3:107957405-107957427 GCCAGCCGCCTCCCTCTCACTGG + Intergenic
960223988 3:115147997-115148019 TCCAGACACCTGCCTCTCACTGG - Intergenic
961416854 3:126765546-126765568 ACCTGGATCCTGCGTCGCACAGG - Intronic
962344543 3:134609767-134609789 ACCAGGCTCCTTCTCCTCTCAGG - Intronic
962437807 3:135382808-135382830 TCCCTGCTCCTGCCTCTCAGAGG + Intergenic
963839615 3:150092097-150092119 ACCAGACTCCTGTCTCTCCTGGG - Intergenic
967292632 3:187936121-187936143 AGCAGGCTCCAGCCCCTTACTGG + Intergenic
968231768 3:197008716-197008738 ACCAGGCACCTGCCACACAGAGG + Exonic
968369632 3:198215118-198215140 ACCAAGCTCATGACTCTCAATGG + Intergenic
969244367 4:5922892-5922914 TCTAGGCTCCTGCCTTTCAAAGG - Intronic
970996160 4:22269313-22269335 ACCAGGCTCCAGGCTCGTACTGG - Intergenic
973774319 4:54230986-54231008 CCCAGGCTCCTGGCTCCCTCTGG - Intronic
976069148 4:81221417-81221439 TCCTGGCTCCTGTCTCTCAGTGG - Intergenic
978446736 4:108787474-108787496 ACCTGGATCCTGCCTCTCACGGG - Intergenic
978655432 4:111060474-111060496 ACCATGCTCCTGCCTCAGCCTGG + Intergenic
979259608 4:118634680-118634702 CCCGGCCTCCTGCCTCTCAAAGG + Intergenic
979822473 4:125191765-125191787 AGCACGCTGTTGCCTCTCACTGG - Intergenic
980136554 4:128863611-128863633 TCCAGGATCCTGCCTCTTCCAGG - Intronic
985778013 5:1855293-1855315 CTCTGGCTCCTGCCTCTCCCTGG - Intergenic
985894077 5:2738886-2738908 ACCTCGCTCCTTCCTCTCCCCGG - Intergenic
986669626 5:10131505-10131527 TCCTGGCTCCTGCTTCTCAGAGG - Intergenic
989694445 5:44183441-44183463 ACCAGGCTCCAGGCTGACACTGG + Intergenic
991569060 5:68035458-68035480 ACCAGTTTCTTGCCTCTCATAGG - Intergenic
992393009 5:76346802-76346824 ATCTGGCCCCTGCCTCCCACTGG + Intronic
994421987 5:99534116-99534138 TCCAGGGTCCTGGCTCTCAGAGG + Intergenic
994460856 5:100066468-100066490 TCCAGGGTCCTGGCTCTCAGAGG - Intergenic
994485003 5:100379893-100379915 TCCAGGGTCCTGGCTCTCAGAGG - Intergenic
995390529 5:111635788-111635810 GACAGGCTGCTGTCTCTCACTGG - Intergenic
999459815 5:151748305-151748327 AGGAGGGTCCTGCTTCTCACAGG + Intronic
1000409764 5:160925930-160925952 ACCAGGCATCTGCTTTTCACAGG - Intergenic
1001955430 5:175845421-175845443 ACCAGGCTCTTTCCTGCCACAGG + Intronic
1002319090 5:178364489-178364511 AACAAGCTCCTGCATCTCAGGGG - Intronic
1003860467 6:10318024-10318046 ACCACGATCCCTCCTCTCACAGG - Intergenic
1004583762 6:16979557-16979579 ACCATGCTCCTGCTTGCCACAGG + Intergenic
1005917678 6:30367815-30367837 TCCAGTTTTCTGCCTCTCACTGG + Intergenic
1006012844 6:31056818-31056840 ACCAGGCTCCTGACACCCATGGG + Intergenic
1006027459 6:31156742-31156764 CCCTGGCTCCTGCCTGTCACTGG + Exonic
1006902490 6:37512145-37512167 GGCAGGCTCCTGCCTTTCTCGGG - Intergenic
1007492284 6:42232785-42232807 ACCAGGCTTCTGCTTCCCAGAGG + Exonic
1008885824 6:56430975-56430997 ACCTGCATCCTGCCTCGCACTGG - Intergenic
1009995780 6:70893795-70893817 ACCTGGCTCCTGCCTTCCAGGGG - Intronic
1012868175 6:104642750-104642772 ACCTGGATCCTCCTTCTCACAGG + Intergenic
1013636511 6:112034035-112034057 GTCAGTCTCCTGCCTCTCAGAGG - Intergenic
1014248595 6:119093718-119093740 ACCAGTCTCCTGCCTCTTGCTGG - Intronic
1019217366 6:170452427-170452449 ACCGGGCTCCTGCCCATCCCAGG - Intergenic
1019515180 7:1436722-1436744 CCCCGGCACCTGCCCCTCACCGG + Exonic
1019709391 7:2511389-2511411 TCCAGCCTCCTGCCTCACTCTGG + Intergenic
1020128732 7:5547696-5547718 ACCAAACTCCTGCCTGCCACAGG + Intronic
1022417557 7:30191036-30191058 CCCACGCTCCTCCCTCTCCCTGG - Intergenic
1023395459 7:39747719-39747741 TCAAGGCTCCTGACTTTCACAGG + Intergenic
1024241297 7:47438587-47438609 CTCAGGCTCCTGCCTCTTTCTGG - Intronic
1024373940 7:48617462-48617484 ACCAGCCTCCTGCCTCTCCACGG - Intronic
1025175744 7:56801405-56801427 ACCCAGCTCTTGCCTCACACTGG - Intergenic
1025175887 7:56802285-56802307 ACCCAGCTCCTGCCTCCCAGTGG - Intergenic
1025258830 7:57403863-57403885 ACCTGGGTCAGGCCTCTCACAGG - Intergenic
1025695906 7:63774137-63774159 ACCCAGCTCCTGCCTCCCAGTGG + Intergenic
1025696050 7:63775017-63775039 ACCCAGCTCTTGCCTCACACTGG + Intergenic
1025731833 7:64114537-64114559 TCCAGGGTCCTGGCTCTCAGAGG + Intronic
1025912495 7:65839784-65839806 GCCCAGCTCCTGCCTCACACTGG + Intergenic
1025912695 7:65840780-65840802 GCCCAGCTCCTGCCTCACACTGG + Intergenic
1025928044 7:65974755-65974777 TCCAGGGTCCTGGCTCTCAGAGG - Intronic
1025958689 7:66202277-66202299 AGCAGGGTCCAGCCTCTGACAGG - Intergenic
1025976737 7:66376576-66376598 GCCCGGCTCCTGCCTCACGCTGG - Intronic
1025976912 7:66377195-66377217 ACCCGGCTCCTGCCTGCCAGCGG - Intronic
1025977069 7:66377918-66377940 GTCAAGCTCCTGCCTCACACTGG - Intronic
1026045343 7:66902751-66902773 GCCAGGCTCCTGCCTTTCGGCGG + Intergenic
1026045442 7:66903168-66903190 GCCCGGCGCCTGCCTCACACTGG + Intergenic
1026045724 7:66904273-66904295 GCCCGGCTCCTGCCTCACGCGGG + Intergenic
1027202760 7:76073635-76073657 GCCAGGCTCCTGCCTTTCGGTGG - Intergenic
1027202780 7:76073700-76073722 GCCCGGCTCCTGCCTCCCATCGG - Intergenic
1029226744 7:99034102-99034124 AGCTGGCTCCTCCCCCTCACAGG + Intronic
1029382198 7:100221542-100221564 ACCTGGCTTCTGCCTCCCAGGGG - Intronic
1029402355 7:100353992-100354014 ACCTGGCTTCTGCCTCCCAGGGG - Intronic
1029458455 7:100682635-100682657 ACCAGGCTCCCGCCGCTCTTGGG + Exonic
1029520870 7:101061399-101061421 ACCTGCCTCCTGCCTCCCATAGG + Intergenic
1029578645 7:101420532-101420554 ACCAGGCATGTCCCTCTCACTGG + Intronic
1030263804 7:107594909-107594931 ATTAGGCTCCTGCCTCTCTTTGG + Intronic
1031696869 7:124867476-124867498 ACCATGCTCATTCCTATCACAGG + Intronic
1032051832 7:128654671-128654693 CCCGGCCTCCTGCCTCTCAAAGG + Intergenic
1034445851 7:151113963-151113985 TCCAGGCCCCTGCTGCTCACTGG - Intronic
1034534713 7:151719635-151719657 TCCTGGCACCTGCCTCTCAAGGG + Intronic
1034637001 7:152575503-152575525 CCCAGACTCCAGCCTCTTACAGG + Intergenic
1034705420 7:153139110-153139132 ACCAGGCTCCAGGCTCGTACTGG + Intergenic
1035673625 8:1439204-1439226 ACCATGCTCCTGCCTCTGGAGGG - Intergenic
1036128302 8:6084077-6084099 CTTAGGCTCCTGCCCCTCACTGG - Intergenic
1036286737 8:7449308-7449330 ACCAGGCTCCAGCCCCCCAGTGG + Intronic
1036334741 8:7862215-7862237 ACCAGGCTCCAGCCCCCCAGTGG - Intronic
1036661757 8:10713856-10713878 ACCGAGCCCCTGCCTCCCACAGG + Intergenic
1041516001 8:58699677-58699699 ACCAGGCTCCTTCCTGCCTCAGG - Intergenic
1042489439 8:69381148-69381170 ACCAGGCTCCGCCCTATCTCAGG - Intergenic
1044827040 8:96208608-96208630 ACCAAGCTCATTCCTCCCACGGG + Intergenic
1044840210 8:96330844-96330866 ACAAGGTTCTTTCCTCTCACAGG - Intronic
1045406983 8:101876423-101876445 AGCAAGTTCCTGCATCTCACGGG + Intronic
1046310811 8:112434661-112434683 ACAAAGCTCCTACCTCGCACAGG + Intronic
1047336899 8:123944762-123944784 ACCAGCCTCCTTTCCCTCACAGG + Intronic
1047953312 8:129953623-129953645 GCCAGGCTCCGTGCTCTCACTGG - Intronic
1047957044 8:129984176-129984198 AACAGTCCCCTGCCTCTCTCTGG + Intronic
1049302163 8:141877309-141877331 GCCTGGCTCCTGCCCCCCACGGG + Intergenic
1049744437 8:144257279-144257301 CCCAGGCTCCTCTCTCTCACGGG - Intronic
1051884054 9:21871324-21871346 ACCAGGCTCCTCCTTGTCTCTGG + Intronic
1053247716 9:36548612-36548634 ACCAGGCTCCTGGCTAATACTGG - Intergenic
1056132921 9:83603102-83603124 AACATGCTCCTCCCTCTCTCTGG + Intergenic
1057466228 9:95317199-95317221 ACCCGGCTCCCGCCTCTCCGGGG + Intronic
1057475788 9:95399830-95399852 ACCAGGCTCCTGGCTGGTACAGG - Intergenic
1058671082 9:107360874-107360896 GCCATGATTCTGCCTCTCACAGG + Intergenic
1059426340 9:114223145-114223167 CCCAGGCTCTGACCTCTCACTGG - Intronic
1059995576 9:119905305-119905327 ACTAGTCTCCAGCCTCTAACTGG - Intergenic
1060038988 9:120283572-120283594 GCCAGGCACCTGCATCTCCCAGG - Intergenic
1061971216 9:134046441-134046463 ACCCGGCCCCTCCATCTCACTGG - Intronic
1203576491 Un_KI270745v1:12581-12603 ACCAAGCTCATGACTCTCAATGG + Intergenic
1203576888 Un_KI270745v1:15990-16012 ACCAAGCTCATGACTCTCAATGG + Intergenic
1192713766 X:73618076-73618098 ACCAGGCTCCTGGCTGGTACTGG + Intronic