ID: 1174802962

View in Genome Browser
Species Human (GRCh38)
Location 20:53580577-53580599
Sequence TAATATTCCTGAGCCCTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 148}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174802962 Original CRISPR TAATATTCCTGAGCCCTGGT GGG (reversed) Intronic
904559786 1:31388704-31388726 TAATGGCCCTGTGCCCTGGTGGG - Intergenic
905361272 1:37422596-37422618 TAATTTTCCTGAGGCCTCCTCGG - Intergenic
906523492 1:46480460-46480482 TTCTTATCCTGAGCCCTGGTTGG - Intergenic
908361031 1:63368298-63368320 TAATTTTACTGAGCCCTGTGTGG - Intronic
909650920 1:77975110-77975132 TAATATTTCTGATCCATGGTTGG + Intronic
916674666 1:167055242-167055264 GAATATTCCTGGGCCATGGCTGG - Intronic
917678074 1:177339215-177339237 TAAAAATCTTGAGCCCGGGTGGG + Intergenic
921077114 1:211708651-211708673 TAAAATTCCTGTTCCCTGGAAGG - Intergenic
921184412 1:212657335-212657357 GACTATTCCTGAGACCTGGAGGG + Intergenic
923070236 1:230557788-230557810 AAATATTTTTGATCCCTGGTTGG + Intergenic
924026763 1:239841683-239841705 TATTACTCCTGACCCCAGGTGGG - Intronic
924474590 1:244371909-244371931 TAATATGACTGAGCCCTGGATGG - Intronic
924937224 1:248782344-248782366 TAAAATTCCTGAGACCTGACAGG + Intergenic
1066252203 10:33645412-33645434 CAATATTTTTGATCCCTGGTTGG + Intergenic
1071996962 10:91158979-91159001 TAAGATTGCTGAGGACTGGTGGG + Intergenic
1074693638 10:116028884-116028906 GAAAATTCCAGAGGCCTGGTGGG - Intergenic
1075617449 10:123901852-123901874 CAATATAACTGAGCCCTGATTGG - Intronic
1075914304 10:126154200-126154222 TGTTATTCCTGAGCACTGGCTGG - Intronic
1077859087 11:6159248-6159270 TAAAATTCCTGTTCCCTGGAAGG + Intergenic
1078765184 11:14289786-14289808 TGATATCCCTGAACCCTGGTGGG + Intronic
1078777096 11:14403666-14403688 TAATATTCCAGAGCTTTGGGAGG - Intergenic
1082231313 11:49770601-49770623 CAATATTCAGTAGCCCTGGTTGG + Intergenic
1083493200 11:63028162-63028184 GGACATTCCTGAGCCCTGCTTGG + Intergenic
1085831846 11:79909841-79909863 TAACATTCCTGAGACCATGTAGG - Intergenic
1089073595 11:115719416-115719438 GAATATTCCTGAGCCAGGGAGGG - Intergenic
1091869867 12:3880380-3880402 CAATATTTCTGATCCATGGTTGG - Intergenic
1097254229 12:57660081-57660103 TAAAATTCCTGTTCCCTGGAAGG - Intergenic
1097506949 12:60485447-60485469 TACAGTTGCTGAGCCCTGGTGGG - Intergenic
1100125080 12:91414980-91415002 CAAAGTTCCTGAACCCTGGTAGG - Intergenic
1100440387 12:94611821-94611843 AAATATTTTTGACCCCTGGTTGG + Intronic
1105548527 13:21369979-21370001 GAATATTTTTGAGCCATGGTTGG - Intergenic
1105960385 13:25329728-25329750 TAATGTTCCTGAGGCCTGGCTGG - Intronic
1108220211 13:48225949-48225971 AAATATTTTTGACCCCTGGTTGG + Intergenic
1108409563 13:50133053-50133075 GAATATTCCTGAGTCCTGAGCGG + Intronic
1109853337 13:68097998-68098020 TAATATTTCTGAACCATGGTTGG + Intergenic
1112563408 13:100533026-100533048 TAATGTTCCTCAGCCCTGCAGGG + Intronic
1115049334 14:29037744-29037766 TAAGATTTCTGGGCCCTGTTGGG + Intergenic
1116678781 14:47939524-47939546 TAAAATTCCTGTTCCCTGGAAGG - Intergenic
1120728114 14:87969201-87969223 AAATATCCCTGACCCCAGGTGGG - Intronic
1125431021 15:39593555-39593577 GAGTATCCCTGAGCCCTCGTGGG - Exonic
1125739136 15:41949559-41949581 TAAAATGACTGAGCCCTGGAAGG + Intronic
1126675904 15:51159119-51159141 TACTATGCCTGAGCCCGGGAGGG + Intergenic
1131099114 15:89674085-89674107 TAATATTACTGTGCCATGTTTGG - Intronic
1132428096 15:101737587-101737609 TAATTTTCTTCAGCACTGGTAGG + Intronic
1135520593 16:23174325-23174347 TAATATTCCTAAGCACAGGAAGG + Intergenic
1137712505 16:50576061-50576083 GAATATTCTTGAGCCCAGGTAGG - Intronic
1145114592 17:20197607-20197629 TAAAATTCCTGTTCCCTGGAAGG + Intronic
1148845684 17:50528572-50528594 CAATAGCCTTGAGCCCTGGTAGG - Intronic
1150170810 17:62991976-62991998 TAATATTTTTGATCCATGGTTGG - Intergenic
1151789306 17:76294007-76294029 AAGTGTTTCTGAGCCCTGGTTGG + Exonic
1152892551 17:82890749-82890771 TCAGAGCCCTGAGCCCTGGTCGG + Intronic
1153954377 18:10083630-10083652 TAATACAACTGAGCCCTGATTGG + Intergenic
1154097198 18:11429661-11429683 TAAAGTTCCTCAGCCCTCGTGGG + Intergenic
1154365302 18:13702559-13702581 TAAAATTCCTGTTCCCTGGAAGG - Intronic
1157479926 18:48047187-48047209 TAAGATTCCCATGCCCTGGTGGG + Intronic
1158240462 18:55371571-55371593 TAAAGTTCCTGGTCCCTGGTTGG - Intronic
1165951006 19:39473955-39473977 TATTCTTCCTCAGCCCTGTTGGG - Exonic
925795051 2:7532186-7532208 TAAGATTCCTGAGGCCTCCTCGG - Intergenic
926521739 2:13923907-13923929 TAAAATTCCTGTTCCCTGGAAGG - Intergenic
927274045 2:21246426-21246448 AAATATGCTTGAGCCATGGTTGG - Intergenic
929272972 2:39994013-39994035 TAATAATCCTGATCCCATGTAGG + Intergenic
932299300 2:70654594-70654616 TAATTTTCTTGGACCCTGGTTGG - Intronic
932965849 2:76473768-76473790 TAAAATTCCTGTTCCCTGGAAGG - Intergenic
935097772 2:99962023-99962045 TCATGTTTCTGAGGCCTGGTAGG - Intronic
937327423 2:120999483-120999505 TAATATTCCTCAGCCTTAGTGGG + Intergenic
937580245 2:123476585-123476607 TATTATACCTGAGTCCTGTTGGG - Intergenic
939583338 2:143977544-143977566 AGAGATTCCTGAGCCATGGTAGG + Intronic
941822680 2:169858191-169858213 TAATCTTCCAGAGGCTTGGTTGG + Intronic
942881204 2:180863210-180863232 GAACATTCCTGAACCATGGTAGG + Intergenic
943650338 2:190451056-190451078 TCATCATCCTAAGCCCTGGTAGG + Intronic
944157981 2:196628145-196628167 TAATATTTTTGATCCATGGTTGG - Intergenic
944515930 2:200511546-200511568 TAGTATGTCTGAGCCTTGGTGGG + Intronic
944994906 2:205282937-205282959 CAATACAGCTGAGCCCTGGTTGG + Intronic
945278935 2:208017126-208017148 TAATATTTTTGATCCATGGTTGG + Intronic
945811745 2:214557480-214557502 CAATATTGCTGAGCTCTGATGGG + Intronic
945852228 2:215022782-215022804 CAATATTCCTGAGCTCTTGGTGG + Intronic
947893246 2:233644691-233644713 GAGAATCCCTGAGCCCTGGTGGG - Intronic
948552817 2:238785868-238785890 TGCTCTTCCTGAGTCCTGGTTGG - Intergenic
948816184 2:240511486-240511508 TTATCTTCCAGAGCCCTGGGCGG - Intronic
1171502925 20:25608132-25608154 GAATATTCCTGGCCCGTGGTAGG - Intergenic
1173702137 20:45082023-45082045 TAATATTTTTGATCCATGGTTGG - Intergenic
1174802962 20:53580577-53580599 TAATATTCCTGAGCCCTGGTGGG - Intronic
1174830940 20:53811790-53811812 TGAAATGCCTGAGGCCTGGTAGG + Intergenic
1175655154 20:60763598-60763620 TAATATTGCTCTGCCCTGCTGGG + Intergenic
1175862041 20:62155730-62155752 TAACATTCCTGAGCCTTGTGGGG + Intronic
1178633616 21:34283409-34283431 TATTACTCTTGAGCTCTGGTTGG - Intergenic
1179428569 21:41303164-41303186 TAATACAACTGAGCCCTGATTGG - Intergenic
1180726902 22:17953053-17953075 TTATGCTCCTGAGCCCTGCTGGG - Intronic
1181520624 22:23447577-23447599 AAATATTCGTGAGCTCTGTTCGG + Intergenic
1182188216 22:28430014-28430036 TCATATTCCAGAGCCCTTGTTGG - Intronic
1184091811 22:42296760-42296782 TTACATCCCTGAGCCCTGCTTGG - Intronic
1184915678 22:47567354-47567376 GGATCTTCCTGAGCCCTGGCAGG - Intergenic
956498449 3:69854553-69854575 TAATATTATTGATCCATGGTTGG + Intronic
957454656 3:80425649-80425671 TCCTATTCCTGGGCTCTGGTAGG + Intergenic
957803215 3:85113392-85113414 TAAAATGCCTGAGACCTAGTAGG + Intronic
963377109 3:144481691-144481713 TAATGCTCCTGACACCTGGTAGG + Intergenic
963840263 3:150097517-150097539 TTATCTTCCTGTGCCCTGGCTGG - Intergenic
965149573 3:164952409-164952431 TAAAATTCCTGTTCCCTGGAAGG - Intergenic
965585885 3:170318043-170318065 TAAAATTCCTGTTCCCTGGAAGG + Intergenic
967322671 3:188210051-188210073 TAATATTTTCGAGCCTTGGTTGG - Intronic
967768082 3:193304391-193304413 TAAAATTCCACACCCCTGGTTGG - Intronic
967905880 3:194499588-194499610 AAATATTTTTGATCCCTGGTTGG - Intergenic
971831413 4:31701111-31701133 TAATATACCTGAGACGTAGTTGG + Intergenic
973814183 4:54603771-54603793 TAAAATTCCTGTTCCCTGGAAGG + Intergenic
976358560 4:84150078-84150100 TGATATTACTGAGGCCTGATGGG - Intergenic
976402091 4:84618837-84618859 TAATCTTCCTGAGGACAGGTGGG + Intronic
979847671 4:125536502-125536524 TAATATTTCTGATCTATGGTTGG - Intergenic
982850594 4:160310377-160310399 GAATATTTTTGACCCCTGGTTGG - Intergenic
983687119 4:170423575-170423597 AAATTTCCCTGAGCCCTGGGAGG - Intergenic
986257044 5:6109301-6109323 GAATATTCCTGAACCCCGGCAGG - Intergenic
992166651 5:74058982-74059004 TTACATTCCTCAGCCCTGGCAGG - Intergenic
994562599 5:101395221-101395243 TAAAATTCCTGTTCCCTGGAAGG - Intergenic
995310435 5:110704398-110704420 TAAGATTCCTGAGCCCTTCAAGG + Intronic
996877509 5:128255343-128255365 CAATATAGCTGAGCCCTGATTGG - Intergenic
999667790 5:153932069-153932091 TAATATTCCTGGGGCCTAGGTGG - Intergenic
1000054882 5:157596683-157596705 GACTATTCCTGAGCAGTGGTTGG - Intergenic
1003026519 6:2559755-2559777 CAGTATTTCTGGGCCCTGGTGGG + Intergenic
1005326015 6:24701554-24701576 TAATTTTCCTGTGGCCTTGTTGG - Exonic
1005898500 6:30197845-30197867 GAATATTTCTGATCCATGGTTGG + Intronic
1006259611 6:32856902-32856924 AAAAATTCCTGAGTTCTGGTTGG + Intronic
1007401132 6:41603031-41603053 TAGCATTGCTGAGCCCTGTTGGG + Intergenic
1008496552 6:52139744-52139766 TAATATCCCTGTTCCCTGGTAGG - Intergenic
1011061894 6:83279021-83279043 TATTATACCAGAGCCCTGTTGGG - Intronic
1012669249 6:102019698-102019720 CAATATTCCTTTGCCTTGGTTGG - Intronic
1018185898 6:161265053-161265075 TAATACTAGTGAGACCTGGTTGG + Intronic
1018350283 6:162951340-162951362 CAATATAGCTGAGCCCTGATTGG + Intronic
1019590618 7:1828670-1828692 AAATATTCGTGAGCTCTGTTCGG - Intronic
1020181391 7:5925147-5925169 CAAAACTCCTGAGGCCTGGTAGG + Intronic
1020301542 7:6799743-6799765 CAAAACTCCTGAGGCCTGGTAGG - Intronic
1023970373 7:44986520-44986542 GACCATTCCTGAGCCCAGGTAGG - Intergenic
1025768832 7:64484224-64484246 TAAAATTCCTGTTCCCTGGAAGG - Intergenic
1026568120 7:71506556-71506578 TAATATTCCTAAGTCCAGGTAGG - Intronic
1027960839 7:84942899-84942921 TAAAATTCCTGTTCCCTGGAAGG - Intergenic
1033763810 7:144465469-144465491 TAAAATTCCTGTTCCCTGGAAGG - Intronic
1034936464 7:155203607-155203629 GAATTTTCCAGAGCCCTGGGAGG + Intergenic
1035994791 8:4533433-4533455 TAATCTACGTGAGCCCTGATGGG + Intronic
1036677185 8:10844216-10844238 TATTATACCTGAGCCATGGTGGG - Intergenic
1037350753 8:17952513-17952535 AAATATTCCTGATCCATGGTTGG - Intronic
1039092903 8:33851596-33851618 CAATATAGCTGAGCCCTGGTTGG - Intergenic
1041103547 8:54419850-54419872 TAATGTTTTTGAGCCCTGATTGG - Intergenic
1041643178 8:60224919-60224941 TAAAATGCCTGAACCCTGGATGG + Intronic
1044032863 8:87260221-87260243 TAAAATTCCTGTACCCTGGAAGG + Intronic
1044373111 8:91437144-91437166 TAAAATTTCTGAGCTCTGTTTGG - Intergenic
1044415129 8:91929771-91929793 TAATATTGCTTAGTCCTGGTTGG + Intergenic
1044717455 8:95113489-95113511 TACAATTCCTGACCCCTGGAAGG - Intronic
1047806674 8:128368129-128368151 TAATATTTTTGATCCATGGTTGG - Intergenic
1048228035 8:132609401-132609423 GAATATTTTTGATCCCTGGTTGG + Intronic
1049450039 8:142655684-142655706 TAATCTTCCTGACACCTGGCTGG - Intergenic
1049555441 8:143279176-143279198 TGATATTCCTGAGCCCTCCCGGG + Intergenic
1051264048 9:15294275-15294297 AAGCATTCCTGAGCCCTGGAGGG - Intronic
1052521129 9:29549366-29549388 TAAAATTCCTGTTCCCTGGAAGG - Intergenic
1056173019 9:84006512-84006534 GAATATTTCTGATCCATGGTTGG + Intergenic
1060151414 9:121291030-121291052 TAATATTTCTGATCTGTGGTTGG - Intronic
1060681534 9:125569208-125569230 TAAAATTCCTGTTCCCTGGAAGG - Intronic
1060870162 9:127033534-127033556 TAGTAATACTGAGGCCTGGTAGG + Intronic
1186317777 X:8389126-8389148 TTAGAGTCATGAGCCCTGGTGGG + Intergenic
1189153179 X:38728542-38728564 TAATATTGCTGATCCTTGTTTGG + Intergenic
1192631584 X:72781748-72781770 GCATCTTCCTGAGCCCTGTTAGG - Intronic
1192650125 X:72939053-72939075 GCATCTTCCTGAGCCCTGTTAGG + Intronic
1195950863 X:110271179-110271201 TTATTTTCCTGAGCCCTGTGGGG - Intronic
1199670925 X:150147609-150147631 GAATATTCCTGTGCTCAGGTGGG - Intergenic
1199986654 X:152957540-152957562 TAAAATTCCTGTTCCCTGGAAGG + Intronic
1201624587 Y:16000751-16000773 TCACATTCCTGAGACCTGCTGGG + Intergenic