ID: 1174806245

View in Genome Browser
Species Human (GRCh38)
Location 20:53606715-53606737
Sequence GCTCAGCCCTGACCTGCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 266}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174806245_1174806249 -2 Left 1174806245 20:53606715-53606737 CCCACAGCAGGTCAGGGCTGAGC 0: 1
1: 0
2: 2
3: 27
4: 266
Right 1174806249 20:53606736-53606758 GCTCTTGAAAATGGCTCTCTGGG 0: 1
1: 0
2: 0
3: 12
4: 168
1174806245_1174806248 -3 Left 1174806245 20:53606715-53606737 CCCACAGCAGGTCAGGGCTGAGC 0: 1
1: 0
2: 2
3: 27
4: 266
Right 1174806248 20:53606735-53606757 AGCTCTTGAAAATGGCTCTCTGG 0: 1
1: 0
2: 2
3: 12
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174806245 Original CRISPR GCTCAGCCCTGACCTGCTGT GGG (reversed) Intronic
900242795 1:1624953-1624975 GCTCAGCCTTAGCCTGCTGGGGG + Intronic
900576545 1:3385403-3385425 GCCAAGCCCTGGCCTGCAGTGGG + Intronic
900975690 1:6014883-6014905 CCACAGCCCTGCCCTTCTGTGGG - Intronic
901396637 1:8986785-8986807 GCCCAACCCTGACCTGCAGGAGG - Intergenic
902963938 1:19984601-19984623 GCTCAGGCATGGCCGGCTGTAGG + Intergenic
903274143 1:22210162-22210184 GTTTAGCCCGGCCCTGCTGTGGG + Intergenic
904035060 1:27554507-27554529 GCTCTGCCCTGACCAGCTCAGGG - Intronic
904411575 1:30328152-30328174 GCTCAGCCCTGACAGGCCTTGGG + Intergenic
906694711 1:47816230-47816252 GAGCAGCCCTGACCTGAGGTAGG + Intronic
906932334 1:50182093-50182115 TCCCAGGCCTGACCTTCTGTTGG + Intronic
907382409 1:54102178-54102200 GCTGAGCCCTTTCCTGCTCTGGG - Intronic
908804861 1:67919689-67919711 AAGCAGCCATGACCTGCTGTGGG - Intergenic
909525670 1:76619905-76619927 GCTCAGCTCTTACCTCCTGTTGG + Intronic
912066874 1:105755740-105755762 GCTCAGGCCTGACTTACAGTTGG + Intergenic
912301856 1:108526083-108526105 GCTCAGCCCTGGGCTTCTGTGGG - Intergenic
912332028 1:108828594-108828616 GCTGTGCCCTGGCCTGCTGTTGG + Intronic
913280583 1:117181555-117181577 GCTCAGCTCTGACCTGCCTCAGG + Intronic
913963819 1:143358489-143358511 ACTCAGCTCTGCCCTGGTGTTGG + Intergenic
914058181 1:144184093-144184115 ACTCAGCTCTGCCCTGGTGTTGG + Intergenic
914120965 1:144782278-144782300 ACTCAGCTCTGCCCTGGTGTTGG - Intergenic
914701078 1:150134521-150134543 GGTTAGCACTTACCTGCTGTAGG - Intronic
915473704 1:156140242-156140264 GCCCAGCCCTGCCCTGCTCCAGG + Intergenic
916856602 1:168756597-168756619 GCTCAGTCTTGACATTCTGTAGG - Intergenic
919826262 1:201505724-201505746 CCTCAGCCCTCAGCTGCTGGAGG - Intronic
920032383 1:203045254-203045276 GCAGAGCCTTGACCTGCTCTGGG + Intronic
920366312 1:205450022-205450044 GCTCAGCCCTGGCCGGTGGTGGG - Intronic
920456464 1:206105232-206105254 GAACAGACCTGACCTGCTGCAGG + Intergenic
920527078 1:206675108-206675130 GCTCAGCCTTGGCCTGCTTGGGG + Intronic
921985261 1:221305759-221305781 GGTCAGCCTTGACCAGATGTGGG + Intergenic
923205136 1:231752022-231752044 CCTCAGCACTCACCTGCTGGTGG - Intronic
923384883 1:233455877-233455899 GGTCAGCCCTGAGCTTCTCTGGG + Intergenic
1062949519 10:1487491-1487513 GCCCTGCCCTGACCTGCTCCCGG + Intronic
1063698800 10:8364577-8364599 GCTCAGGCCTGGGCTGCTGAAGG - Intergenic
1064602600 10:17008687-17008709 GATCATCCCTGACCTCCTGCTGG + Intronic
1064971634 10:21072635-21072657 ACTGAGCCCTGAGCTGCTGGTGG - Intronic
1065684256 10:28268179-28268201 GCTCAGCCCTGAATCACTGTGGG + Intronic
1067044156 10:42975081-42975103 GCACAGGCCTGGCCTCCTGTGGG - Intergenic
1067155133 10:43775236-43775258 CCTCCGCACTGCCCTGCTGTAGG - Intergenic
1069558835 10:69415470-69415492 GCTCAGCCCTGAGCAGCGTTGGG + Intronic
1070648869 10:78220679-78220701 CCCCCGCCCTGGCCTGCTGTGGG + Intergenic
1071509421 10:86251819-86251841 GCCCAGCCCTGAGCTGCTCAGGG - Intronic
1073025768 10:100486359-100486381 GCTCAGCCCTGAAGTGGGGTAGG + Intergenic
1073156711 10:101353467-101353489 ATTCGGCCCTGACTTGCTGTGGG + Intergenic
1074149014 10:110741765-110741787 GCTCAGACCTCACCTCCTCTAGG + Intronic
1074969278 10:118522348-118522370 GTTCAGCCCTCATCAGCTGTGGG - Intergenic
1075173472 10:120137425-120137447 CCTCTGCCATGACCAGCTGTGGG + Intergenic
1075403035 10:122174358-122174380 GCTCAGCGCAGACCTGCCCTAGG + Intronic
1075664035 10:124218184-124218206 GATCAGCCCTGACCTGATGCAGG - Intergenic
1076688703 10:132209706-132209728 GCTCAGCGCTGGCATGGTGTGGG + Intronic
1076810711 10:132885007-132885029 GCTCAGCAGGGACCTGGTGTGGG - Intronic
1077416521 11:2426628-2426650 GCTCTGCCCTGAGCTGGTCTTGG - Intergenic
1081907529 11:46679150-46679172 TTTCGGCCCTAACCTGCTGTGGG - Exonic
1082875125 11:57980189-57980211 GCTCATCCCTTCCCTTCTGTAGG - Intergenic
1083785958 11:64947376-64947398 GTCCAGCCCTGGCCTGCTGGGGG + Exonic
1084107322 11:66988577-66988599 GCTCAGCCAAGACCTGTTTTTGG - Intergenic
1084449843 11:69230019-69230041 GCTCACACTTGACCTGATGTGGG - Intergenic
1084959822 11:72710540-72710562 GCTCAGCCATGGCCTGCTGCAGG + Exonic
1086833954 11:91599164-91599186 GCTCAGGCCTGACTTACAGTGGG + Intergenic
1089869240 11:121657455-121657477 GCTCATCACTTACCTGCTGCAGG + Intergenic
1090089063 11:123678282-123678304 GCACAGCCTGGAGCTGCTGTTGG - Intergenic
1090334446 11:125953404-125953426 GCTCAGCCACGTCCAGCTGTGGG - Intergenic
1091112561 11:132983450-132983472 GCGCAGCCCTGACTCGCTGCTGG + Intronic
1091193828 11:133715584-133715606 GCTCAGCCCTCACCAGCAGCTGG + Intergenic
1091836724 12:3591338-3591360 CCTTGGCCCAGACCTGCTGTAGG - Intronic
1092261430 12:6955258-6955280 GCCCACCCCTGACCTGCCGCAGG - Exonic
1093659369 12:21736619-21736641 CCTCTGCCCTATCCTGCTGTCGG - Intronic
1096262671 12:50102935-50102957 GCAGAGCCCTGAACTGCTGAGGG + Intergenic
1096638660 12:52977027-52977049 CCTCACCCCTGACCTCCTGCTGG + Intergenic
1097267833 12:57755876-57755898 GCCCAGGCCTGACCTGCTCCGGG - Exonic
1103931090 12:124451457-124451479 GCTCATCTCTTACCAGCTGTGGG - Intronic
1104674114 12:130701213-130701235 GCTCAGCTCCCACCTGCTGGGGG - Intronic
1104851496 12:131877180-131877202 CCTCAGTCCTGTCCTGCTGCTGG + Intergenic
1104859398 12:131916689-131916711 GCCCAGCCTTGCCCTTCTGTGGG + Intronic
1105273091 13:18895608-18895630 ACTCAGCCCCGACCTGAAGTGGG + Intergenic
1110774073 13:79386020-79386042 GCCTATCCCTGACCTGCAGTGGG - Intronic
1110866957 13:80407196-80407218 GATCACCCCTGAGCTGCAGTGGG - Intergenic
1113498738 13:110756256-110756278 GCTCAGACATTACTTGCTGTGGG + Intergenic
1114379760 14:22190160-22190182 GCTCTGCCCTGGCCTGCTGTGGG + Intergenic
1114460487 14:22883381-22883403 GGTTAGCCCTCACCTGGTGTGGG - Exonic
1118325709 14:64779066-64779088 GCCCAGCCCTGACCTGCAGAAGG - Intronic
1118821519 14:69349195-69349217 CCTCGGCCCTGCCCTGCAGTGGG + Intronic
1119651563 14:76387444-76387466 GCTCACCCCTGAGCTTCTGAAGG - Intronic
1120242577 14:81966483-81966505 ACTCAGCCCTGCCAGGCTGTAGG - Intergenic
1122267848 14:100554961-100554983 GCTCAGCCTGGTCCTGCTCTAGG - Intronic
1122349478 14:101079085-101079107 GCTCTGCCCTGCCCTGCTCTCGG - Intergenic
1123148212 14:106154570-106154592 GCTCAGCTCTGTCCTGGAGTTGG - Intergenic
1124637443 15:31374049-31374071 ACTCAGCCCTGCCATGCTATGGG + Exonic
1125513822 15:40307113-40307135 GCTCTCCCCTGCGCTGCTGTGGG - Intronic
1129162061 15:73752698-73752720 GCTCAGCCCAGCCCCGCGGTCGG + Exonic
1130056634 15:80531937-80531959 GCTGAGCTCTGTCCTGCTGCAGG - Intronic
1130251604 15:82303691-82303713 GCCCAGCCCTGTTCTGCTGCAGG - Intergenic
1130938202 15:88487743-88487765 TCCCAGCCATGACCTCCTGTGGG - Intergenic
1132214021 15:100049536-100049558 GCTGAGCCCCCACCTGCTCTTGG + Intronic
1132692621 16:1188380-1188402 ACTGAGCCCTGAGGTGCTGTGGG - Intronic
1132775626 16:1592360-1592382 CCCCAGCCCTGAGGTGCTGTAGG - Intronic
1133019638 16:2961676-2961698 GCTCAGCCCTGCCCTTCTTAAGG - Intergenic
1134313093 16:13093914-13093936 GCTCATCCCTCCCCTTCTGTGGG + Intronic
1135258996 16:20964979-20965001 TCTCTGCCCTGACCAGCTTTTGG + Exonic
1135541115 16:23331110-23331132 ACACAGCCCTGCCCTCCTGTGGG - Intronic
1136365345 16:29806821-29806843 GCTCAGCCCCGACCTGCAGGGGG - Exonic
1137004362 16:35259057-35259079 AGTGAGCTCTGACCTGCTGTGGG - Intergenic
1137025320 16:35468345-35468367 GCTCAGGGCTGAGCTGGTGTGGG + Intergenic
1138418218 16:56883693-56883715 GCCCTGGCCTGACCTGCTGGTGG + Intronic
1139922935 16:70471063-70471085 GCTCAGGCCTCACCTGCAGGTGG - Exonic
1140196354 16:72858824-72858846 GGCCAGCCCTGACCCGCTGCAGG - Intronic
1140428710 16:74883405-74883427 GCTGAACCCTGAACTGTTGTCGG - Intronic
1141689335 16:85587594-85587616 GCTCAGCCCAGGCCCCCTGTTGG + Intergenic
1142000772 16:87662974-87662996 TCTCAGCCGTCACATGCTGTTGG + Intronic
1142105953 16:88302869-88302891 CCTCTGCCCTGGCCAGCTGTGGG + Intergenic
1143352837 17:6301567-6301589 GCTCAGCCCCGACCTGTTCATGG + Intergenic
1143684029 17:8499380-8499402 ACTCAGCCTTGACCTGCTGCAGG + Exonic
1143836904 17:9700103-9700125 GCTGAGCCCTGAAGAGCTGTGGG + Intronic
1145392675 17:22468007-22468029 GCACAGCTCTGCCCTGCTGCAGG - Intergenic
1146789345 17:35742725-35742747 CCTCAGCCCTGGCCTGGTGGGGG + Exonic
1147261664 17:39212597-39212619 GGTCAGCCCTGAAGTGCTGCTGG - Intronic
1149056991 17:52378530-52378552 GCCCAGGCCTGTCCTGCTGAAGG + Intergenic
1151489582 17:74424899-74424921 GCCCTGCCCTGCCCTGCTGGAGG + Intronic
1151664297 17:75536573-75536595 GTCCAGCCCTGTCCTGCTGGTGG - Intronic
1152409232 17:80113429-80113451 AGGCAGCCCTGTCCTGCTGTGGG + Intergenic
1152889040 17:82869716-82869738 GTTCACCCCAGACCTGCTCTGGG + Intronic
1154324783 18:13382013-13382035 GCTCGGCCCTGAGCGTCTGTGGG + Intronic
1154464855 18:14633170-14633192 ACTCAGCCCCGACCTGAAGTGGG + Intergenic
1156502836 18:37570541-37570563 GCTCTGCCCAGACCTGCAGAGGG + Intergenic
1157623060 18:49027118-49027140 GCTCAGCCCTGGCCCCCAGTGGG + Intergenic
1157744215 18:50120649-50120671 GCTCAGCTATGACCTGCTTGAGG - Intronic
1160554368 18:79716511-79716533 GCCAAGCCCTGGCCTCCTGTGGG + Intronic
1160804236 19:984769-984791 GCTCAGGCCTGAGCTGCTATGGG + Intronic
1161030530 19:2056066-2056088 GCCTGGCCCTGCCCTGCTGTGGG + Intergenic
1163034610 19:14563609-14563631 GCTGAGCCCTGCCAGGCTGTGGG + Intronic
1165468038 19:35986640-35986662 GCCCAGGCCTGAACTTCTGTTGG - Intergenic
1165833835 19:38743087-38743109 GCTCAGCACAGAACTCCTGTGGG + Exonic
1166383816 19:42369524-42369546 GCACAGCCCTGTCATGCTGCAGG - Exonic
1166405743 19:42520744-42520766 GCTCTGCCCTGACCCCATGTGGG - Intronic
1166703621 19:44896243-44896265 GCTCAGCCCTGACCGGCACACGG - Intronic
1167116353 19:47491345-47491367 ACAGAGCCCTGCCCTGCTGTGGG - Intronic
1167508048 19:49881449-49881471 CCTCAGCCGCTACCTGCTGTTGG + Exonic
1167786659 19:51643366-51643388 TCTCAGCCCTGCTCTGCTGGGGG + Exonic
1167812651 19:51847995-51848017 CCCAAGCCCTGACATGCTGTTGG + Intergenic
1168398668 19:56069989-56070011 GCTAAGCTATGACCTTCTGTGGG + Intergenic
1168539517 19:57198605-57198627 GCTCAGGCCTGACTTACAGTGGG - Intronic
1202697664 1_KI270712v1_random:136750-136772 ACTCAGCTCTGCCCTGGTGTTGG + Intergenic
925265323 2:2562953-2562975 TCTCAGCCCTCACCTGCAGATGG + Intergenic
925988067 2:9231834-9231856 TCTCAGTCCTCACCTGCTGCAGG - Intronic
926743116 2:16128356-16128378 GCTCTGCCCTGGCATGCTGCAGG - Intergenic
926868716 2:17388964-17388986 GCTTAGACCTGGCCTTCTGTGGG + Intergenic
928704909 2:33939086-33939108 GCACAGTCCTGATCTGCTGAAGG - Intergenic
929581533 2:43084480-43084502 GCTCAGCCCTGAGCCGCAGCTGG + Intergenic
930357949 2:50345391-50345413 GCTCTGCCCTGAGCAGCTGCTGG - Intronic
931221558 2:60292813-60292835 GCCCTGCCCTGTCCTGCTGCTGG - Intergenic
931461122 2:62450868-62450890 GCTCCACCCTGACCTGCTCAGGG - Intergenic
932818535 2:74880433-74880455 GCTGAGCCATGACCAGCTGCTGG + Exonic
934159019 2:89230501-89230523 GCCCAGCTCTGAGCTCCTGTTGG - Intergenic
934208255 2:89951924-89951946 GCCCAGCTCTGAGCTCCTGTTGG + Intergenic
934278837 2:91593746-91593768 ACTCAGCTCTGCCCTGGTGTTGG + Intergenic
934917560 2:98312306-98312328 CCTCAGCCCTTTGCTGCTGTGGG - Exonic
935441649 2:103104846-103104868 GATCAGCACTGAGCTACTGTGGG + Intergenic
936152796 2:110030858-110030880 GCTGAGCCCAGACCTCCTCTCGG - Intergenic
936191884 2:110340554-110340576 GCTGAGCCCAGACCTCCTCTCGG + Intergenic
937278654 2:120702590-120702612 CCACATTCCTGACCTGCTGTGGG + Intergenic
937363836 2:121246778-121246800 GCTCTGCCGTGCCCTGCTGCTGG - Intronic
937958742 2:127438572-127438594 GCTAGGCCCTGCCCTGCTGGGGG + Intronic
940472258 2:154114354-154114376 GCTCAGATCTGACTTGCAGTGGG - Intronic
940506118 2:154555368-154555390 ACTCATCCCTGACCTTCTTTTGG - Intergenic
942902545 2:181139167-181139189 ACTCAGCCCAGACCTCCTGTAGG - Intergenic
944904888 2:204252475-204252497 CCCCAGCTCTGACCTGCTGTGGG - Intergenic
946054012 2:216885459-216885481 GCTTAGGCATGGCCTGCTGTAGG - Intergenic
946143154 2:217708928-217708950 GCTTAGCCCTCACCTGGTGTAGG + Intronic
946775004 2:223128192-223128214 GCTCTACACTGGCCTGCTGTGGG - Intronic
947395647 2:229684248-229684270 GCTCAGCCATCACCTCCTATTGG - Intronic
948205910 2:236162849-236162871 GCTCTGGCCTGAGATGCTGTTGG - Intergenic
948763958 2:240210139-240210161 GCTCTCCCCTGACCTTCTGGGGG + Intergenic
1169569080 20:6887227-6887249 GCTCAGGCCTGGCCTGCCTTGGG + Intergenic
1171135599 20:22692015-22692037 CCTCTGACCTAACCTGCTGTTGG - Intergenic
1172224683 20:33297452-33297474 GCACAGCCCGGGGCTGCTGTGGG + Intronic
1172973347 20:38889028-38889050 GGTGAGCCATCACCTGCTGTGGG + Intronic
1174302868 20:49594893-49594915 GCTCTGCCCAGGCCTGCTGAAGG - Intergenic
1174806245 20:53606715-53606737 GCTCAGCCCTGACCTGCTGTGGG - Intronic
1176110903 20:63410293-63410315 GCTCAGCCTGGAGCTGCTGCTGG + Intronic
1176260496 20:64177131-64177153 TCTCAGCAGTGAGCTGCTGTTGG + Intronic
1177134636 21:17296296-17296318 GCTCAGCTCAGGCCTGCTGGTGG + Intergenic
1179612366 21:42560489-42560511 TTCCAGCCCTGACCTGCTGAGGG - Intronic
1180700631 22:17779714-17779736 CCTTGGCCCTGAGCTGCTGTTGG - Intergenic
1180825268 22:18857054-18857076 GGTCAGCACTGCCGTGCTGTGGG - Intronic
1180879102 22:19191354-19191376 GCTCATCAATGACCTGCTGCTGG - Exonic
1181187461 22:21117493-21117515 GGTCAGCACTGCCGTGCTGTGGG + Intergenic
1181211737 22:21293000-21293022 GGTCAGCACTGCCGTGCTGTGGG - Intergenic
1181397771 22:22633886-22633908 GGTCAGCACTGCCGTGCTGTGGG + Intergenic
1181651640 22:24262172-24262194 GGTCAGCACTGCCATGCTGTGGG - Intergenic
1183548064 22:38465884-38465906 GCTCATCCCTGAGCTGCGGCAGG - Intergenic
1183586081 22:38753827-38753849 GCTCAGCTCTGACAGGCTGTAGG + Intronic
1183932924 22:41246358-41246380 GCCCAGCCCTGCTCTGTTGTGGG - Exonic
1184188792 22:42881385-42881407 GCTCACCTCTGACCACCTGTGGG - Intronic
1184631485 22:45784011-45784033 ACACAGACCTGGCCTGCTGTAGG - Intronic
1185058099 22:48591727-48591749 GCTGAGCCCTGAACTGATGTGGG + Intronic
1203215216 22_KI270731v1_random:2432-2454 GGTCAGCACTGCCGTGCTGTGGG + Intergenic
1203275417 22_KI270734v1_random:82957-82979 GGTCAGCACTGCCGTGCTGTGGG - Intergenic
950444906 3:13031351-13031373 GCTGAGCCCCTCCCTGCTGTAGG - Intronic
950574899 3:13826383-13826405 GCTCAGCCCTGGCCTTCTTGGGG - Intronic
950576664 3:13836322-13836344 GCTCAGCCCTGGCCTCCAGATGG + Intronic
951352182 3:21619700-21619722 TCCCAGCCCTGGCCTGCTGAGGG + Intronic
952041558 3:29267695-29267717 GCTCAGCCCTTTCCTGCTCTGGG + Intergenic
954361083 3:50123163-50123185 GCTCAGCCCTGTCTTGCTCCAGG - Intergenic
954684827 3:52364811-52364833 GCTCAGCCGGCACCTGCTGCAGG + Exonic
960685513 3:120289909-120289931 CCTGAGCCCTGCCCTGCGGTGGG - Intergenic
961259808 3:125593168-125593190 GCTTCGTCCTGACCTGCTATGGG - Intronic
961465939 3:127081709-127081731 GCCCAGCCCTCTTCTGCTGTGGG - Intergenic
962214718 3:133511343-133511365 GCTCAGCTCTGACTTACAGTGGG + Intergenic
962604994 3:137025627-137025649 CCACAGCCCTGGTCTGCTGTGGG + Intergenic
962802318 3:138900927-138900949 GCTCAGACCTGTCCTACTGGAGG + Intergenic
965679007 3:171231111-171231133 GCTCAGCCCTAGGCTGCTGATGG - Intronic
967325370 3:188233395-188233417 GCTCAGCTCTGACCTGCTTTGGG + Intronic
967893356 3:194378880-194378902 GCTCAGCCCTGCTCTGCAGCTGG - Intergenic
968734988 4:2290675-2290697 CCTCACCCCTCTCCTGCTGTGGG + Intronic
971280505 4:25239348-25239370 GCTCAGGCATGGCCGGCTGTAGG + Intronic
972805731 4:42528120-42528142 GCTCAGGTCTGACTTGCAGTGGG + Intronic
976087061 4:81417617-81417639 TCTCAGCCCTGCAGTGCTGTGGG - Intergenic
978735174 4:112076931-112076953 GCCCTGCCCTGAGATGCTGTGGG + Intergenic
980729858 4:136811763-136811785 GCTCAGCACTGACCTGCAGGTGG - Intergenic
985653218 5:1116512-1116534 GCTCAAGCTTGACCTTCTGTTGG - Intergenic
986086955 5:4461485-4461507 GCTCAGGTTTGACCTACTGTGGG + Intergenic
992791887 5:80220999-80221021 GCTCAGGGCTGACCTGTTTTGGG - Intronic
993549952 5:89261171-89261193 GAGCAGCCCTGACATGTTGTGGG - Intergenic
995595561 5:113743948-113743970 GCTCAGCATTGACCTGCTTCTGG - Intergenic
997964730 5:138348010-138348032 GCTCACCCCAGCACTGCTGTTGG + Exonic
998614992 5:143730247-143730269 ACTAAGCCCAGACCTGCTGTTGG + Intergenic
998721107 5:144950497-144950519 GCTCAAGACTGACCTTCTGTAGG + Intergenic
999294000 5:150446629-150446651 GCTCAACACTGAGCTGCTGGGGG + Intronic
999831334 5:155322937-155322959 GCTCATCCCTGCAGTGCTGTAGG - Intergenic
1001299226 5:170522061-170522083 GCCCAGCCCTGAATTGCTGCCGG - Intronic
1001426251 5:171624565-171624587 GCTCATGCCTGACCTGGAGTAGG + Intergenic
1001450419 5:171820304-171820326 GCCCAGCCCTTTCCTGCTCTGGG - Intergenic
1001840199 5:174869449-174869471 GCTCAAACCTGACCTCCTGTCGG + Intergenic
1002066632 5:176655096-176655118 GCTCCGCTCTGCCCTGCTCTGGG + Intronic
1003446840 6:6192685-6192707 GCTAAGCCCTCCTCTGCTGTGGG - Intronic
1004321645 6:14636018-14636040 GCCCAGCCTTCACCTGCTGGGGG - Intergenic
1004406364 6:15337447-15337469 GCTCAGACCTTGCCTGCTGCAGG - Intronic
1005905975 6:30261524-30261546 CCTCAGCCCTGCCCTGCTGAAGG - Intergenic
1007405005 6:41630129-41630151 ACTCAGCCGTGACCTCCTATGGG - Intergenic
1010818466 6:80387170-80387192 GCTCAGCTCTGACTTACAGTGGG + Intergenic
1011753122 6:90473116-90473138 GCTCAGCCCAGAGGTGCTGTGGG + Intergenic
1012439793 6:99252624-99252646 GCTCGGCCTTTGCCTGCTGTGGG - Intergenic
1015603764 6:134935602-134935624 CCTCAGGCCTGACCTACGGTAGG + Intronic
1017016165 6:150101165-150101187 GCTAAGCCCTGATGTTCTGTGGG - Intergenic
1018466345 6:164049322-164049344 GCTCAGTCCTAGCCTGCTGCTGG - Intergenic
1019040622 6:169101215-169101237 GCTCAGCTCTGACTTACAGTGGG + Intergenic
1019140595 6:169939977-169939999 GCTCATCCCTGTCCTGGTTTCGG - Intergenic
1019180077 6:170181215-170181237 GCTCTGCCCTGCCCTGCTGGAGG - Intergenic
1022483329 7:30758587-30758609 TCTCAGCCCTGACCCTCTGGGGG - Intronic
1024007890 7:45241023-45241045 GCTCACCCCAGCCCTGCTGCTGG - Intergenic
1024061954 7:45704659-45704681 GCTCTGCCCTAAACTGCTCTGGG + Intronic
1024081120 7:45855898-45855920 GTTCAGACCTGGCCTGCTCTGGG + Intergenic
1024096258 7:45985194-45985216 GCTCTGCCCTGCCCAGCTATGGG + Intergenic
1025246724 7:57323182-57323204 CCTCTGCCCAGGCCTGCTGTGGG - Intergenic
1029453555 7:100655940-100655962 GCTCTGCCCTGACTTTCTCTCGG - Intronic
1031474611 7:122206568-122206590 GCTCAGGTCTGACTTGCAGTGGG - Intergenic
1032153269 7:129448170-129448192 GCTCAGGCCTGACTTACAGTGGG - Intronic
1033284207 7:140026672-140026694 GCTGAGCCCTGGGATGCTGTAGG + Intronic
1035659170 8:1333914-1333936 GCTCAGCCCTGGGCTGCTGAAGG + Intergenic
1035727785 8:1835231-1835253 GCTCAGCCCTGTCCGGCACTCGG - Intronic
1037812314 8:22094445-22094467 GCCCAGCATTGACCTGCTGCAGG + Exonic
1037970704 8:23169876-23169898 GCTGAGACCTGTCCTGCTTTTGG + Intergenic
1041260995 8:56020447-56020469 ACTCAGCCCTGGCCTCCTGCGGG + Intergenic
1041934880 8:63323503-63323525 GCTCAGCCTTTGTCTGCTGTGGG - Intergenic
1044822236 8:96162020-96162042 GCTCTGCCCTGGACTGCTATGGG + Intergenic
1046962763 8:120127322-120127344 CTGCAGCCCTGACCTCCTGTGGG + Intronic
1047393771 8:124475151-124475173 GCGCCGCCCAGACCTGCTGATGG - Exonic
1048574754 8:135681705-135681727 ACAGAGCCCTGGCCTGCTGTTGG + Intergenic
1049100500 8:140575346-140575368 GCACCTCCCTGACCTGCTCTGGG + Intronic
1049309839 8:141928009-141928031 GCTCAGCCCTCGCCTCCTGGAGG + Intergenic
1049761193 8:144332710-144332732 GCTCCGCCCCGGCCTGCTGCCGG + Exonic
1051881981 9:21849425-21849447 GCTCAGGTCTGACGTGCAGTGGG + Intronic
1052347751 9:27427198-27427220 GCTTAGCCCTGGCCTTCTGGTGG - Intronic
1054827240 9:69585597-69585619 ATTCAGTCCTGACCTGCTGCTGG + Intronic
1054841524 9:69746439-69746461 GTTCAGTCCTGACCTGCAGAAGG - Intronic
1055890865 9:81122409-81122431 GCTCAGAGGTGACCTGCAGTGGG + Intergenic
1056606497 9:88090047-88090069 CAGCAGCCCTCACCTGCTGTGGG + Intergenic
1058902773 9:109456618-109456640 CCTCTGCCCTGATCTGCTCTCGG - Intronic
1059234626 9:112751115-112751137 GCCCAGCCCGGACCTGCTGATGG + Exonic
1059430036 9:114244550-114244572 GCTCTGTCCTAACCTCCTGTGGG - Intronic
1060009015 9:120027019-120027041 ACTCATCCCTGACCCGCTCTAGG - Intergenic
1060797994 9:126525626-126525648 GCTCAGCCGCGAGCTGCTGAAGG + Intergenic
1061948255 9:133920732-133920754 GCCCAGCACTGGCCTGCTGTGGG - Intronic
1061997403 9:134193472-134193494 GCTCTGCCCTGCCCTGCGGGAGG - Intergenic
1062400511 9:136370584-136370606 GCCCAGCCAGGAGCTGCTGTGGG - Exonic
1062517127 9:136942340-136942362 CGACAGCCCTGACCTGCTGCTGG - Exonic
1062524674 9:136973404-136973426 GCCCAGCCCTGACCGGGGGTGGG + Intergenic
1062602391 9:137323778-137323800 GCACAGCCTTGGCCTGCTGCTGG + Exonic
1186080074 X:5921591-5921613 GCTCAGCCCTCCCAGGCTGTTGG - Intronic
1186271100 X:7889077-7889099 TATCATCCCTGACCTGCTGTGGG - Intergenic
1190334838 X:49255981-49256003 GTTCAGGCCTGACATGCAGTAGG - Intronic
1192433175 X:71126133-71126155 CCTGAGCCGTGACCTGGTGTTGG - Exonic
1193360361 X:80573152-80573174 GCTGAGCCATGACCAGCTGTTGG - Intergenic
1197342268 X:125288049-125288071 GCTCAGAGCTGACCTGCAATAGG - Intergenic
1200011790 X:153125639-153125661 GCTCACCCCTGACCTGTCGCCGG + Intergenic
1200027811 X:153274280-153274302 GCTCACCCCTGACCTGTCGCCGG - Intergenic
1200115746 X:153769013-153769035 CATCAGCCCAGACCTGCTGCTGG + Exonic