ID: 1174818622

View in Genome Browser
Species Human (GRCh38)
Location 20:53708734-53708756
Sequence AAAGAAAAGAAGACAGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174818622_1174818628 -7 Left 1174818622 20:53708734-53708756 CCCTCCCCTGTCTTCTTTTCTTT No data
Right 1174818628 20:53708750-53708772 TTTCTTTCTTTTTTTTAACAGGG No data
1174818622_1174818629 12 Left 1174818622 20:53708734-53708756 CCCTCCCCTGTCTTCTTTTCTTT No data
Right 1174818629 20:53708769-53708791 AGGGTTTCACTTTGTTGCCCAGG 0: 48
1: 1965
2: 22624
3: 109620
4: 281194
1174818622_1174818630 26 Left 1174818622 20:53708734-53708756 CCCTCCCCTGTCTTCTTTTCTTT No data
Right 1174818630 20:53708783-53708805 TTGCCCAGGCTAAAGTGCAGTGG 0: 233
1: 7194
2: 85879
3: 195431
4: 233179
1174818622_1174818627 -8 Left 1174818622 20:53708734-53708756 CCCTCCCCTGTCTTCTTTTCTTT No data
Right 1174818627 20:53708749-53708771 TTTTCTTTCTTTTTTTTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174818622 Original CRISPR AAAGAAAAGAAGACAGGGGA GGG (reversed) Intergenic
No off target data available for this crispr