ID: 1174836223

View in Genome Browser
Species Human (GRCh38)
Location 20:53857915-53857937
Sequence GCTGGAAAGTTTCTGGGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174836223_1174836228 -7 Left 1174836223 20:53857915-53857937 CCCCTGCCCAGAAACTTTCCAGC No data
Right 1174836228 20:53857931-53857953 TTCCAGCCGTCTCTTCTGTTCGG No data
1174836223_1174836232 3 Left 1174836223 20:53857915-53857937 CCCCTGCCCAGAAACTTTCCAGC No data
Right 1174836232 20:53857941-53857963 CTCTTCTGTTCGGGCTTCACTGG No data
1174836223_1174836229 -6 Left 1174836223 20:53857915-53857937 CCCCTGCCCAGAAACTTTCCAGC No data
Right 1174836229 20:53857932-53857954 TCCAGCCGTCTCTTCTGTTCGGG No data
1174836223_1174836233 22 Left 1174836223 20:53857915-53857937 CCCCTGCCCAGAAACTTTCCAGC No data
Right 1174836233 20:53857960-53857982 CTGGCCTGAATTGTGCCATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174836223 Original CRISPR GCTGGAAAGTTTCTGGGCAG GGG (reversed) Intergenic
No off target data available for this crispr