ID: 1174845271

View in Genome Browser
Species Human (GRCh38)
Location 20:53937282-53937304
Sequence GTTCACCCCATTCTAAAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 93}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174845271 Original CRISPR GTTCACCCCATTCTAAAGTA AGG (reversed) Intronic
900055783 1:629556-629578 TCACACCCCATCCTAAAGTAAGG + Intergenic
902829104 1:18998250-18998272 CCTCACTCCATTCTAAAGAAGGG + Intergenic
904595447 1:31641920-31641942 TATGACCCCATTCTAAAGAAGGG + Intronic
907344525 1:53763748-53763770 GTTAAGCTCATTCTAAAGAATGG + Intergenic
916856069 1:168751437-168751459 GTTCGCCCAACTGTAAAGTAGGG + Intergenic
920390200 1:205595298-205595320 GTTCACCACGTGCCAAAGTAGGG - Intronic
923065857 1:230516752-230516774 ATTCACCACATTGTTAAGTATGG + Intergenic
923256736 1:232228235-232228257 ATTCTCCCCATTTTACAGTAGGG + Intergenic
1063365998 10:5491306-5491328 GTTGAGCCCATTCTTAAGAAGGG - Intergenic
1070241697 10:74688586-74688608 GTTGACCTGATCCTAAAGTATGG - Intronic
1070387575 10:75939739-75939761 GTTCACCCCAGCCCAAAGTCCGG - Intronic
1078564351 11:12401635-12401657 ATCCAGCCCTTTCTAAAGTAGGG - Intronic
1083476262 11:62917536-62917558 GTTCACCCCATTCCACAGAAGGG - Intronic
1083894837 11:65614587-65614609 GTTCACCCCCTTCCCAAGTGTGG - Intronic
1086361705 11:86067850-86067872 ACTCACCCCAGTCAAAAGTATGG + Intronic
1086479058 11:87214224-87214246 ATTCACCCCATTCTAGAACAGGG - Intronic
1087724929 11:101705939-101705961 GTTCACCCCAGTTTAAATTCTGG + Intronic
1088515439 11:110627530-110627552 TTTCTCCCCATTCTAAGATAGGG + Intronic
1092683102 12:11010543-11010565 TTTTACCACATTCTAAAGTGTGG + Intronic
1092923651 12:13255004-13255026 GTTATCCCCATTTTAAAGTTAGG - Intergenic
1093003253 12:14024025-14024047 GCTGAGCCAATTCTAAAGTATGG + Intergenic
1103920851 12:124398472-124398494 GATCACCCCATTTTATAGAAGGG + Intronic
1105221068 13:18327963-18327985 GGTCACCCCATTCCAAAGCATGG - Intergenic
1107054659 13:36090095-36090117 TGTCACCCCACTCTAAAGTAAGG - Intronic
1111533069 13:89565472-89565494 GTTAACCCTATTGTAAACTATGG + Intergenic
1112439946 13:99418016-99418038 GTTGACCACATTCTAGACTAGGG - Intergenic
1116699930 14:48227877-48227899 GTTCATTCCATTAAAAAGTACGG - Intergenic
1117017186 14:51530103-51530125 GTTCATTACATTCTAAAGAAAGG + Intronic
1117688207 14:58277604-58277626 ATTCACCCCAGTTTAAAGGAGGG - Intronic
1120580942 14:86247764-86247786 GTGAACCCCATTGTAAACTATGG + Intergenic
1121819621 14:96955776-96955798 GTTAACCCCAATCTAAAGTAAGG + Intergenic
1122080078 14:99261040-99261062 GTTCACCCGATTCCAAAGAACGG + Intronic
1122332540 14:100932765-100932787 GTGCACCCTATTGTAAACTATGG - Intergenic
1123844159 15:24280346-24280368 GTTCACCCCATCAGAAAGGATGG + Intergenic
1127024424 15:54787584-54787606 GTTCACTGCATTCAATAGTATGG + Intergenic
1128249661 15:66155417-66155439 GTGCACCCCATCCTAAATTTGGG - Intronic
1129165252 15:73773597-73773619 GTTCACAGCATTCCGAAGTAAGG - Intergenic
1130126264 15:81096672-81096694 GTTCTTCCCATCATAAAGTAAGG + Intronic
1130776626 15:86990880-86990902 ATTCATGCCATTCTAAAGTGAGG - Intronic
1131090907 15:89624434-89624456 CTCCACCCCCTTCTAAAGTTGGG + Exonic
1135064064 16:19294589-19294611 GTTTACCTCATTCTAAACTCAGG + Intronic
1135077029 16:19402546-19402568 CATCACCCCACTCAAAAGTAGGG - Intergenic
1145044585 17:19603331-19603353 TTACACCACATCCTAAAGTAAGG + Intergenic
1153380892 18:4438332-4438354 GTTCACACCATTCTGAAATGTGG - Intronic
1155306885 18:24487326-24487348 GTTCACACCATTCTCACATAGGG + Intergenic
1157980291 18:52372021-52372043 GTTCACCACATTGTGAAGAAGGG + Intronic
1158558304 18:58493047-58493069 GGTCAGCCCATTCTGTAGTAGGG - Intronic
1162049912 19:8026860-8026882 GTTCACCCCATTTTACAGCAAGG + Intronic
931097501 2:58957724-58957746 ATTCACCTCAATCTAAAATAAGG - Intergenic
931845211 2:66196667-66196689 GTTATCTCCATTCTAAAGAAAGG + Intergenic
934182989 2:89644505-89644527 GGTCACCCCATTCCAAAGCATGG + Intergenic
934293275 2:91718692-91718714 GGTCACCCCATTCCAAAGCATGG + Intergenic
941870821 2:170383714-170383736 TTTCACCCCATGATAAAGTCTGG - Exonic
942224144 2:173800163-173800185 GATCACCCCATTTTTAACTAAGG + Intergenic
942516708 2:176761605-176761627 GTTCACCAAATTGTGAAGTAAGG + Intergenic
942959021 2:181807391-181807413 TTCCATCCCATTCTAAAGAATGG - Intergenic
947154259 2:227145569-227145591 GGTCACACCATTCCAAAGGATGG + Intronic
947555082 2:231085128-231085150 GTCCACCCCATTCCCAAGAAAGG - Intronic
1170974405 20:21149080-21149102 GTTGTCCCCATTTTATAGTAAGG + Intronic
1174845271 20:53937282-53937304 GTTCACCCCATTCTAAAGTAAGG - Intronic
1177906536 21:26978216-26978238 ATTCACCGCTTTCTAGAGTATGG - Intergenic
1179606930 21:42522721-42522743 CTTCACCCAATTCTACAGGACGG + Intronic
1180732533 22:17992872-17992894 TTTCACCCCATTTTACAGCAGGG - Intronic
1181517272 22:23422188-23422210 TTTCACCCCATTTTACAGCAGGG - Intergenic
1184114184 22:42412689-42412711 GTTCTCCCCGTGCCAAAGTAAGG + Intronic
949354052 3:3158678-3158700 ATTATCTCCATTCTAAAGTAAGG + Intronic
950269767 3:11604650-11604672 ATTCACCCCATCCTAAATAAAGG - Intronic
950424596 3:12918256-12918278 GTGCACCCCATTCCCAAGAAGGG - Intronic
955820638 3:62892133-62892155 GTTGACCCCATTTTCAGGTAAGG - Intergenic
956285193 3:67601558-67601580 ACTCACCCCATTGTAAAGTTTGG - Intronic
956422923 3:69103383-69103405 GTTCACTCATCTCTAAAGTAAGG + Intronic
956485541 3:69718419-69718441 GTTCAGTCCTTTCTTAAGTAAGG + Intergenic
957354200 3:79060586-79060608 GTTCCCCCCATAATAAAATATGG + Intronic
958804147 3:98789162-98789184 TTTCACCCCTTTTTAAAGTAGGG + Intronic
966673319 3:182554848-182554870 ATTTACCCCATTGTTAAGTATGG + Intergenic
967130310 3:186464674-186464696 GTTAACCACATCCTAAAGGAAGG - Intergenic
970036917 4:11746675-11746697 GTTGACCCCATTTTAAAATAAGG + Intergenic
972402249 4:38716366-38716388 GTTCACTCCATTCTTTATTAGGG - Intergenic
974289031 4:59907056-59907078 GTACAACCCATTCTTAAGAAGGG + Intergenic
974386368 4:61205379-61205401 ATTCACACCATGCTAAATTAAGG - Intronic
976617201 4:87090330-87090352 GTTCTCCCATCTCTAAAGTAAGG - Intronic
978082290 4:104608268-104608290 TTCCACCACATTCTAAATTATGG + Intergenic
981018779 4:140003623-140003645 GTGTACCCCATTTTAAAGTGAGG + Intronic
983127666 4:163974174-163974196 GCTCACCCTATTCAAAATTAGGG - Intronic
984225821 4:177033528-177033550 TTTCCCCCTATTCTAAGGTAGGG - Intergenic
986403970 5:7407145-7407167 GTTCAGACCATTCTAAGGTCTGG + Intronic
993485668 5:88481035-88481057 TTCTGCCCCATTCTAAAGTAAGG - Intergenic
1001110612 5:168893221-168893243 GTTCACCTGATTCAAAAGGATGG + Intronic
1003442529 6:6157025-6157047 GTTCACACCATTAGTAAGTAGGG + Intronic
1005777671 6:29154151-29154173 ATCCACCCCATTCAAAATTAGGG - Intergenic
1007175295 6:39892352-39892374 ATTCTCTCCTTTCTAAAGTAGGG + Intronic
1008920646 6:56841784-56841806 CATCACTCCATTTTAAAGTAAGG - Intronic
1035684684 8:1514667-1514689 TGTCACCCCATTCTAAAGGAGGG + Intronic
1036920586 8:12850706-12850728 GTTCACACCATGCTCAAATAAGG + Intergenic
1039321253 8:36434549-36434571 GTTCCCCCCCTTTTAAAGCAGGG - Intergenic
1039447859 8:37646903-37646925 GGTCACCTCATTTTAAAGTCAGG - Intergenic
1045676573 8:104614478-104614500 GTTCCCCTGATTCTAAATTATGG - Intronic
1202629434 M:4386-4408 TCACACCCCATCCTAAAGTAAGG + Intergenic
1188093505 X:25992548-25992570 GGTAACCCCATTGTAAGGTAAGG - Intergenic
1191783774 X:64895847-64895869 GTTCCCACCATTCTATGGTAAGG + Intergenic
1194680861 X:96850973-96850995 TTTCCCCCCATTCTACAGTGAGG + Intronic
1195865122 X:109424543-109424565 GTTTACCCCAATGTAAACTATGG + Intronic
1198303303 X:135352858-135352880 GTTCCCCCCATCCTAAACTCAGG - Intronic
1199528081 X:148814678-148814700 GTTTACAGCATTCTAAATTATGG + Intronic
1201450708 Y:14110470-14110492 GTGAACCCTAATCTAAAGTATGG - Intergenic