ID: 1174846270

View in Genome Browser
Species Human (GRCh38)
Location 20:53946187-53946209
Sequence GATTTGGATGGTGGTTTTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 298}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174846270_1174846282 29 Left 1174846270 20:53946187-53946209 CCCCTAAAACCACCATCCAAATC 0: 1
1: 0
2: 0
3: 20
4: 298
Right 1174846282 20:53946239-53946261 GATCTTTCTTGTGCCTTTTGTGG 0: 1
1: 0
2: 1
3: 26
4: 261
1174846270_1174846275 -9 Left 1174846270 20:53946187-53946209 CCCCTAAAACCACCATCCAAATC 0: 1
1: 0
2: 0
3: 20
4: 298
Right 1174846275 20:53946201-53946223 ATCCAAATCAACATGTCACATGG 0: 1
1: 0
2: 1
3: 12
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174846270 Original CRISPR GATTTGGATGGTGGTTTTAG GGG (reversed) Intronic
900742069 1:4336460-4336482 GATAATGATGGTGATTTTAGTGG + Intergenic
901900141 1:12353737-12353759 ATTTTGGATGGTGTTTATAGAGG + Intronic
902170237 1:14604388-14604410 GATTTGGAGGGTGGTGGCAGGGG - Intronic
903759190 1:25685871-25685893 GACTCGTATGGTGATTTTAGGGG + Intronic
904133663 1:28294150-28294172 GATTTGGATGGTAGTTGCATAGG - Intergenic
904416457 1:30364333-30364355 GATTTGGCTGGTGGTTACATGGG + Intergenic
907221815 1:52912567-52912589 GATTTGGGTGGTGGTTATAAGGG - Intronic
907449724 1:54537396-54537418 AATTTTGGTGGTGGTTGTAGAGG + Intergenic
908173274 1:61528867-61528889 CCTTTGGATGGAGGTTTTATTGG - Intergenic
908897073 1:68912397-68912419 AAGTTGGATGGTTGTGTTAGAGG - Intergenic
909328639 1:74385303-74385325 GATTGAGATGGTGGTTTCACAGG + Intronic
909623336 1:77689017-77689039 GATTTGGGTGGTTGAATTAGTGG + Intergenic
909665942 1:78133546-78133568 GATTTTGATGGTGGTGCTGGTGG + Intronic
909838568 1:80288929-80288951 GATTTGCATTGTGGTTTGATTGG - Intergenic
909845778 1:80393057-80393079 GAGAAGGATGGTGCTTTTAGGGG - Intergenic
910711367 1:90185754-90185776 GATTTGGATGGAGGGAGTAGTGG + Intergenic
911881640 1:103246734-103246756 GATTTTGATGTTGATTTTGGAGG - Intergenic
912343677 1:108943579-108943601 GCTCTGCATCGTGGTTTTAGTGG - Exonic
912561458 1:110554724-110554746 GATTCAGATGATGGTTGTAGAGG - Intergenic
913041150 1:115025273-115025295 GATTGTGATGATGGTTTTACAGG - Intergenic
913050036 1:115109561-115109583 TATTTGGAGGGAGGTTTTTGGGG - Intergenic
913356089 1:117923665-117923687 GACTTTGGTGGTGGTTCTAGGGG - Intronic
916396829 1:164399766-164399788 GATTAGGATGGTGATTTTAAAGG + Intergenic
916559349 1:165919895-165919917 GATTTTGGTGATGGTTTCAGAGG - Intergenic
917603735 1:176603722-176603744 GATTAGGGTGGTGGCTATAGGGG - Intronic
917912160 1:179660504-179660526 TATTTGTATAGTGTTTTTAGTGG + Intronic
918510965 1:185314194-185314216 GATGGTGATGGTGGTTTTAGAGG - Intronic
919724073 1:200870800-200870822 GATTTGGAAAATGGTCTTAGAGG - Intergenic
919963679 1:202499084-202499106 GATTTGGGTAGTGGTTATACTGG - Intronic
920246459 1:204591202-204591224 GATTTAGATGTTGGTTATATGGG + Intergenic
920418685 1:205814930-205814952 GATCTGGATGGTGGTCATATGGG - Intergenic
922276879 1:224087438-224087460 GCTGTGGAGGGTGGTTTCAGAGG - Intergenic
922850414 1:228728759-228728781 GATCTGAGTGGTGGTTTTATAGG - Intergenic
924887932 1:248240038-248240060 GATTTGGATGTTAGTATAAGTGG + Intergenic
1063432358 10:6001655-6001677 TATCTTGATTGTGGTTTTAGGGG - Intergenic
1063854240 10:10229650-10229672 GATTTGGCTCATGGTTCTAGAGG + Intergenic
1064651965 10:17518664-17518686 GATTTGAATGTTGCTTTTAACGG + Intergenic
1065177990 10:23096875-23096897 AAAAAGGATGGTGGTTTTAGCGG + Intronic
1065401604 10:25308731-25308753 AAGTAGAATGGTGGTTTTAGGGG - Intronic
1065403682 10:25337244-25337266 GATCTGGATGGTGGTTTACATGG - Intronic
1065626670 10:27636502-27636524 GATCTGGATTGTGGTTGTATAGG - Intergenic
1066477658 10:35763750-35763772 GTTTTGGATGCTGGTTAAAGAGG - Intergenic
1067215206 10:44295656-44295678 GATTTGGATGCTGTTTTCTGTGG - Intergenic
1068427759 10:56889559-56889581 GATTTGGAGGCTGGTCATAGTGG + Intergenic
1068649004 10:59500867-59500889 GATTTGGTTGGTAGTCTTATGGG + Intergenic
1069763961 10:70837813-70837835 TATTTGGCTCGTGGTTCTAGAGG + Intronic
1069882507 10:71602572-71602594 GATTTGGAGGGAAGTTTCAGGGG + Intronic
1071782768 10:88865133-88865155 GATTTGGATTGTGGTTTTGTAGG + Intergenic
1071979969 10:90995293-90995315 TATTTTGATGCTGGTTTCAGTGG + Intergenic
1074156034 10:110800574-110800596 GACTTTGGTGGTGGTTTTACGGG - Intronic
1074353601 10:112761423-112761445 CATTATGATGGTGGTTTGAGGGG + Intronic
1075119366 10:119652318-119652340 AGCTTGGATGGTGGTTTTGGGGG + Intronic
1075438154 10:122460303-122460325 TATTTGGAAGGTGCTTTGAGGGG + Intergenic
1077067231 11:647535-647557 GATTTGGATTGTGTTTTAATTGG - Intronic
1077617328 11:3686665-3686687 GATCGTGATGGTGGTTTTACAGG - Intronic
1077872941 11:6278853-6278875 CATGTGGATGGGGGTTCTAGGGG - Intergenic
1078117163 11:8465405-8465427 GGTTTGGATGATGGTTTTATGGG - Intronic
1078192032 11:9098853-9098875 GATCTGCATGGTGATTTTATGGG + Intronic
1078332936 11:10440875-10440897 GAATGGGGTGGTGGTATTAGGGG + Intronic
1081043563 11:38242378-38242400 GATTTGGAAGGTGGTAGAAGTGG - Intergenic
1082152235 11:48754884-48754906 AATTTGCATGGTGATATTAGAGG - Intergenic
1084466051 11:69323696-69323718 GATTTGGGTGGTGGTGGTGGTGG + Intronic
1087469965 11:98560642-98560664 GATTTTGATGGGGGGTTGAGGGG + Intergenic
1088010758 11:104998162-104998184 GATTTGGGTGATGATTTTAGGGG + Intronic
1088207848 11:107414768-107414790 GATTTTTATGGTGGTTTAGGTGG - Intronic
1089959965 11:122607750-122607772 GAGTAGAATGGTGGTTATAGAGG + Intergenic
1090337208 11:125978961-125978983 TATTTGGATGTTGCTTTTGGCGG + Intronic
1090415675 11:126538669-126538691 GATTTTTATGGAGGTTCTAGGGG + Intronic
1091719635 12:2803375-2803397 TGGTTGGATGGTGGCTTTAGGGG + Exonic
1091934089 12:4421571-4421593 GACTGGGATGCTGATTTTAGAGG - Intergenic
1092835738 12:12486286-12486308 TATTTGGAATGTGGCTTTAGTGG - Intronic
1095488115 12:42705434-42705456 CTTTTGGATGGTGGGATTAGTGG - Intergenic
1095709988 12:45278063-45278085 GAGGTGGAGGGTGGTTTGAGCGG - Intronic
1095837143 12:46651532-46651554 GTTTTGGCTGGCGGGTTTAGAGG + Intergenic
1099126805 12:78769878-78769900 GATTTGGATGGTGGTGGGAGAGG + Intergenic
1100455691 12:94749648-94749670 GATTTGGATGTGGGTTTTAACGG + Intergenic
1101627248 12:106457399-106457421 AGTTTGGATGGTGGTTTTATAGG - Intronic
1101980176 12:109399262-109399284 GATCTGGGTGGTGGTTACAGAGG - Intronic
1102879803 12:116475554-116475576 GATTTGGATGGCCCTTTAAGAGG + Intergenic
1103929478 12:124441855-124441877 GACTGGGATGGTGGGTTTTGGGG - Intronic
1104115095 12:125742251-125742273 GCTTGGGATTGGGGTTTTAGTGG - Intergenic
1105952295 13:25240746-25240768 GATCTGTATGGTTGTTTTGGTGG - Intergenic
1106060686 13:26288396-26288418 TTTTTGCATGTTGGTTTTAGGGG + Intronic
1108367436 13:49730063-49730085 GCTTTGGGTGGTGGTTACAGAGG + Intronic
1111678835 13:91419629-91419651 TATTTGGATTGTGGTTATCGTGG + Intronic
1113182385 13:107644809-107644831 GATCTGGGTGGTGGTTCCAGAGG - Intronic
1113829417 13:113283410-113283432 GATTGGGGTGGTGGTTTCATGGG + Intergenic
1115173228 14:30531958-30531980 GATTGCGGTGGTGGTTTTACAGG + Intergenic
1115423981 14:33232909-33232931 GTGCTGGATGGTGGATTTAGGGG + Intronic
1115537212 14:34384587-34384609 TGTTTGGATGGGGGTTGTAGGGG + Intronic
1115780515 14:36763579-36763601 TATTTGGGTGGTGGTGGTAGGGG + Intronic
1116277176 14:42850309-42850331 GATTAGGATGGTGGTTGCTGAGG + Intergenic
1116461940 14:45187134-45187156 AATTTAGATGGTGATTATAGAGG + Intronic
1118582025 14:67310522-67310544 GATTTGGATGCTAGTTATACAGG + Intronic
1119029150 14:71177910-71177932 GTTTAGGCTGGTGGTTATAGGGG - Intergenic
1119705075 14:76778201-76778223 ACTTGGGATGGTGGGTTTAGAGG + Intronic
1120557548 14:85947572-85947594 GATTTGAACTGTGGTTTTAATGG + Intergenic
1122342592 14:101038172-101038194 TTTTTGGAGGGTGGTATTAGTGG + Intergenic
1123973121 15:25527870-25527892 TATTTGGATGGTGGTGACAGTGG + Intergenic
1126432073 15:48597144-48597166 AATTTGAATGGAGGTTTTGGGGG - Intronic
1127520852 15:59741758-59741780 TTTTTGGATGGTGGTGTCAGAGG - Intergenic
1128873267 15:71180487-71180509 GATTGTGGTGGTGGTTTCAGGGG + Intronic
1129779168 15:78258352-78258374 GATTAAGATGGTGGTTTCATGGG + Intergenic
1131258121 15:90874549-90874571 AAATGGGATGGTGCTTTTAGGGG - Intronic
1133535006 16:6693381-6693403 GATGGGGATGGTGATTCTAGTGG - Intronic
1134689101 16:16179276-16179298 GAAATGGATGGTGGTCTCAGTGG - Intronic
1137445646 16:48530396-48530418 GTTTTGCATGGTGGTTATATGGG - Intergenic
1140389356 16:74572019-74572041 GAATTGAATGGTGGTGTTGGGGG + Intronic
1141894635 16:86951208-86951230 GATGTTGATGGTGGTAATAGTGG - Intergenic
1145243775 17:21254340-21254362 GATTTGGATGGTGGTCACACGGG - Intergenic
1145832029 17:27924170-27924192 GATTTGGGTGGTGGTTCCAGGGG + Intergenic
1146563956 17:33895851-33895873 GATTTGAATTCTGGTTTTATGGG - Intronic
1146611444 17:34308947-34308969 GATTTGGATGGTGATTCCTGGGG - Intergenic
1150162697 17:62912643-62912665 GATTTGGCTCATGGTTCTAGAGG - Intergenic
1150920143 17:69474392-69474414 CATTTGGATGATTGTTTTATAGG + Intronic
1150975379 17:70080146-70080168 GATATGGATAGTGATTTTAATGG - Intronic
1151022483 17:70633503-70633525 GATTGTGATGATGGTTTTACAGG - Intergenic
1152634481 17:81425080-81425102 GATGTGGTTGGTGGTGATAGTGG + Intronic
1152634546 17:81425339-81425361 GATGTGGTTGGTGGTGATAGTGG + Intronic
1152634630 17:81425695-81425717 GATGTGGTTGGTGGTGATAGTGG + Intronic
1152634681 17:81425957-81425979 GATGTGGTTGGTGGTGATAGTGG + Intronic
1152634710 17:81426080-81426102 GATGTGGTTGGTGGTGATAGTGG + Intronic
1152634716 17:81426108-81426130 GATGTGGTTGGTGGTGATAGTGG + Intronic
1152634738 17:81426210-81426232 GATGTGGTTGGTGGTGATAGTGG + Intronic
1153270993 18:3321079-3321101 GATCTGGGTGGTGGCTATAGGGG + Intergenic
1153664378 18:7355036-7355058 GATATGGATTGTAGATTTAGGGG - Intergenic
1156288653 18:35724307-35724329 GATTTGGATGGGGCTTTTTATGG - Intergenic
1156612841 18:38747927-38747949 GATTAGGATGATGGTTTCAGGGG + Intergenic
1156848027 18:41691833-41691855 GCTTTGGTTGATGGTTTTGGAGG - Intergenic
1157416199 18:47505188-47505210 AGTTGGGATGGTGGATTTAGTGG + Intergenic
1157865238 18:51177338-51177360 GACTTGGACGGTGGTTTGACCGG + Exonic
1158245168 18:55424005-55424027 GATTCTGATGGTGGTTGGAGAGG - Intronic
1158425105 18:57332553-57332575 GATTGGGATTGTGGTTTCACAGG + Intergenic
1158568232 18:58574151-58574173 GATTTGGATGGTGCTGGTTGCGG + Intronic
1159381355 18:67663707-67663729 GAATTGGATGATGGGTTAAGAGG - Intergenic
1162612771 19:11768808-11768830 CAATTGGATGGTGGTATTAAGGG + Intronic
1166277369 19:41763325-41763347 GATGGGGATGGGGGTTTGAGCGG - Intronic
1167179395 19:47890795-47890817 CATTTGCATGGTGGTATTGGAGG + Intergenic
1168644738 19:58052790-58052812 GATGTACATGGTGGTTCTAGGGG - Intronic
925183481 2:1831747-1831769 GAGTTGCATGGTGGCATTAGGGG - Intronic
926477601 2:13346042-13346064 GATTTTGGTGGTGATTTTATGGG + Intergenic
926624785 2:15082109-15082131 GATAAGGATGGTGGTATTGGTGG + Intergenic
927343594 2:22010384-22010406 GATTTGGCTCGGGGTTCTAGAGG - Intergenic
927840568 2:26439640-26439662 TATTTCTATGGTGTTTTTAGAGG + Intronic
928183388 2:29087014-29087036 GATTGGGATTCTGGGTTTAGGGG + Intergenic
930433197 2:51307214-51307236 GATTTTGATGGTAATTATAGTGG + Intergenic
932002995 2:67901595-67901617 TATTTGGCTCATGGTTTTAGAGG - Intergenic
932995941 2:76852849-76852871 GATTAGGATAGTAGGTTTAGAGG + Intronic
933132082 2:78684066-78684088 TATTTGGATGGGAGTTTTATTGG - Intergenic
933248537 2:80002829-80002851 GATTTAGATGTTGGTTTGACAGG - Intronic
934994370 2:98943615-98943637 GATGTGGATGATGGTGGTAGGGG - Intergenic
935668183 2:105532252-105532274 GATCTGGGTGGTGGTTACAGAGG + Intergenic
936055529 2:109259338-109259360 GCTCTGGATGGTGGTCTCAGAGG - Intronic
940210606 2:151252971-151252993 GATTTGAATGTTGAATTTAGAGG - Intronic
943115758 2:183668140-183668162 CAACTGGATGGTGATTTTAGAGG - Intergenic
944377568 2:199064903-199064925 TATCTGGATGGTGGTTTCATAGG + Intergenic
945990528 2:216392154-216392176 AATTTGGATGGTATTTTTGGTGG - Intergenic
947174141 2:227344858-227344880 GTTTTTGATGCTGGTTTTTGAGG + Intronic
1172562425 20:35901031-35901053 GATCTGCATGGTGGTTATACAGG + Intronic
1172940806 20:38653115-38653137 GATTGTGATGGTGGTGTTGGTGG + Intergenic
1172940830 20:38653286-38653308 GATTATGATGGTGGTGTTGGTGG + Intergenic
1173314849 20:41933839-41933861 GATTTGGCTTGTGGTTCTACAGG - Intergenic
1173582755 20:44159236-44159258 GATTTGGATGGATGTTTGGGTGG + Intronic
1174086345 20:48010766-48010788 GATATTGATGGTGGTTGTAGTGG - Intergenic
1174086351 20:48010811-48010833 GATATTGATGGTGGTTGTGGTGG - Intergenic
1174594441 20:51672517-51672539 GCTCTGGATGGTGGATTCAGAGG - Intronic
1174846270 20:53946187-53946209 GATTTGGATGGTGGTTTTAGGGG - Intronic
1175059863 20:56232120-56232142 TACCTGGATGGTGGTTTTGGAGG + Intergenic
1175376833 20:58533534-58533556 GCTTTGAATGGTGGTAGTAGTGG - Intergenic
1175697443 20:61113295-61113317 GATTTGGAATGTGCTTTTAGAGG + Intergenic
1177013392 21:15755180-15755202 AATTTGGAAGGTTTTTTTAGAGG + Intronic
1177412114 21:20742409-20742431 GATTTGGATGCTAGTTTTGTGGG + Intergenic
1177637448 21:23806117-23806139 GATTAAGAGGGTGATTTTAGAGG - Intergenic
1177761721 21:25409160-25409182 GAGTAGAATGGTGGTTTTACAGG + Intergenic
1178212573 21:30553269-30553291 GATTTAGATAGTAATTTTAGTGG - Intronic
1178912376 21:36685806-36685828 GATCTGGGTGGTGGTTATATGGG - Intergenic
1179003906 21:37492232-37492254 GACTTGGCTGGAGGTTTCAGTGG + Intronic
1183009306 22:34931858-34931880 AATTTGGTTGGAGGTTTGAGGGG - Intergenic
1183244149 22:36680628-36680650 GATAATGATGGTGGTGTTAGTGG - Intronic
1185127305 22:49018212-49018234 GATTTGGAGGCTGGCTTTGGGGG + Intergenic
949625216 3:5858123-5858145 GATCTGGGTGGTGGTTATATAGG + Intergenic
950651116 3:14407403-14407425 GATTTGGGTGGTGGTTACACAGG - Intronic
950748468 3:15109350-15109372 GATTTGGGTGGAGCTTTCAGTGG - Intergenic
951185232 3:19704893-19704915 GAAGTGGATGGTGGTTTAATAGG - Intergenic
952329676 3:32352749-32352771 GATTTGGATGCTGGTTACACAGG + Intronic
952442795 3:33349927-33349949 GACCCGGATGGTGGTTTTACTGG + Intronic
953758677 3:45669504-45669526 GATCTGGGTGGTGGTTACAGGGG - Intronic
954002711 3:47570474-47570496 GTATTGGATGATGGTTTAAGTGG - Intronic
954158572 3:48702945-48702967 GATTTGGATGATGATTGCAGTGG - Intronic
954654003 3:52182757-52182779 GATTTGCAGGGTGGGTTTAAGGG + Intergenic
955241948 3:57186151-57186173 GATTTGGATGAGTGTTTAAGGGG + Intergenic
958768445 3:98397809-98397831 GTTCTTGATGGTGCTTTTAGGGG - Intergenic
959198417 3:103214742-103214764 GTTTTTGAGGGTGGTTTTTGAGG - Intergenic
959549076 3:107633767-107633789 ATTTTGTATGGTGGTTTCAGAGG - Intronic
960109286 3:113829451-113829473 GATTTAGTTGGAGGTTTTGGAGG - Intronic
960363465 3:116742582-116742604 ACTTTGGCTGATGGTTTTAGTGG - Intronic
961578389 3:127857290-127857312 GGTTTGGATGCTGGTTGTGGAGG - Intergenic
962056592 3:131878533-131878555 AATCTGGATGCTGGTTTTACAGG + Intronic
964651763 3:159019414-159019436 GATCTGGATGGTGGTTACACAGG - Intronic
965208036 3:165747190-165747212 GATTGGGATGGTGGTTTTGCAGG + Intergenic
965390543 3:168097740-168097762 AATTTGGATAGTGTTTTTGGAGG - Intergenic
966187285 3:177239186-177239208 GATTTGATTAGTGGTTTCAGAGG - Intergenic
966316919 3:178657701-178657723 TATTTGGCTGATGGTTCTAGAGG + Intronic
967128852 3:186452107-186452129 GCTTTGGAAGGTGGTTGTGGTGG - Intergenic
967349627 3:188498370-188498392 GAGTAGAATGGTGGTTTCAGGGG - Intronic
967617950 3:191595917-191595939 TATTGTGATGGTGGTTTTATGGG - Intergenic
967772857 3:193353880-193353902 AGTTTGGATGGTGGTTTTGGTGG - Intronic
970237719 4:13975488-13975510 TATTTGGAGGTGGGTTTTAGAGG - Intergenic
970333593 4:15007640-15007662 GAGTTGGGTGGTGGTGGTAGTGG + Intronic
971273381 4:25172288-25172310 GATTTGGAAGGTGGATCTGGTGG + Intronic
974013963 4:56632308-56632330 GATTTGGCTGGTGGCCTCAGAGG - Intergenic
974108824 4:57502440-57502462 GATATGCATACTGGTTTTAGAGG - Intergenic
974665762 4:64959592-64959614 GATTTGGATTTTGCTTTGAGTGG + Intergenic
974820321 4:67059175-67059197 GATTTAGATAGTGGTTTGCGTGG - Intergenic
974943204 4:68493347-68493369 TATTTTGATGGTGATATTAGAGG + Intronic
974984216 4:68999113-68999135 GATCTGGATAGTGGTGATAGTGG + Intergenic
974994227 4:69132705-69132727 GTTTTTTTTGGTGGTTTTAGTGG + Intronic
975590303 4:75993219-75993241 GATTGTGATGATGGTTTTATGGG - Intergenic
976603959 4:86965033-86965055 GATGTGGAGGGTGGTTATAATGG + Intronic
976660763 4:87537919-87537941 GAATTGGATAGTGGTGGTAGTGG - Intergenic
978096493 4:104785328-104785350 GAGTAGGATGGTGGTTATAAGGG - Intergenic
979047817 4:115892514-115892536 AACTTGGATGGTGTTTTCAGGGG + Intergenic
979218385 4:118193267-118193289 TGGTTGGATGGTGGCTTTAGGGG - Intronic
979945309 4:126823649-126823671 GAAGTGGGTGGTGGTTTTATGGG + Intergenic
980148853 4:129022117-129022139 GCTTTGGATGGGGCTTTTTGTGG - Intronic
981206810 4:142051469-142051491 GACTTGGGTGGTGGTTTCATCGG + Intronic
982098279 4:151943321-151943343 TATTTCAATGGAGGTTTTAGTGG + Intergenic
984035477 4:174662602-174662624 GATTTAGATAGTAGTTTTAAAGG + Intronic
984789224 4:183599502-183599524 TATTTGGCTAATGGTTTTAGAGG - Intergenic
986927173 5:12769278-12769300 TATTTGGATCATGGTTCTAGAGG - Intergenic
988495838 5:31745272-31745294 TATCTGGATGGTGGTGTTATTGG - Intronic
988795350 5:34648395-34648417 GATTTGCATGTTTGTTTGAGAGG - Intergenic
988936541 5:36089012-36089034 GACTTCGGTGGTGGTTTTACAGG - Intergenic
989122166 5:38015766-38015788 GCTTTGGATGCTGTTTTTAAAGG - Intergenic
989237814 5:39169815-39169837 GGTTTTGATGGTGGTTATACTGG + Intronic
989554622 5:42778877-42778899 ATTTTGGATTTTGGTTTTAGAGG - Intronic
989592451 5:43124260-43124282 GATTTTGATGCTGGTGGTAGGGG - Intronic
990004946 5:50935082-50935104 GATTTGGATCATGGTTTTGTAGG + Intergenic
991140201 5:63231721-63231743 GATTTGGATGGAGGAGGTAGAGG + Intergenic
992171994 5:74112000-74112022 GATCTGGGTGGTGGTTGTATGGG + Intergenic
992383190 5:76258758-76258780 GATTTGGGTGGTGGTTACATGGG - Intronic
992429847 5:76699140-76699162 GAATAGAATGGTGGTTTCAGAGG - Intronic
993400533 5:87444836-87444858 GTATTGGATGCTGGTTATAGTGG + Intergenic
993403567 5:87483667-87483689 GATTTTGGTGATGGTTTTATAGG - Intergenic
995570816 5:113479377-113479399 GATTTTGGTGGTGGTTAAAGGGG + Intronic
996428958 5:123349058-123349080 TTTTTGGAGGGTGGTTTTGGGGG - Intronic
998649028 5:144096870-144096892 GATCTGGATGGTGGTTACACAGG - Intergenic
998686177 5:144529311-144529333 GAGTAGAATGGTGGTTATAGAGG + Intergenic
999509321 5:152231649-152231671 GATTGGGATGGTGGTTACATGGG - Intergenic
999782661 5:154862503-154862525 GATTTGCATTGTGGTTTTTAGGG + Intronic
999839560 5:155410802-155410824 GATCTGGATGGTGTTTCTTGAGG + Intergenic
999962666 5:156773883-156773905 GATTTGGATGGTGATATTGTAGG + Intergenic
1000732059 5:164847218-164847240 GATTGTGATGATGGTTTTACAGG - Intergenic
1001809108 5:174613542-174613564 GATTGGGATGGTGCTTCTACAGG + Intergenic
1003240654 6:4342989-4343011 GGTTGGGGTGGTGGTTTTACTGG + Intergenic
1003554992 6:7131351-7131373 GATTTGGAAGGTGGCATTTGGGG + Intronic
1003655306 6:8001668-8001690 GAGGTGGCTGGTGGTTTCAGGGG + Intronic
1005396090 6:25383240-25383262 GGCTCGGATGGTGGTTTTTGAGG + Intronic
1006625193 6:35392681-35392703 GATTTGGGTGGAGGTTCTTGAGG + Intronic
1007640666 6:43336960-43336982 GATTTGTCTGGTGTTTTAAGGGG + Exonic
1009950518 6:70390081-70390103 GACTTGGATGGTGGTTAAATGGG + Intergenic
1010739005 6:79477523-79477545 GATATGGATAGTTGTTTCAGAGG - Intergenic
1011119973 6:83942064-83942086 CATTTGAATTGTGGTTATAGAGG + Intronic
1013486838 6:110605356-110605378 GATTTGGATTTTGGTTATATGGG + Intergenic
1014164165 6:118204727-118204749 GATTTGGATACTGGTTACAGAGG - Intronic
1017603780 6:156111523-156111545 GATTTGAATAGGGGTTTTATTGG + Intergenic
1019926243 7:4195031-4195053 GATTTGCATCATGGTTTCAGTGG - Intronic
1020658717 7:10957156-10957178 GATGTGGATGGTGTTTATAAGGG + Intergenic
1023814301 7:43937922-43937944 GATTGGGATGGTGGTTGGGGAGG + Intronic
1025923224 7:65934551-65934573 GAGTAGAATGGTGGTTATAGAGG - Intronic
1027529102 7:79307938-79307960 GATTTCTATGGTGGTTAAAGAGG - Intronic
1031146876 7:118006535-118006557 GCTTTGGAAGGAGGTTCTAGAGG - Intergenic
1032649650 7:133863604-133863626 GATTTAGGTGGTGGTTATATGGG + Intronic
1033402439 7:141039419-141039441 GATTTGGAGGGTGGATGTGGGGG - Intergenic
1033436448 7:141337277-141337299 GATGGGGATGGTGGTGGTAGTGG - Intronic
1035027295 7:155834303-155834325 GAATTGGTTGGTGGTTTTCTGGG + Intergenic
1038606014 8:29005645-29005667 GATCTGGAGGGTGGTTATATGGG - Intronic
1039594707 8:38781128-38781150 GATTGGGATGGTGGTTGGAAGGG - Intronic
1040350201 8:46558676-46558698 TATTTGGATAGTGGTTATAGAGG + Intergenic
1042656010 8:71097345-71097367 GATTTGGATGGGGGTGATAGAGG - Intergenic
1042708219 8:71685138-71685160 GATTTGGATGGTAGTTTCCTGGG + Intergenic
1043620417 8:82184438-82184460 GATTTGGATGCTGGTTACATAGG + Intergenic
1043792978 8:84497107-84497129 GATATGGATGGAGGTTTTCATGG - Intronic
1044593254 8:93934360-93934382 TATTTTGATGGTGGTTATACAGG - Intergenic
1046212363 8:111093918-111093940 GATTTGGATGTATCTTTTAGGGG - Intergenic
1046231138 8:111360301-111360323 TGTTTTGATGGTGGTTGTAGAGG - Intergenic
1046588769 8:116180293-116180315 CATTTGGATTGTGGTATCAGTGG - Intergenic
1046992314 8:120472545-120472567 GATTTGGAGGCTGGGTTCAGTGG + Intronic
1047887563 8:129268799-129268821 GATATGGATGCTGGTTATACAGG - Intergenic
1048403775 8:134097445-134097467 GATTTGGATTGTGGTACTAGTGG + Intergenic
1049421804 8:142520045-142520067 GATTGTGATGGTGGTGATAGTGG + Intronic
1050715946 9:8525764-8525786 GATTTTGATGGGTGTCTTAGGGG - Intronic
1052431488 9:28372477-28372499 GAATAGAATGGTGGTTATAGAGG + Intronic
1054734975 9:68741869-68741891 GATTTGGGTGGTAGTTGTTGGGG + Intronic
1055420001 9:76129536-76129558 TATTTGGGTGGTGGGTTGAGCGG + Intronic
1056844448 9:90025219-90025241 AATTTGGATGGAGGCTTTTGTGG + Intergenic
1057572349 9:96214310-96214332 GTTTTGTATGGTGGTTGTAGTGG - Intergenic
1058071755 9:100608549-100608571 GATTTGGATGCTTGTTTGATTGG + Intergenic
1058142169 9:101368274-101368296 GATTTGTTTGGTGGTTTGGGTGG - Exonic
1058249653 9:102675457-102675479 GATTTGGATTTTGGATTTTGGGG - Intergenic
1059739335 9:117134494-117134516 GATTTTGATGGAGGATTTTGTGG + Intronic
1059814478 9:117896523-117896545 GAGTAGGATGGTGGTTGTGGGGG + Intergenic
1061151679 9:128832189-128832211 TCTTTGGAAGGTGGTGTTAGGGG - Intergenic
1061511679 9:131065257-131065279 CTTTTGGAGGGTGGTTCTAGAGG - Intronic
1186190399 X:7062350-7062372 GATTTGGAAGGTGGATTTGAAGG + Intronic
1186639755 X:11443050-11443072 GATTTGGGTGGTCGTTATACAGG - Intronic
1187499793 X:19830301-19830323 GATCTGGGTGGTGGTTATAGAGG + Intronic
1189141586 X:38612605-38612627 GTTTTGCTTGCTGGTTTTAGTGG + Intronic
1189157941 X:38778768-38778790 GATTGGGATAGTGGTTACAGAGG - Intergenic
1189588843 X:42490342-42490364 GTTCTGGATGGAGGTTTTAAGGG - Intergenic
1189745122 X:44161119-44161141 CATTTGGGTGGTGGATTGAGTGG + Intronic
1190030319 X:46966074-46966096 GATTTGGAAGATTATTTTAGAGG + Intronic
1192127883 X:68518958-68518980 GATTTGGAAAGTGACTTTAGAGG - Intronic
1193591870 X:83398338-83398360 GATCTGTCTAGTGGTTTTAGTGG - Intergenic
1194807485 X:98347423-98347445 GGATGGGATGGTGGTTTTGGTGG + Intergenic
1194859652 X:98980842-98980864 GATTTGGGTGATGGTTTCATGGG - Intergenic
1197755077 X:129987695-129987717 GAATTGGAGGGTGGGGTTAGGGG + Intronic
1202299320 Y:23394926-23394948 GATTTGGGTAGTGGTTATACTGG - Intergenic
1202571489 Y:26275672-26275694 GATTTGGGTAGTGGTTATACTGG + Intergenic