ID: 1174846463

View in Genome Browser
Species Human (GRCh38)
Location 20:53948120-53948142
Sequence CTGGGCAAACAGAGGCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 742
Summary {0: 1, 1: 1, 2: 4, 3: 69, 4: 667}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174846463_1174846472 9 Left 1174846463 20:53948120-53948142 CCATCCTGCCTCTGTTTGCCCAG 0: 1
1: 1
2: 4
3: 69
4: 667
Right 1174846472 20:53948152-53948174 CCGTGGATCCTGGTTCACCCAGG 0: 1
1: 0
2: 3
3: 10
4: 78
1174846463_1174846469 -1 Left 1174846463 20:53948120-53948142 CCATCCTGCCTCTGTTTGCCCAG 0: 1
1: 1
2: 4
3: 69
4: 667
Right 1174846469 20:53948142-53948164 GCGTGCCTTGCCGTGGATCCTGG 0: 1
1: 0
2: 0
3: 4
4: 57
1174846463_1174846466 -8 Left 1174846463 20:53948120-53948142 CCATCCTGCCTCTGTTTGCCCAG 0: 1
1: 1
2: 4
3: 69
4: 667
Right 1174846466 20:53948135-53948157 TTGCCCAGCGTGCCTTGCCGTGG 0: 1
1: 0
2: 0
3: 2
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174846463 Original CRISPR CTGGGCAAACAGAGGCAGGA TGG (reversed) Intronic
900101546 1:964228-964250 GTGGGTAAACAGAGGGAGGAGGG - Intronic
900502890 1:3015295-3015317 CTGGAGGAACACAGGCAGGAGGG - Intergenic
900536303 1:3179397-3179419 CTGGGGAAACAGAGGCACAGGGG - Intronic
900909570 1:5585477-5585499 GAGGGCAAACAGTGGCAAGACGG - Intergenic
901042545 1:6374211-6374233 CAGCCCAAACAGAGGCGGGAGGG + Intronic
901504155 1:9673954-9673976 GTGGGCATGCAGAGACAGGAAGG + Intronic
901813797 1:11782446-11782468 CTGGGAAAAAAGGGGCATGAAGG + Intronic
902169267 1:14597917-14597939 ATGGGTAAACTGAGGCAGCAGGG + Intergenic
902481463 1:16714254-16714276 CTGGGCAAAGACTTGCAGGAAGG + Intergenic
902818770 1:18930814-18930836 CTGGGCAAATATAGACAGGAGGG - Intronic
903433899 1:23331724-23331746 CTGGGGAGGCTGAGGCAGGAGGG + Intronic
903574546 1:24330797-24330819 CAGGGCACACAGAGGCAGGAAGG - Intronic
903803200 1:25985215-25985237 CTGGGCAAACAGGCTCTGGAAGG - Intronic
904446125 1:30574252-30574274 CTGGGCCAAAGGAGGCAGGAAGG - Intergenic
904617865 1:31759746-31759768 CTGGCTATACACAGGCAGGAGGG - Intronic
904964548 1:34361298-34361320 ATGGGGAAAGAGAGCCAGGATGG + Intergenic
905077530 1:35286573-35286595 ATAGGCAGACAGAGGCAGGCAGG - Intronic
905253058 1:36662107-36662129 ATGGACAAACAGAGGCTGGGAGG - Intergenic
905415742 1:37802665-37802687 CTGGGGAAACCAAGGCAGGCAGG + Intergenic
906048637 1:42852423-42852445 TGGGGAAAACAGAGGCAGGTTGG - Exonic
906332347 1:44897070-44897092 CTGGGCAGAAAGAGGCATCATGG + Intronic
906760833 1:48376494-48376516 CTAGGCAAAAATAGCCAGGAAGG - Intronic
907277523 1:53325529-53325551 GTGAGGAAACTGAGGCAGGAGGG + Intronic
907304443 1:53505970-53505992 GTGGGCAAACTGAGGCTGGGAGG - Intergenic
907478622 1:54726878-54726900 CTTGGGAGACTGAGGCAGGAGGG - Intronic
907882691 1:58565874-58565896 CTGGGGAGGCTGAGGCAGGAGGG - Intergenic
907993380 1:59604956-59604978 CTGGGCAAAGAAAGGCAGAGTGG + Intronic
908582839 1:65535470-65535492 GTGGGGACACTGAGGCAGGAGGG - Intronic
909131367 1:71741509-71741531 CTTGGCAAATACTGGCAGGAAGG - Intronic
910368692 1:86493302-86493324 CTGGGGAGACAGGGGCAGAAGGG + Intronic
910461024 1:87448080-87448102 TTGAGCCAACAGAGGCGGGAGGG - Intergenic
911083818 1:93959568-93959590 CTACGCAACCAGAGGGAGGAGGG - Intergenic
912236494 1:107856929-107856951 CTTGGCAGGCTGAGGCAGGAGGG + Intronic
912561855 1:110556647-110556669 CTGGGAAAACAGTGGCAGTTGGG + Intergenic
913124607 1:115773356-115773378 CTTGTGAAACAGAGGCAAGAGGG + Intergenic
915325844 1:155080799-155080821 CTGGGCCGGCAGAGGTAGGAGGG + Intronic
915360903 1:155285758-155285780 ATGGGCAAACAGCGGCATGTGGG - Exonic
915488892 1:156240812-156240834 CAGGGCAGCCAAAGGCAGGATGG + Intronic
915713043 1:157919613-157919635 GTGGGGAAGCAGAAGCAGGAGGG - Intergenic
915916073 1:159941756-159941778 CTGGGCAGGCGGAGGCAGGGAGG + Intronic
916014230 1:160734348-160734370 CTTGGCAAACAGAATGAGGATGG - Intergenic
916447012 1:164881645-164881667 GTGGGGAAAAAGAGGAAGGAAGG + Intronic
916983742 1:170167674-170167696 CTGGGCCAGGAGAAGCAGGATGG + Exonic
917505414 1:175622905-175622927 ATGGGGAAACAGAGGCACCAGGG - Intronic
919178221 1:194047272-194047294 GTGGGAAAACAGAAACAGGAGGG + Intergenic
920742889 1:208598150-208598172 CTGGGAAAAGAGATGGAGGAGGG + Intergenic
920957101 1:210629712-210629734 CTTTGAAAACAGAGGAAGGAAGG - Intronic
921095840 1:211886737-211886759 TTAGGAAGACAGAGGCAGGAGGG - Intergenic
921626101 1:217379514-217379536 GAGGGCAAACAGAAGCAGGGTGG + Intergenic
922085513 1:222343253-222343275 CTGGGGAAAGGGAGTCAGGAAGG + Intergenic
922473518 1:225890705-225890727 CTGGCCCACCAGGGGCAGGAGGG - Intronic
922474739 1:225899174-225899196 CTGGCCTATCAGGGGCAGGAGGG + Intronic
922551690 1:226498769-226498791 AAGAGCAAAGAGAGGCAGGAGGG + Intergenic
922789493 1:228303362-228303384 CTGGGTAGGCAGAGGTAGGAAGG - Intronic
923544766 1:234916119-234916141 CAGGGCAAACAAAGTTAGGAAGG - Intergenic
923669587 1:236029067-236029089 CTTGGGAAGCTGAGGCAGGAGGG + Intronic
924255724 1:242180873-242180895 CTTGGGAAGCTGAGGCAGGAGGG + Intronic
924445622 1:244127784-244127806 CTGGGGATACAGAGGAAGGTGGG - Intergenic
924497441 1:244603761-244603783 TTTGGGAATCAGAGGCAGGAGGG + Intronic
1063362376 10:5469001-5469023 CAGGGGAAACAGACCCAGGAGGG + Intergenic
1063977916 10:11431740-11431762 CTGAGCAGACAGAGGCATGATGG + Intergenic
1064025569 10:11846092-11846114 CTTGGGAGACTGAGGCAGGAGGG - Intronic
1064267680 10:13838191-13838213 CTGGGAAGCCTGAGGCAGGATGG - Intronic
1064366618 10:14714311-14714333 CTGAGCTAACAGAGGCTGTAGGG - Intronic
1064974196 10:21096619-21096641 CTGGGAAAACTGAGGCAGGAGGG - Intronic
1065695301 10:28374272-28374294 CTGGGCAAAGAGAGGGTGGATGG - Intergenic
1065857984 10:29845892-29845914 CTGGGGAGGCAGAGGCAGGAGGG - Intergenic
1066127295 10:32354188-32354210 CTTAGCAAACAGTAGCAGGATGG + Intronic
1066700553 10:38123122-38123144 CAGGGCAAAGAGAGGGGGGAAGG + Exonic
1067380972 10:45773024-45773046 AGGGGCAACCTGAGGCAGGAGGG + Intronic
1067412097 10:46073875-46073897 CTGGGGAGGCTGAGGCAGGAGGG + Intergenic
1067808421 10:49409013-49409035 CTGGGCACAGAGAGGCAGCTGGG - Intergenic
1067888671 10:50113663-50113685 AGGGGCAACCTGAGGCAGGAGGG + Intronic
1068297884 10:55098565-55098587 CTTGGCAAATAGAGGGAAGATGG - Intronic
1068778148 10:60890044-60890066 CTGAGGAAACTGAGGCAGAAAGG + Intronic
1069580308 10:69561354-69561376 CTGGTCAAGCAAAGGCATGAAGG - Intergenic
1070914430 10:80144046-80144068 CTGGGGAAACTGAGGCAGGTAGG + Intronic
1071407168 10:85348338-85348360 CTGAGAAAACAGATGCAAGAAGG + Intergenic
1072486991 10:95865019-95865041 GTGGGCCAACAGACCCAGGAGGG - Intronic
1072727345 10:97822585-97822607 CTGGGCAAACTGAGCCACTATGG + Intergenic
1072730687 10:97844261-97844283 CAGGGCAAACAGAGAGGGGATGG - Intergenic
1072735373 10:97875607-97875629 CTGGGCACAGGGAGGCAGGGAGG + Intronic
1072829943 10:98647162-98647184 CTTGGCTGACAGAGACAGGAAGG - Intronic
1073111893 10:101067421-101067443 CCGGACAAACCGGGGCAGGAAGG + Intronic
1073125338 10:101145833-101145855 CTGGGCACAGTGAGGCTGGAGGG - Intergenic
1073347549 10:102795434-102795456 CTGGGAAAGCGGAGGCAGAACGG + Intronic
1073440389 10:103549225-103549247 CTGAGCAAACAGAACCTGGATGG - Intronic
1073793857 10:106966704-106966726 GTGGAGAAACAGAGTCAGGAGGG - Intronic
1074232980 10:111556032-111556054 CTGGGCAAGCAGGGGCACAAAGG + Intergenic
1074438623 10:113455622-113455644 ATGGGGAAACAGACTCAGGATGG - Intergenic
1074532067 10:114305009-114305031 GAGGGCACACAGATGCAGGAGGG + Intronic
1074541635 10:114370040-114370062 ATGGGGAAACAGAGTCAGGGAGG - Intronic
1074780444 10:116798358-116798380 CTGGGCAAACAGGGACAAGTTGG + Intergenic
1074941215 10:118237326-118237348 CTGGGGGACCAGAGGCTGGAAGG - Intergenic
1074969993 10:118528286-118528308 CTTGGGAAGCTGAGGCAGGAGGG - Intergenic
1075023058 10:118965373-118965395 CTGGGCTATCTGAGCCAGGAGGG + Intergenic
1075257770 10:120939182-120939204 CTGGTGACACTGAGGCAGGAGGG - Intergenic
1075261502 10:120967272-120967294 CTTGGAAGACAGAGACAGGAGGG - Intergenic
1075335291 10:121604509-121604531 CAGGGCACACAGAGGGATGATGG + Intergenic
1075345914 10:121681880-121681902 AAAGGCACACAGAGGCAGGATGG - Intergenic
1076141289 10:128080398-128080420 CTGTGCATAGAGAGGCAGGAAGG + Intronic
1076533393 10:131160343-131160365 CTGGGAGCACAGAGGAAGGATGG - Intronic
1076729203 10:132429813-132429835 CTGGGCAGGCAGGGGCAGGGTGG + Intergenic
1077031237 11:468896-468918 CTGGGTAATCGGAGGGAGGAGGG + Intronic
1077034706 11:489033-489055 CGGGGCACCCACAGGCAGGAGGG - Intronic
1077126104 11:937965-937987 CCAGGCAATCAGAGGCAGAAAGG - Intronic
1077444775 11:2585836-2585858 CTGGAGCAACAGGGGCAGGAAGG + Intronic
1077485001 11:2834597-2834619 CTGTGCGAGCAGAGGCAGGGAGG + Intronic
1077532463 11:3103651-3103673 AGGGGGCAACAGAGGCAGGAAGG - Intronic
1077532518 11:3103867-3103889 ATGGGGCTACAGAGGCAGGAAGG - Intronic
1077549972 11:3195841-3195863 CTGGGCAGTCAGAGGCAGCCTGG + Intergenic
1077889042 11:6405551-6405573 CTGGGCAACCAGACACAGCAGGG + Intronic
1078028527 11:7723691-7723713 CTGGGGAAACAAAAGAAGGAAGG - Intergenic
1078901850 11:15649938-15649960 CTGGGGACACAGGGGCACGAGGG - Intergenic
1079496034 11:21045088-21045110 CAGGGCAAGTAAAGGCAGGAGGG + Intronic
1079601377 11:22316158-22316180 CAGGGGAGACAGAGGCAGGAGGG - Intergenic
1080493601 11:32794478-32794500 CTTGGCAACCAGAGCAAGGAAGG + Intronic
1080615629 11:33942524-33942546 CTTGGAAGACTGAGGCAGGAAGG + Intergenic
1081121850 11:39276463-39276485 CTGGGCTACCAGAAGCTGGAAGG - Intergenic
1081534882 11:43989381-43989403 CTGGCCAAGCCTAGGCAGGAAGG - Intergenic
1081654826 11:44850295-44850317 CTTGGCAAATGGTGGCAGGAGGG - Intronic
1081811817 11:45918413-45918435 CTGGGGAAACTGAGGCAGTAAGG + Intronic
1082804872 11:57441516-57441538 CTGGGAAGGCTGAGGCAGGAGGG + Intergenic
1083477512 11:62923625-62923647 ATGGGGAAACTGAGGCAGGAGGG + Intergenic
1083635627 11:64119337-64119359 CTGGCCAAGCTGAGCCAGGATGG - Intronic
1083691748 11:64413498-64413520 CTGAGCAACCAGAGGAAGGATGG + Intergenic
1083946865 11:65928496-65928518 CTGGGGAGACTGAGGCAGAAAGG - Intergenic
1084323004 11:68384059-68384081 CTGGGGAAACTGAGGCAGGCAGG - Intronic
1084559029 11:69892405-69892427 ATGGGAAAACTGAGGCATGAGGG - Intergenic
1084687818 11:70707509-70707531 GTGGACAGACAGAGGCAGGAAGG + Intronic
1085071193 11:73547552-73547574 CTTGGGATGCAGAGGCAGGAGGG + Intronic
1085328538 11:75627497-75627519 CTGGCCAAACAGTAGGAGGAGGG + Intronic
1085510261 11:77084555-77084577 CTGGTCAAACAAAGGAAGGCAGG + Intronic
1085656284 11:78318220-78318242 CTGGTGGAACAGAGGCAGAAGGG + Intronic
1086972377 11:93097479-93097501 CTGAGCAAACACAGGCTGCAAGG - Intergenic
1088302507 11:108374062-108374084 CTGAGCCTACAGAGGCAGGCAGG - Intronic
1088421510 11:109653319-109653341 CTGGGCACTCAGTGGCTGGAAGG - Intergenic
1088644312 11:111904543-111904565 CTTGGGAAGCTGAGGCAGGAAGG + Intergenic
1089093198 11:115895834-115895856 CTGTGCAAACAAAGGCAGTAAGG - Intergenic
1089223060 11:116891371-116891393 CTTGGGAGACTGAGGCAGGAGGG + Intronic
1089350753 11:117820373-117820395 CTGAGAAGACAAAGGCAGGATGG + Intronic
1090296617 11:125593364-125593386 CTGGGAAACTAGAGGCAGGGTGG + Intronic
1090582759 11:128178079-128178101 CTTGGAAAACAGGGGCAAGATGG - Intergenic
1090976549 11:131684672-131684694 CTTCTCAAACAGAGGCAGGGAGG - Intronic
1091143720 11:133258820-133258842 CTGGGCAGGCAGGGGCAGGCTGG - Intronic
1091412595 12:253950-253972 CTGGGCTGAGATAGGCAGGAAGG + Intronic
1092265628 12:6978285-6978307 CTGGGAAGACAGTGGAAGGAAGG + Intronic
1092629031 12:10358826-10358848 GAGGGCAAACAGAAGCAGGGTGG - Intergenic
1092682834 12:11006488-11006510 CTTGGCAAGCTGAGGCAGGAAGG - Intronic
1093142323 12:15523665-15523687 CTTGGTAGACTGAGGCAGGAGGG + Intronic
1093903802 12:24665564-24665586 CTGGGGAAACAGAAGCAGAAAGG + Intergenic
1094490736 12:30959072-30959094 CTCGGCAGACAGAGGCAGGTAGG + Intronic
1095449463 12:42314707-42314729 CTGGGCAGGCTGAGGCAGGTGGG + Intronic
1095471075 12:42537405-42537427 TTTGGGAGACAGAGGCAGGATGG - Intronic
1096216118 12:49798341-49798363 CTGGGCAGAGAGAGGTAGGAGGG - Exonic
1096484610 12:51970209-51970231 CTTGGCACACAGAGCCAGCAGGG - Intronic
1096524151 12:52200707-52200729 GAGGGCAAACAGTGCCAGGAGGG + Intergenic
1096620430 12:52861210-52861232 CTGGGCACAGCCAGGCAGGAGGG + Intergenic
1097192098 12:57224466-57224488 CTGAGCAAACTGAGCCAGGGAGG - Intronic
1097328268 12:58303933-58303955 TTTGGAAAACTGAGGCAGGATGG - Intergenic
1097474781 12:60039675-60039697 CTAGGCAAAAAGAGGATGGATGG + Intergenic
1097746749 12:63311634-63311656 CTGGGCTTACAGAGGGAGAAAGG + Intergenic
1098349409 12:69541715-69541737 CTCGGGAGACTGAGGCAGGATGG + Intronic
1098389710 12:69956605-69956627 CTGGGCAAGCAGAGGGAGAGAGG - Intronic
1099107809 12:78518769-78518791 GAGGGCAAACAGAAGCAGGGTGG + Intergenic
1099239015 12:80116345-80116367 GAGGGCAAGCAGAAGCAGGATGG - Intergenic
1100102574 12:91126706-91126728 CTGGGCAAACAGAAGAGGGAGGG + Intergenic
1100263039 12:92950595-92950617 CTGGGCAACAAGAGCCAGGAAGG + Intergenic
1101439001 12:104688928-104688950 CTGGGCAAGAAGGGGCAAGAAGG + Intronic
1101923944 12:108955884-108955906 ATGAGAAAACAGATGCAGGAAGG + Intronic
1102462448 12:113108273-113108295 CTGCGTAAACTGAGGCAGCAAGG + Intronic
1102466510 12:113133730-113133752 CTAGGGAAACTGAGGCAGGGTGG + Intronic
1102473984 12:113176778-113176800 CTGGGAAAGCAGAGGCAGAGAGG - Intronic
1102596647 12:113998043-113998065 CTTGGGAGGCAGAGGCAGGAGGG - Intergenic
1102784448 12:115592826-115592848 GTGGGCAAACAGCTGGAGGATGG - Intergenic
1103367687 12:120394957-120394979 TTGGGGATGCAGAGGCAGGAAGG + Intergenic
1103509720 12:121466589-121466611 GTGGGCAGACGGAGACAGGAAGG - Intronic
1103610908 12:122123805-122123827 CTGGGGAGACTGAGGCAGGAAGG - Intronic
1103659395 12:122501354-122501376 CTCGGCAAGCTGAGGCGGGAGGG + Intergenic
1104091091 12:125518364-125518386 CTAGGCCCCCAGAGGCAGGAAGG + Intronic
1104260849 12:127180733-127180755 TTTGGAAAACAGAGGCAGGGGGG - Intergenic
1104380323 12:128301688-128301710 CTTGGCAAACAGATGCAGAATGG + Intronic
1104598981 12:130139636-130139658 CTGGGTTAAGTGAGGCAGGAGGG - Intergenic
1104871675 12:132003101-132003123 CTTGGGAGACTGAGGCAGGATGG + Intronic
1104977363 12:132558131-132558153 CTGGGCAAAGCCAGCCAGGAGGG - Intronic
1105208553 13:18243279-18243301 CTTGGCAGGCTGAGGCAGGAGGG + Intergenic
1106014111 13:25851948-25851970 CTCAGGAAACTGAGGCAGGACGG - Intronic
1106042063 13:26103094-26103116 GAGGGCAAGCAGAAGCAGGATGG + Intergenic
1106925083 13:34605437-34605459 TTGAGAAAACAGAAGCAGGAAGG + Intergenic
1108094377 13:46885291-46885313 CTGGGTAATACGAGGCAGGATGG + Intronic
1110332515 13:74288838-74288860 CTGACAGAACAGAGGCAGGAAGG - Intergenic
1112219196 13:97470843-97470865 GTGGGGATACAGAGGCAGGTTGG + Intergenic
1112412919 13:99179340-99179362 CTGGGCAAACGGAGGGAAGCAGG - Intergenic
1112580112 13:100671238-100671260 CTTGGGAGACCGAGGCAGGAGGG - Intronic
1112763707 13:102718610-102718632 CTGTGGAAACAGAGCCAGGTTGG + Intergenic
1113718507 13:112533218-112533240 CTGGGCAGACACAGCCAAGAGGG + Intronic
1114246464 14:20919269-20919291 TTGGGCCAGCAGAGCCAGGAGGG - Intergenic
1114600644 14:23953473-23953495 GTGGGCAAGCAGATGCAGAAAGG + Intergenic
1114610328 14:24036164-24036186 GTGGGCAAGCAGATGCAGAAAGG + Intergenic
1114651949 14:24290893-24290915 TTGGGCACACGGAGGAAGGAGGG + Exonic
1115827226 14:37291774-37291796 AAGGGCAAAAAGAGGCAAGAGGG + Intronic
1116324735 14:43518231-43518253 ATCGGCAAACAGAGGCAGTTTGG - Intergenic
1116618722 14:47172183-47172205 CGGGGCCTACAGAGGCAGGCAGG - Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117139649 14:52775772-52775794 CTGGGGAGGCTGAGGCAGGAGGG + Exonic
1117339027 14:54778169-54778191 CTGGCAAAAGAGTGGCAGGAAGG - Intronic
1117658750 14:57983058-57983080 GTGGGCAGACAGAGCCAGGTTGG - Intergenic
1117940473 14:60959024-60959046 CTTGGGAGACTGAGGCAGGAGGG - Intronic
1118615150 14:67569928-67569950 CAGGGGAAACAAGGGCAGGAGGG - Exonic
1118971889 14:70643751-70643773 CTGGGAAGACAGAGGTAGGCTGG - Intronic
1119401452 14:74365405-74365427 CTGGGGGAACAGAGATAGGAGGG + Intergenic
1119662095 14:76459410-76459432 CTGGAGAAACAGAGGGTGGAGGG + Intronic
1120061608 14:79989948-79989970 CTTGGGAAACTGAGGCAGGAGGG - Intergenic
1120228799 14:81820648-81820670 ATGGCCAGATAGAGGCAGGATGG - Intergenic
1120271863 14:82322389-82322411 GTGGGCAAGCAGAAGCAGGGTGG - Intergenic
1122034321 14:98936406-98936428 CTGATAAAAGAGAGGCAGGAGGG + Intergenic
1122168752 14:99853343-99853365 CAGTGGAAACAGGGGCAGGAGGG + Intronic
1122386218 14:101350083-101350105 CTGAGCAAACAGGGGCAGCCAGG - Intergenic
1122487715 14:102092606-102092628 TGGGGCAGACAGGGGCAGGAGGG + Intronic
1122634600 14:103124045-103124067 TTGGGCCCACTGAGGCAGGAAGG - Intronic
1122707236 14:103629093-103629115 CTGGGGAAACTGAGGCTGGGTGG - Intronic
1122917935 14:104867354-104867376 CAGGGAACACAGAGGCAGGGCGG - Intronic
1123019782 14:105392270-105392292 CTGGAAACACAGAGGCAGGGGGG - Intronic
1126045460 15:44635496-44635518 CTGGGGATGCTGAGGCAGGAGGG + Intronic
1127205742 15:56716389-56716411 CTAGGCAAACAGGAGAAGGAAGG + Intronic
1127235226 15:57042654-57042676 TTTGGGAGACAGAGGCAGGAGGG - Intronic
1127276007 15:57444753-57444775 GTGGGAACACAGAGCCAGGATGG + Intronic
1127418027 15:58776295-58776317 ATGGGGAGACTGAGGCAGGATGG - Intronic
1127523009 15:59761937-59761959 CTGGGGAGGCTGAGGCAGGAAGG - Intergenic
1127969428 15:63946883-63946905 CTGGGCAACCTGAGAAAGGAAGG + Intronic
1128134845 15:65255196-65255218 CTGGGAATGGAGAGGCAGGAAGG - Intronic
1128518526 15:68359977-68359999 CTGAGCAGACAGAGGAAGGTGGG + Intronic
1128602675 15:69011025-69011047 CTCGGGAGACTGAGGCAGGAGGG + Intronic
1128687951 15:69700852-69700874 ATGGGAAAACAGAGGCTGTAGGG - Intergenic
1128709532 15:69861317-69861339 GTGGGGAAACTGAGGCTGGAAGG + Intergenic
1129681664 15:77661759-77661781 CTGAGCAAACAGAGACAGCATGG + Intronic
1129699154 15:77757682-77757704 CAGGGCAAAGAGAGCCAGCAGGG + Intronic
1129876450 15:78978789-78978811 CAGGGCACACAGAGGAGGGAGGG - Intronic
1129885838 15:79036420-79036442 GTGGAGAAACAGAGGCGGGAGGG - Intronic
1129968538 15:79757813-79757835 CTGGGGGACCAGAGGCAGCACGG + Intergenic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1131040922 15:89266102-89266124 CTTGGGAAGCAGAGGCTGGAGGG - Intronic
1131059232 15:89394372-89394394 CTGAGCAAACAGAGCCACCAAGG - Intergenic
1131314154 15:91318038-91318060 CTGTGGAAGCAGAGGCTGGAGGG - Intergenic
1132147507 15:99437377-99437399 CTGGGCAGACACAGAGAGGAGGG - Intergenic
1132332296 15:101021204-101021226 CTGGGCCAGCAGAGCCAGCACGG - Intronic
1132686497 16:1164437-1164459 CTGGGGAGGCTGAGGCAGGAGGG - Intronic
1132714005 16:1281734-1281756 GTGGGGAAACTGAGGCTGGAGGG - Intergenic
1132761519 16:1510733-1510755 CCGGGCACCCAGAGGCAGGTGGG + Exonic
1132833478 16:1941171-1941193 TGGGGCAAGCAGAGGGAGGAAGG + Intronic
1134101048 16:11451782-11451804 CTGGGGAAACTGAGGCAGACAGG + Intronic
1135660405 16:24291720-24291742 ATGAGGAAACTGAGGCAGGAGGG - Intronic
1136173509 16:28502509-28502531 CTGGGCACATGGAGGAAGGATGG - Intronic
1136251865 16:29010652-29010674 CTTGGAAAGCTGAGGCAGGAGGG + Intergenic
1136999223 16:35214908-35214930 CTGGCCAACCAGATGCAGCAAGG - Intergenic
1137400975 16:48154224-48154246 CTGGACAGGCAGAAGCAGGAAGG + Intronic
1137670381 16:50274978-50275000 ATGGGGAAACTGAGGCAGGTGGG + Intronic
1137845000 16:51678370-51678392 ATGGATAATCAGAGGCAGGAGGG - Intergenic
1138345072 16:56315706-56315728 CTGGGCCCCCAGAGGCAGGGGGG - Intronic
1138495889 16:57409181-57409203 CTGGGGACATAGAGGAAGGAAGG + Intronic
1138971658 16:62151494-62151516 CTGGTCTAATAGAGGAAGGAAGG - Intergenic
1139052674 16:63145373-63145395 CTTGGGAGACTGAGGCAGGAGGG - Intergenic
1139586941 16:67909951-67909973 GTGGGAAAAGTGAGGCAGGAAGG + Intronic
1139853442 16:69963753-69963775 TTGGGCAGAGAGAGGCAGGGAGG + Exonic
1139882413 16:70186662-70186684 TTGGGCAGAGAGAGGCAGGGAGG + Exonic
1140107379 16:71973176-71973198 CTGGGCAAAAGGAGGGAGGAGGG - Intronic
1140370097 16:74408842-74408864 TTGGGCAGAGAGAGGCAGGGAGG - Exonic
1140467795 16:75196284-75196306 CTGTGCAAGCAGAGTCATGATGG - Intergenic
1141768430 16:86073916-86073938 CTGGGCAAGCAGGGGCAGCCAGG - Intergenic
1141894337 16:86948936-86948958 ATGGGGAAACTGAGGCATGAGGG + Intergenic
1142127891 16:88419288-88419310 GTGGGCAGCCAGAGGCCGGAGGG + Intergenic
1142368778 16:89666123-89666145 CTGGAAAACCAGAGGCATGAGGG + Intronic
1142655983 17:1394496-1394518 CTAGGGAAGCTGAGGCAGGAGGG + Intronic
1142923039 17:3207765-3207787 CTGGAGAAGCAGTGGCAGGATGG - Intergenic
1144457622 17:15432075-15432097 CTGGACCAGCAGAGGTAGGATGG - Intergenic
1144551455 17:16244780-16244802 CTCGGGAGACTGAGGCAGGAGGG - Intronic
1144725515 17:17499987-17500009 CTGTGCAAGCAGGAGCAGGACGG + Intergenic
1144825060 17:18101116-18101138 GTGTGCAAGCAGAGGCAGGATGG + Intronic
1144852067 17:18248884-18248906 CTGGACAAGAAGGGGCAGGAAGG + Intronic
1146255236 17:31388494-31388516 CTAAGCAAAGGGAGGCAGGAGGG + Intergenic
1146373478 17:32279762-32279784 ATGGAGAAACAGAGGCAGGGTGG + Intronic
1146669903 17:34729918-34729940 CTTGGGAGACTGAGGCAGGAAGG + Intergenic
1146789997 17:35745743-35745765 CTGGGCCTACAGGAGCAGGAGGG - Exonic
1146825838 17:36022828-36022850 CCAGGCAAACAGAGTCTGGAGGG - Intergenic
1147148433 17:38499229-38499251 CTCGGCAAAGAGAGGCCGCAGGG - Intronic
1147156205 17:38545562-38545584 ATGGGAAAACTGAGGCAGGGAGG + Intronic
1147192652 17:38747039-38747061 CTGGGGAGACTGAGGCAGCATGG + Intronic
1147325772 17:39668683-39668705 CGGGGGAAACTGAGGCACGAGGG + Intronic
1148049186 17:44760767-44760789 CTGGGCAGAGGGAGGAAGGAGGG + Intronic
1148905067 17:50906804-50906826 CTGGGCGGGCAGAGGCAGAAGGG - Intergenic
1149446055 17:56714266-56714288 CTGGGCAAAGAGACATAGGAAGG + Intergenic
1150510928 17:65752383-65752405 CTGGGCAAACTGATCCAAGAGGG - Intronic
1151161217 17:72167355-72167377 CTGTGGAAGCAGTGGCAGGAGGG - Intergenic
1151633271 17:75325955-75325977 CTTAGCAAACAGCGGCACGATGG - Exonic
1151732422 17:75919455-75919477 CTGCTCTTACAGAGGCAGGAGGG - Intronic
1151785810 17:76274369-76274391 CTGGGCTGACACAGGCTGGAGGG + Intronic
1151930515 17:77229012-77229034 CCGGTCACACAGAGGTAGGAAGG - Intergenic
1152154788 17:78625870-78625892 GTCTGCAAACAGAGGCAGGTAGG + Intergenic
1152157052 17:78641353-78641375 ATTGGCAGTCAGAGGCAGGAGGG - Intergenic
1152376266 17:79920325-79920347 CTGGGACAATAGAGGCAGCAAGG + Intergenic
1152510278 17:80782152-80782174 CTCTGCAAACAGGGACAGGAGGG - Intronic
1152573408 17:81130212-81130234 CTGGGAACACAGAGGCAGGAGGG - Intronic
1152905025 17:82965298-82965320 CTGGGACAACAGAGGGAGAAGGG - Intronic
1153498090 18:5720948-5720970 CTAGGAAGACTGAGGCAGGAGGG - Intergenic
1154072554 18:11165882-11165904 GCAGGGAAACAGAGGCAGGAAGG + Intergenic
1155152336 18:23133260-23133282 CTGGGGAGGCTGAGGCAGGAGGG - Intergenic
1155225841 18:23728351-23728373 ATGGGCCAACAGAGGCAGCTGGG - Intronic
1155488573 18:26373788-26373810 CTGGGTGAACAGAGGGAGGGAGG - Intronic
1155857432 18:30850569-30850591 GAGGGCAAGCAGAAGCAGGATGG - Intergenic
1157382545 18:47232560-47232582 CTGGGGACACAGAGGAGGGATGG - Intronic
1157452787 18:47800858-47800880 TTGGGAAAACAGAGGCTGGCTGG + Intergenic
1157614072 18:48976445-48976467 CGGGGGAAACTGAGGCCGGAGGG - Intergenic
1158367696 18:56757172-56757194 ATGGGAAAACAGAAGTAGGAAGG + Exonic
1159913412 18:74167218-74167240 CTGGGCACACAGAGACACCAGGG + Intergenic
1160327865 18:77967347-77967369 CTGGGCACACAGAGTCACCAAGG + Intergenic
1160389415 18:78518860-78518882 CTGTGCCCACAGAGCCAGGATGG + Intergenic
1160694821 19:478373-478395 ATGGGGAAACGGAGGCAGGTGGG - Intergenic
1161552304 19:4920659-4920681 CTTGGCAGACTGAGGCTGGAGGG - Intronic
1161642859 19:5435301-5435323 CTGGACCCACAGTGGCAGGAGGG - Intergenic
1161785841 19:6325086-6325108 ATGGGCAGAGAGAGCCAGGAAGG - Intronic
1162509735 19:11110834-11110856 ATGGGGAAACTGAGGCATGAGGG - Intronic
1162794254 19:13078462-13078484 CTGGGCAAGGAGCAGCAGGAGGG + Intronic
1162887656 19:13708004-13708026 GTTGGCAGAAAGAGGCAGGAGGG - Intergenic
1162895241 19:13761521-13761543 CTCGGCATACAGTGGCAGGCAGG - Intronic
1163125913 19:15244173-15244195 ATGGGTAAACCGAGGCAGGAAGG + Intronic
1163511633 19:17739143-17739165 CTGGGCAAACAGTGTCAGGTGGG + Intergenic
1163588177 19:18175234-18175256 CTGGGGAAACTGAGGCACGTGGG + Intronic
1163674486 19:18648625-18648647 CTGAGCAAGGAGAGGCATGAAGG - Intronic
1164393800 19:27846798-27846820 CTGGACAAACAGATACTGGAGGG + Intergenic
1164566530 19:29329741-29329763 CTGGGGAAACAGAGCCAAGCTGG + Intergenic
1164960465 19:32424210-32424232 CTTGGGAAGCTGAGGCAGGAGGG + Intronic
1165333683 19:35154975-35154997 CTGGGGAGACTGAGGCAGGCGGG - Exonic
1165369948 19:35398786-35398808 TTGGGAGAACAGAGGAAGGAAGG - Intergenic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1165797407 19:38526970-38526992 CTGGGGAGACAGAGCCAGGCTGG - Intronic
1165858219 19:38893009-38893031 CTGGCCAATCAGAGGCATGGGGG + Intronic
1166075775 19:40413109-40413131 ATGGGGAAACAGAGGCACAAAGG + Intronic
1166178202 19:41089285-41089307 CGGGGCAGAGAGAGGCAGGGAGG - Intronic
1166750361 19:45161595-45161617 CAGGGCACACAGAGGCAGGGCGG + Intronic
1166851581 19:45763948-45763970 CTGGGGAGACGGTGGCAGGATGG - Intronic
1166894103 19:46012957-46012979 CTGGGAAGGCTGAGGCAGGAAGG - Intronic
1166944566 19:46388955-46388977 CTGGGCAATCAGTGGGAGAAAGG - Intronic
1167557351 19:50204535-50204557 ATGTGGAAACTGAGGCAGGAAGG - Intronic
1167688530 19:50971053-50971075 CTGGGAAGACTGAGGCGGGAGGG - Intergenic
1168062916 19:53903633-53903655 CTGGGGAGGCTGAGGCAGGAGGG + Intronic
1168575354 19:57504475-57504497 CTGAGCAAGCAGAGGCAGGTAGG - Intronic
1202715503 1_KI270714v1_random:40165-40187 CTGGGCAAAGACTTGCAGGAAGG + Intergenic
924960931 2:33849-33871 CCGTGCAGGCAGAGGCAGGAAGG - Intergenic
925542324 2:4979303-4979325 CTGGGCTCAGAGAAGCAGGAAGG - Intergenic
925913110 2:8586211-8586233 CTGAGGAAACAGAAGCATGACGG + Intergenic
926726803 2:16004910-16004932 ATGGGGAAACCGAGGCTGGAAGG + Intergenic
926732994 2:16051197-16051219 CTGCGCAAACAGAAGCCGAAGGG - Intergenic
927192647 2:20527395-20527417 ATGGGGAAACTGAGGCAGTAGGG + Intergenic
928113107 2:28526158-28526180 CTGGGCAAACAGAAGCCAGTGGG + Intronic
928558867 2:32456997-32457019 CTTGGGAGACAGGGGCAGGAGGG - Intronic
929786932 2:45000213-45000235 CTGGGGAGACTGAGGCAGGGAGG + Intergenic
929834478 2:45382489-45382511 ATGGGGTAACAGAGGGAGGAAGG - Intergenic
930003176 2:46874958-46874980 CTGGATAAACTGAGGCAGGAAGG + Intergenic
930519342 2:52444407-52444429 GTGGGAACACTGAGGCAGGAGGG - Intergenic
932833617 2:75013577-75013599 CTGGGCACTGACAGGCAGGAGGG + Intergenic
934762801 2:96865633-96865655 CTGGGGACACCGAGGTAGGAGGG + Intronic
934983156 2:98864415-98864437 CTGGGGAAACACAGGTAGAATGG + Intronic
935110673 2:100091776-100091798 ATGGGCAAACTGATGGAGGAAGG - Intronic
935787238 2:106560333-106560355 CTGGGAAAAAAGAGGGAGGGAGG - Intergenic
936124298 2:109773386-109773408 ATGGGCAAACTGATGGAGGAAGG + Intergenic
936146050 2:109981267-109981289 CTGAGCAGAGAGAGGCAGGGTGG - Intergenic
936198640 2:110390212-110390234 CTGAGCAGAGAGAGGCAGGGTGG + Intergenic
936220391 2:110598078-110598100 ATGGGCAAACTGATGGAGGAAGG - Intergenic
936255094 2:110904440-110904462 CAGGAAAGACAGAGGCAGGAGGG - Intronic
936463151 2:112726159-112726181 CAGGGCAGACACAGGCAGGCAGG + Intronic
936727427 2:115337226-115337248 CTGGGCAAGTTGAGGCAGAATGG + Intronic
937241737 2:120466346-120466368 CTGTGCAAACAGACCCTGGAGGG + Intergenic
937260032 2:120579455-120579477 CTGGGAGAACCGAGGCACGATGG - Intergenic
937384333 2:121413863-121413885 CTGGGGACAGAGTGGCAGGAAGG + Intronic
937679899 2:124632897-124632919 CTGGGGGAAGAGAGGCAGGCAGG + Intronic
938261148 2:129895891-129895913 CAGGGCACACAGAGGAAGGAAGG + Intergenic
938341917 2:130541475-130541497 CTGAGCCAACACAGGAAGGAGGG + Intronic
938347915 2:130579236-130579258 CTGAGCCAACACAGGAAGGAGGG - Intronic
938580798 2:132645078-132645100 CTGGGCAGACACGAGCAGGAGGG - Exonic
940746957 2:157578008-157578030 CTTGGGAAGCTGAGGCAGGAGGG - Intronic
941640121 2:167978181-167978203 CTTGGCAGACAGAGGCTGCATGG + Intronic
942887693 2:180947691-180947713 CTTGGCAAACTGAAGCAGGCAGG + Intergenic
942922240 2:181389577-181389599 CTGAAGAAACAGATGCAGGAAGG - Intergenic
943129887 2:183841720-183841742 CTGGGGAAGCAGAAGCAGGGTGG + Intergenic
945482287 2:210357986-210358008 GAGGGCAAACAGAAGCAGGGTGG - Intergenic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
946023351 2:216656941-216656963 TTGTGCCCACAGAGGCAGGAAGG - Intronic
946203898 2:218089664-218089686 CTGTGCTCACAGAGGAAGGAGGG - Intronic
946653419 2:221918731-221918753 GTGGGTAAACAGAGGAAGGCAGG - Intergenic
947536473 2:230942961-230942983 CTAGGGGAACAGAAGCAGGATGG - Intronic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
947876640 2:233471881-233471903 CTGTGCAGAGAGAGGCAGGAAGG + Exonic
948251865 2:236535987-236536009 CTGGGCCAGCAGAGGGAGGTGGG + Intergenic
948826954 2:240577496-240577518 CTGGGAAGCCAGGGGCAGGAGGG + Intronic
948981133 2:241495420-241495442 CTGGGCCAGGAGAGGGAGGAGGG + Exonic
1168989214 20:2079893-2079915 TATAGCAAACAGAGGCAGGATGG + Intergenic
1169200151 20:3705363-3705385 CTGAGAAAACAGAGCCAGGCAGG + Intronic
1169458149 20:5770872-5770894 CATGGCAAACAGATTCAGGATGG + Intronic
1170032400 20:11956817-11956839 GTGGGACAGCAGAGGCAGGAGGG - Intergenic
1170414171 20:16122372-16122394 CTTAGGAAATAGAGGCAGGAGGG - Intergenic
1170975167 20:21157014-21157036 CTTGGGAGACTGAGGCAGGAGGG + Intronic
1171292948 20:23993097-23993119 CTTGGCAGGCTGAGGCAGGAAGG + Intergenic
1171294231 20:24003690-24003712 CCTGGCAAGCAGAGGCAGGGCGG - Intergenic
1172100257 20:32480983-32481005 CTGGGAAATATGAGGCAGGAAGG + Intronic
1172133686 20:32673230-32673252 CTGGAGCCACAGAGGCAGGAGGG + Intergenic
1172722631 20:37011968-37011990 CTGGGCAGGCTGAGGCAGGGAGG - Intronic
1172737617 20:37139739-37139761 CTTGGGAAGCTGAGGCAGGAGGG - Intronic
1172837520 20:37882568-37882590 CCGGGGACACAGAGTCAGGAGGG + Intergenic
1173139634 20:40470856-40470878 CTGGGAAAGCAGAGACAGGCGGG - Intergenic
1173341401 20:42155828-42155850 CAGGGACAACAGAGGCAGGTAGG - Intronic
1173461528 20:43246952-43246974 CTGGGAAGACACAGGCAGTATGG + Intergenic
1173658484 20:44717069-44717091 CTGGGGAAACTGAGGCACAATGG + Intronic
1174102359 20:48137407-48137429 CTGGGACCACAGAGGAAGGAGGG - Intergenic
1174435542 20:50503979-50504001 CTGGGTACACATAGCCAGGAAGG - Intergenic
1174559416 20:51419421-51419443 ATGGGAAAAAAGAGGAAGGAGGG - Intronic
1174846463 20:53948120-53948142 CTGGGCAAACAGAGGCAGGATGG - Intronic
1175018992 20:55824466-55824488 CTGGGAAAACTGAGGCATGGAGG - Intergenic
1175027652 20:55919456-55919478 CTGGGCAAACTGAGACAAGTTGG + Intergenic
1175159006 20:56994231-56994253 CTGGGCAAACATCAGCAGCAAGG + Intergenic
1175184953 20:57173817-57173839 GTGGGCAAACCGAGGCATGGAGG - Intronic
1175217679 20:57400138-57400160 ATGGGGAAACAGAGGCCGGAGGG + Intronic
1175378475 20:58546054-58546076 CTGGGAAAACTGAGACCGGAGGG - Intergenic
1176086174 20:63296568-63296590 CTGGGCAGACAGCGGCTGGTGGG - Intronic
1176164970 20:63668049-63668071 CTGGGCACACACTGGGAGGAGGG - Intronic
1176957605 21:15124190-15124212 CTGGGTAAACAGAGGTAAGACGG + Intergenic
1177435403 21:21045539-21045561 CTCGGAAAACTGAGGCAGGAGGG + Intronic
1178272954 21:31210115-31210137 TTGGGCAGACAGAACCAGGATGG + Exonic
1178467831 21:32864752-32864774 CTGGGAGAACAGTGGAAGGAAGG - Intergenic
1178928981 21:36800556-36800578 GTGAGGAAACAGAGGCAGGAAGG + Intronic
1179480303 21:41672544-41672566 ATGGAGAAACTGAGGCAGGACGG + Intergenic
1180721270 22:17910552-17910574 ATGGATGAACAGAGGCAGGATGG + Intronic
1180767709 22:18356062-18356084 CTTGGCAGGCTGAGGCAGGAGGG - Intergenic
1180778599 22:18506328-18506350 CTTGGCAGGCTGAGGCAGGAGGG + Intergenic
1180811324 22:18763636-18763658 CTTGGCAGGCTGAGGCAGGAGGG + Intergenic
1180824007 22:18850811-18850833 CTTGGCAGGCTGAGGCAGGAAGG + Intronic
1180931094 22:19592354-19592376 CTGTGGAAGCTGAGGCAGGAGGG - Intergenic
1181006026 22:20013978-20014000 CTGGGGAGACTGAGGCAGGAGGG - Intronic
1181097635 22:20516646-20516668 CTGGGCATCCCGAGGTAGGAAGG + Intronic
1181124434 22:20693964-20693986 CTTGGCAGGCTGAGGCAGGAGGG + Intergenic
1181188730 22:21123737-21123759 CTTGGCAGGCTGAGGCAGGAAGG - Intergenic
1181197476 22:21197891-21197913 CTTGGCAGGCTGAGGCAGGAGGG + Intergenic
1181210468 22:21286756-21286778 CTTGGCAGGCTGAGGCAGGAAGG + Intergenic
1181399041 22:22640135-22640157 CTTGGCAGGCTGAGGCAGGAAGG - Intergenic
1181443212 22:22949284-22949306 CAGGGCAACCAGGGGCAGGGTGG + Intergenic
1181501771 22:23319481-23319503 CTTGGCAGGCTGAGGCAGGAAGG - Intergenic
1181513888 22:23400852-23400874 CAGGGCAACCACAGGGAGGAGGG + Intergenic
1181630508 22:24148741-24148763 CTGTTCCAGCAGAGGCAGGAAGG + Intronic
1181650380 22:24255924-24255946 CTTGGCAGGCTGAGGCAGGAAGG + Intergenic
1181707000 22:24654814-24654836 CTTGGCAGGCTGAGGCAGGAAGG - Intergenic
1181772159 22:25133648-25133670 CTCGGGAAGCTGAGGCAGGAGGG - Intronic
1181803644 22:25362369-25362391 CTAGGGAAACGGAGGCAGGCAGG + Exonic
1181928946 22:26383801-26383823 CTGAGCTAAGAGAGGGAGGATGG - Intergenic
1182082709 22:27540437-27540459 CTCGGCAAACACCCGCAGGAAGG - Intergenic
1182364585 22:29769758-29769780 CTGGGCAAACAGCTGCTGGGTGG - Exonic
1182398428 22:30054881-30054903 CTGGACAAACAGATGCAGTGTGG + Intergenic
1182434503 22:30321688-30321710 CTGGGCGGACTGAGGCTGGATGG + Intronic
1182735433 22:32529509-32529531 CTGGCAAAACACAGGCGGGAGGG + Intronic
1183733609 22:39631489-39631511 TGGGGCAATGAGAGGCAGGAGGG + Intronic
1184080815 22:42218780-42218802 CAGGGAAAACAGATACAGGAAGG + Intronic
1184093543 22:42304680-42304702 CTGGGGAAACCGAGGCAGAGAGG + Intronic
1184400405 22:44270620-44270642 GTGGTCTCACAGAGGCAGGATGG - Intronic
1184407353 22:44307748-44307770 CTGGGGAAGGAGAGGAAGGAGGG + Intronic
1184478306 22:44733476-44733498 CAGGGCAACCAGAGCAAGGAAGG + Intronic
1184486551 22:44783328-44783350 CTGTCCACACAGAGGCAGGCGGG + Intronic
1184717239 22:46289157-46289179 ATGAGCAAACTGAGGCTGGAAGG + Intronic
1184756176 22:46517146-46517168 CTGGGAAAACTGAGGCAGTGGGG - Intronic
1184810570 22:46828734-46828756 CAGTCCAAACAGAGACAGGAGGG - Intronic
1184978206 22:48078129-48078151 CTGGAAAAGCAGAAGCAGGAAGG - Intergenic
1185108696 22:48888724-48888746 CTGTGGAAACAAAGGCAGCAAGG + Intergenic
1185258295 22:49848645-49848667 ATGGGGAAACAGAGGCACGGTGG + Intergenic
1185353757 22:50353182-50353204 CTTGGCAAACTGGTGCAGGAGGG + Intronic
1185354642 22:50360468-50360490 CTCAGGAAACTGAGGCAGGAGGG - Intronic
1203216478 22_KI270731v1_random:8674-8696 CTTGGCAGGCTGAGGCAGGAAGG - Intergenic
1203229324 22_KI270731v1_random:96945-96967 CTTGGCAGGCTGAGGCAGGAGGG - Intergenic
1203274148 22_KI270734v1_random:76714-76736 CTTGGCAGGCTGAGGCAGGAAGG + Intergenic
949959035 3:9296684-9296706 ATGGGGAAACTGAGGCAGGGTGG - Intronic
950502423 3:13372874-13372896 CTGGGCGAACAGTGGCACAAGGG + Intronic
950527025 3:13530226-13530248 CTGAGAAAACTGAGGCAGAAAGG - Intergenic
950658493 3:14452134-14452156 CTGTGAAAACAGAGGGAGGAAGG - Intronic
950730531 3:14952767-14952789 ATGGGGAAAGAGTGGCAGGATGG - Intronic
951043022 3:18009179-18009201 CTGGGCAAGTACAGGAAGGAAGG - Intronic
951072559 3:18349419-18349441 CTGGGCAGACAGAGTCTGGATGG + Exonic
952777641 3:37061496-37061518 CTTGGGAAGCTGAGGCAGGAGGG - Intronic
953432905 3:42854400-42854422 CTCGGCAACTAGTGGCAGGAAGG - Intronic
953787284 3:45920713-45920735 CAGAGTAAACAGAGGCATGATGG - Exonic
954306382 3:49727716-49727738 CTGGGCAAACACTGTCTGGAAGG + Intronic
954577765 3:51686213-51686235 CTGGTCCCACAGAGGCAGGGAGG - Intronic
955345111 3:58155186-58155208 GTGGGCAGACAGAGGCTGGTTGG - Intronic
955478069 3:59360066-59360088 CCAGGCAAACAGAGTCTGGAGGG - Intergenic
955570131 3:60295830-60295852 CTGGGCATACATAGGAAGGAGGG + Intronic
955672650 3:61418151-61418173 ATGAGAAAACAGAGGCAGGGAGG + Intergenic
955986513 3:64579099-64579121 TTGGGCAAGTAGAGGAAGGAGGG - Intronic
956157414 3:66312795-66312817 GTGGGCAAGCAGATGCAGGGTGG - Intronic
956800905 3:72757495-72757517 CTTGGGAAGCTGAGGCAGGAGGG - Intronic
957272618 3:78051345-78051367 GTGGGGAGGCAGAGGCAGGAGGG - Intergenic
957333233 3:78793012-78793034 CTTGGCAGGCTGAGGCAGGAGGG + Intronic
957776415 3:84760854-84760876 CAGGGCAAGCAGAAGCAGGGTGG + Intergenic
957780729 3:84815032-84815054 CTAGGCAAACAGGGTCTGGAGGG - Intergenic
957979766 3:87494144-87494166 CTAGGAAAAGAGAGGAAGGAAGG + Intergenic
960450539 3:117801495-117801517 CTAGGCAAGCAGTGCCAGGATGG - Intergenic
960983489 3:123254469-123254491 GTGGGGAAACAGAGACAGGAAGG - Intronic
961175075 3:124828497-124828519 CTGGGGTAAGGGAGGCAGGAGGG + Intronic
961231858 3:125320167-125320189 TTGAGAAAACAGAGGGAGGAAGG - Intronic
961356463 3:126343039-126343061 CAGGGCAGACAGAGCCAGAAGGG - Exonic
961793790 3:129395032-129395054 ATAGGCAAGCAGAGGCAGCAGGG - Intergenic
962241439 3:133754267-133754289 CCAGGCAAACAGGGGCAAGAAGG - Intronic
962580492 3:136793270-136793292 CTGGGCAAACAGAAAAATGATGG + Intergenic
964178932 3:153859949-153859971 CTGGGGAGACTGAAGCAGGAGGG - Intergenic
965590517 3:170357232-170357254 CTGGGCGACTAGAGGAAGGAAGG + Intergenic
965784901 3:172325098-172325120 CTGGTCACACACAGGCAGCAGGG - Intronic
966568641 3:181413423-181413445 AAGGGCAAGCAGAGGAAGGAAGG + Intergenic
966670536 3:182521180-182521202 GTGGGAAGACAAAGGCAGGATGG - Intergenic
967366151 3:188688437-188688459 ATGGGCAAACAAAGCCAAGAAGG - Intronic
968356016 3:198108043-198108065 CTGGCCAAACTGGGGAAGGAGGG + Intergenic
968474845 4:799380-799402 CTGGGCACATGGAGGCTGGAAGG + Intronic
968538263 4:1148783-1148805 CTGTGGAGACTGAGGCAGGAGGG - Intergenic
969155385 4:5205458-5205480 CAGGGCACACAGAGACAGGGAGG + Intronic
969351135 4:6598510-6598532 ATGAGCAAACAGAGGCTGGGAGG - Intronic
969463916 4:7343651-7343673 ATGGGGAAACTGAGGCAGGCAGG - Intronic
969525613 4:7702504-7702526 CTTGGCAAACAGCCCCAGGATGG - Intronic
969636674 4:8373561-8373583 CTGGGAACACAAAGCCAGGACGG + Exonic
969639255 4:8387270-8387292 ATGAGGAAACCGAGGCAGGAAGG + Intronic
969845288 4:9915585-9915607 CTGGGGAAACTGAGGCACGGAGG + Intronic
970640195 4:18055701-18055723 CTGGGAACACAGGGGCAAGATGG + Intergenic
971114904 4:23633663-23633685 CTTGGGAAGCTGAGGCAGGAGGG + Intergenic
971274378 4:25182110-25182132 ATAGGCAAACAGAGCCATGAAGG + Intronic
971377904 4:26069802-26069824 CTGGGCACAGAAAGGCAGAAAGG - Intergenic
972032991 4:34486081-34486103 CTTGGGAAGCAGAGGCAGGAGGG - Intergenic
972425902 4:38932602-38932624 CAGGGGAGACTGAGGCAGGAGGG - Intronic
972452484 4:39216474-39216496 CTTAGCTAACAGAGGCAGAAGGG - Intronic
972622254 4:40758775-40758797 CTTGGGAGACTGAGGCAGGAGGG + Intronic
972636757 4:40891125-40891147 CTGGGGAAACTGAGGCTGAAAGG + Intronic
973093099 4:46162963-46162985 CTGGGGAGACAAAGGCATGACGG + Intergenic
974134987 4:57804012-57804034 CTTGGCAAAGAAAGGCAGCAGGG + Intergenic
974310092 4:60194682-60194704 CTTGGGAAGCTGAGGCAGGAGGG - Intergenic
975143385 4:70940297-70940319 CTGGGTAGACAGAGGAAGGTGGG - Intronic
975458579 4:74623487-74623509 CTAGGCAAACAGAGGAAATAGGG + Intergenic
975609070 4:76186145-76186167 GTGGGCATACAGAGGAGGGAGGG + Intronic
976072218 4:81254453-81254475 CTGGGTACACAGGGACAGGAAGG - Intergenic
977049303 4:92106888-92106910 CTGGGGGCACAGAGGCAGGGTGG + Intergenic
977764877 4:100785327-100785349 CTGGGTGAACAGGGGCAGGAGGG + Intronic
979344039 4:119564556-119564578 CTCTGCAAACAGAAGCAGAAGGG + Intronic
979347694 4:119607627-119607649 CTGGGGAGACTGAGGCAGGAGGG + Intronic
979987585 4:127333983-127334005 CAGTGCAAACAGAGGAAGGGAGG - Intergenic
980166423 4:129233610-129233632 ATGGGTAGACAGAGGCAGGTGGG + Intergenic
980455807 4:133040914-133040936 ATAGGCAAACAAAGGAAGGAGGG + Intergenic
981108704 4:140910940-140910962 ATGGGCACACAGAGCCAGGTGGG + Intronic
982710466 4:158753561-158753583 CTTGGGAAGCTGAGGCAGGAGGG + Intergenic
982743959 4:159087006-159087028 CTTGAGAGACAGAGGCAGGAGGG + Intergenic
985551058 5:533832-533854 CTAGGCGGACAGAGCCAGGAGGG - Intergenic
985901683 5:2800651-2800673 GTGGGGAAACGGAAGCAGGAAGG + Intergenic
986967237 5:13288678-13288700 CTCAGCAAACAAATGCAGGAAGG - Intergenic
988582103 5:32477374-32477396 CTGGGGAGGCTGAGGCAGGACGG - Intergenic
988606920 5:32686518-32686540 CTGGGGAGGCTGAGGCAGGAGGG + Intergenic
989129859 5:38096489-38096511 TCAGGCAAACAGAGGTAGGAAGG + Intergenic
990317858 5:54601077-54601099 ATGGACAGACAGAGGGAGGACGG - Intergenic
990635984 5:57726764-57726786 CTCGGAAAACTGAGGCAGGAGGG - Intergenic
991095390 5:62734455-62734477 TTGGGCAAAAAGCGGGAGGAGGG - Intergenic
991396839 5:66213050-66213072 CTTGGCAGGCTGAGGCAGGAGGG - Intergenic
992366091 5:76091443-76091465 CTGGGCAGTGAGAGGCAGGCTGG - Intronic
992640564 5:78765327-78765349 CTGGGAAATCAGTGGGAGGATGG + Intronic
992795887 5:80255243-80255265 ATTTGCAAAGAGAGGCAGGAAGG + Intronic
992834207 5:80624204-80624226 CTGGCCAAACAGAAGAAAGAAGG - Intergenic
993620534 5:90162685-90162707 CTGGGCATGCAGAACCAGGAGGG - Intergenic
994276885 5:97849446-97849468 CTGGGAAAAACAAGGCAGGAAGG - Intergenic
994502323 5:100595379-100595401 TTTTGCAAACAAAGGCAGGATGG - Intergenic
994939155 5:106298439-106298461 CTGGGCAAATATACTCAGGAGGG - Intergenic
996420617 5:123258426-123258448 CTAGGCAAACAGAGTCTGGAGGG - Intergenic
997296737 5:132773299-132773321 CTGGCAGCACAGAGGCAGGAAGG + Intronic
997621794 5:135303922-135303944 ATGGGCAAACACAAGCAAGATGG - Intronic
997864104 5:137445449-137445471 CTGGGCACTCAGAGGCAACAGGG + Intronic
997979633 5:138460830-138460852 CTGGGGAAAATGAGGCTGGAAGG - Intergenic
998133668 5:139663609-139663631 CTGGGGAAACTGAGGCATGAAGG + Intronic
999950558 5:156645296-156645318 CTGAGAAAACAGAGAGAGGATGG + Intronic
1000343285 5:160294204-160294226 CGGGGCAGAGAGAGGAAGGAGGG - Intronic
1000783889 5:165519449-165519471 CTCGGGAAACTGAGGCAGAATGG - Intergenic
1001412880 5:171523355-171523377 CTGGGCACACAAAGGAAGTAGGG - Intergenic
1001956408 5:175850930-175850952 CTGAGGAACCAGAGGCAGGAGGG + Intronic
1002177355 5:177408775-177408797 CTGGGGAAACTGAGGAAGGCTGG + Intronic
1002640165 5:180626959-180626981 ATGGGCAAACAGACACAGCAAGG - Intronic
1002856470 6:1042504-1042526 TTGGGCAAACAAATGTAGGAAGG + Intergenic
1003032409 6:2613442-2613464 CTTGTAAAAGAGAGGCAGGAGGG - Intergenic
1003504095 6:6725546-6725568 CTGGGTCACCAGAGGCAGGGAGG + Intergenic
1004527437 6:16422503-16422525 CTTGGAAAAGAGAGGCATGAAGG + Intronic
1005632675 6:27723232-27723254 CTGGGGAGACTGAGGCAGGAGGG + Intergenic
1005676926 6:28164385-28164407 CTGGGGAAACTGAGGAAGAAGGG - Intergenic
1006018741 6:31104051-31104073 TTGGGGAAGCTGAGGCAGGAGGG - Intergenic
1006076167 6:31534115-31534137 CTTGGGAAGCTGAGGCAGGAGGG - Intronic
1006083404 6:31580385-31580407 CTGGCCATTCAGAGGCAGGGAGG + Intergenic
1006201890 6:32300838-32300860 CTGGGCAAAGAGAAGGGGGAAGG - Intronic
1006381506 6:33700598-33700620 CTGGGCAACCAGAGGCCAGGAGG + Intronic
1006713899 6:36101328-36101350 CTTGGGAAGCTGAGGCAGGAGGG + Intronic
1006939468 6:37742445-37742467 TTGGGCAAGAGGAGGCAGGAAGG - Intergenic
1007694843 6:43725511-43725533 CGTGGCAAACAGAAGGAGGAAGG - Intergenic
1007833862 6:44659296-44659318 CTGGGCACACAGTGGCGGCAAGG + Intergenic
1008464464 6:51815052-51815074 CTTGGCAAACAAAGGGTGGATGG - Intronic
1008507624 6:52246399-52246421 CTGGGGCAGCAGAGCCAGGACGG + Intergenic
1009718335 6:67428676-67428698 GAGGGCGAACAGAAGCAGGATGG - Intergenic
1010682263 6:78810637-78810659 ATGGGTAAAGAGAGGAAGGAAGG - Intergenic
1010767651 6:79794710-79794732 CCTGGAAAACTGAGGCAGGAAGG + Intergenic
1011020784 6:82809787-82809809 GAGGGCAAACAGAAGCAGGGTGG - Intergenic
1013270250 6:108538329-108538351 GTCGCCAAACTGAGGCAGGAGGG + Intergenic
1014143852 6:117973667-117973689 CTGGGAAGGCTGAGGCAGGAGGG - Intronic
1016505994 6:144779615-144779637 CAGGGGTAACAGAGGCAGAAAGG + Intronic
1017996243 6:159534036-159534058 CTCAGCAAACAGAGTGAGGATGG + Intergenic
1018208414 6:161456878-161456900 CTAGGCAAACAGAGGTAGTGTGG + Intronic
1018287796 6:162259252-162259274 GTGGGAGAACAGAGGCAGGTCGG - Intronic
1018381388 6:163261125-163261147 CCGGGAAGACAGAGGGAGGAGGG - Intronic
1018517490 6:164601716-164601738 CTGGGCAATCTATGGCAGGAAGG + Intergenic
1018899022 6:168041999-168042021 GGGAGCAAACAGAGGCAGGAAGG + Exonic
1019115542 6:169758500-169758522 GTGGTTAAACAGAGGCAGCAGGG - Intronic
1019144953 6:169970559-169970581 CTGTGCCTGCAGAGGCAGGAGGG + Intergenic
1019436683 7:1025816-1025838 CTGGGCCTCCAGAGGCAGGCTGG + Intronic
1019520126 7:1457062-1457084 CTGGGCTGGAAGAGGCAGGAAGG - Intronic
1020982680 7:15091217-15091239 CTTAGCAAACAGAGGCAGGAAGG + Intergenic
1021299165 7:18950223-18950245 CAGGGCAAGTAGAGGCAGAATGG - Intronic
1021413447 7:20354689-20354711 CCAGGCAGAAAGAGGCAGGATGG + Intronic
1021942314 7:25689802-25689824 GTGGGCAAACAGCTGGAGGATGG - Intergenic
1022108075 7:27210936-27210958 CAGGCCTGACAGAGGCAGGAGGG - Intergenic
1023018292 7:35987161-35987183 CATGGCAAAAAGAGGCAGAACGG + Intergenic
1023167623 7:37358461-37358483 CTGGGCAATAAGATGCAAGATGG - Intronic
1023178650 7:37458585-37458607 CTGAGCAAACAAAGGAAGAAAGG - Intergenic
1023541956 7:41275283-41275305 CTTCTCCAACAGAGGCAGGATGG + Intergenic
1024024845 7:45401264-45401286 CTGGGCAGATCAAGGCAGGAGGG + Intergenic
1024159915 7:46663516-46663538 CTGGGAAAGCAGAGGGAGTAAGG + Intergenic
1024863499 7:53874939-53874961 CTGGGGACTCAGAGGCAGGAAGG + Intergenic
1026418234 7:70205288-70205310 CTCAGGAGACAGAGGCAGGAGGG - Intronic
1026633217 7:72057046-72057068 CTGGGGAGGCTGAGGCAGGAGGG - Intronic
1026788446 7:73316749-73316771 CTGGGCAAACATAGATAGGATGG - Intronic
1026875607 7:73877373-73877395 ATGGGGAGACTGAGGCAGGAAGG + Intergenic
1027056300 7:75052327-75052349 TCGGGGAAACAGAGGCACGATGG - Intronic
1027188768 7:75986287-75986309 CTGGGCCAACTGTGGCAGGCAGG - Intronic
1027731419 7:81878444-81878466 TTGGGCAAATAGAGGCAAGAAGG + Intergenic
1028844419 7:95463273-95463295 TTTGGGAAGCAGAGGCAGGAGGG - Intergenic
1029111894 7:98217019-98217041 CTGGGGCAGCAGAGCCAGGATGG - Exonic
1029585579 7:101468722-101468744 CTGGGGAAACTGTGGGAGGAGGG + Intronic
1029629212 7:101739916-101739938 CTGTGCAAACAGACTGAGGAAGG - Intergenic
1030236620 7:107270367-107270389 CTTGGGAAGCTGAGGCAGGAAGG - Intronic
1031881015 7:127198780-127198802 CTTGGGAAGCTGAGGCAGGAGGG - Intronic
1031997368 7:128241386-128241408 CCGGGGAAACTGAGTCAGGAGGG + Intronic
1032061750 7:128730559-128730581 CTGGTCAAACAGAGGCACATAGG - Intronic
1032515195 7:132501655-132501677 CTGGCCAAAAAGAGGGAGGTGGG + Intronic
1032548289 7:132761761-132761783 ATGGGGAAACTGAGGCAGGGTGG + Intergenic
1033150893 7:138914073-138914095 CGGGGGAAACAGAGGCAGAATGG + Intronic
1033195228 7:139321782-139321804 CTGGGGAAGCAGGGGAAGGAAGG - Intergenic
1033568823 7:142606931-142606953 CTCGGGAAACTGAGGCAGGAGGG + Intergenic
1033754925 7:144390447-144390469 CTGGATAAGCAGAGGAAGGAAGG - Intergenic
1033767948 7:144515199-144515221 CTGGGCACACAGAGAAAGAAAGG + Intronic
1034295196 7:149966233-149966255 CTGGAGAAACAGAGGCTGGAAGG + Intergenic
1034674498 7:152882838-152882860 ATGGGCACACAGAGGCAAGACGG - Intergenic
1034686038 7:152972328-152972350 CTGAGAGCACAGAGGCAGGAAGG + Intergenic
1034810867 7:154130714-154130736 CTGGAGAAACAGAGGCTGGAAGG - Intronic
1035283013 7:157788982-157789004 CTTGGGAAATGGAGGCAGGAAGG - Intronic
1035417485 7:158702524-158702546 CTGGAAAAACACAGGCAGGATGG - Intronic
1035438246 7:158875570-158875592 GGGGGCAAACAGAGCCAGGCAGG - Intronic
1035754753 8:2022912-2022934 CGGGGCAGACAGAGGGAGGCAGG - Intergenic
1036179139 8:6568144-6568166 CTGGGCAAACTGAGCCAAAAGGG - Intronic
1036428910 8:8671471-8671493 CTGGGAACACAGGGGCAAGAGGG + Intergenic
1036458939 8:8934787-8934809 CTTGGGACACTGAGGCAGGAGGG + Intergenic
1036462153 8:8962986-8963008 CTGGGCAAAGAGAGGATGCATGG + Intergenic
1036741200 8:11363190-11363212 CTGGGGAGTCTGAGGCAGGAGGG + Intergenic
1036825543 8:11973014-11973036 CTTGGCAACCAGAAGCATGATGG + Intergenic
1037192430 8:16142824-16142846 CTGGGAATACAGAGGGAGGGAGG + Intronic
1037429143 8:18791278-18791300 CTAGGCAAAAAGAGGCAAGCTGG + Intronic
1037707591 8:21328248-21328270 CTTGGGAGACTGAGGCAGGAGGG + Intergenic
1038567822 8:28634544-28634566 ATGGGCAGAAAGAGCCAGGAAGG - Intronic
1038915438 8:32016303-32016325 TTTGGCAGACTGAGGCAGGAGGG - Intronic
1039311883 8:36325224-36325246 TTGGATACACAGAGGCAGGATGG - Intergenic
1039478723 8:37856089-37856111 CTGGGCAAACAGACCCAGAGAGG - Intergenic
1040973444 8:53163444-53163466 CTGAGGATACAGAGCCAGGACGG - Intergenic
1041040440 8:53841274-53841296 TTGGGCTAACGGAGGGAGGAAGG - Intronic
1041277492 8:56177884-56177906 CTGGGGACACAGAAGCAGTACGG - Intronic
1041524933 8:58794821-58794843 CTGGAGAAAGAGAAGCAGGAAGG + Intergenic
1041731708 8:61069420-61069442 AAGGGAAAACAGAGGAAGGAAGG - Intronic
1042256827 8:66813144-66813166 CTTGGCAGGCTGAGGCAGGAGGG + Intronic
1044571985 8:93730232-93730254 CTGCAAAAACAGAGGCAGCAAGG + Exonic
1045461055 8:102426210-102426232 CAGGGCAACCAATGGCAGGAAGG - Intergenic
1047159706 8:122364135-122364157 CTGGGCAAACTGAGACAGCTTGG + Intergenic
1047192812 8:122693676-122693698 CTGAACATAGAGAGGCAGGAAGG + Intergenic
1048194533 8:132321506-132321528 GAGAGCAAACAGAAGCAGGAGGG - Intronic
1048273846 8:133050916-133050938 CTGGGGAAACAAAGGCAAGGGGG + Intronic
1048773242 8:137918483-137918505 CTTCGAAGACAGAGGCAGGAGGG + Intergenic
1048984949 8:139730316-139730338 CTGGGCTAGCAGATGCAGGGAGG + Intergenic
1049557394 8:143289769-143289791 GTGGGCATACAGAGGCAGTCGGG + Intronic
1049806707 8:144544284-144544306 GTGGGCACACAGAGGCAGGGTGG - Intronic
1050062449 9:1724133-1724155 CAGGGCAAACAGAGGTATCAGGG - Intergenic
1050374910 9:4960650-4960672 CTGGGGAAACTGAAGCAGGAGGG - Intergenic
1050527447 9:6558289-6558311 TTGGGCAGAAAGAGGCAGGCAGG + Intronic
1050889479 9:10806188-10806210 CTGAGTGAAAAGAGGCAGGAGGG - Intergenic
1052216368 9:25971691-25971713 CTGAGAAAACAGAGGCAGAAGGG - Intergenic
1054916577 9:70500121-70500143 CTGGGGAAACTGAGGCACAAGGG + Intergenic
1056178927 9:84062663-84062685 CTGGGAAAAAGGAGGCAGGCAGG + Intergenic
1056302713 9:85258445-85258467 CATGGCAAACAGAAGCAGGGTGG - Intergenic
1056707730 9:88966311-88966333 CTTGGGAAGCTGAGGCAGGAGGG - Intergenic
1057670291 9:97080475-97080497 TTGGGCAAAAATTGGCAGGATGG + Intergenic
1058120731 9:101135833-101135855 CTGGGCAGACAGAGGCAGGAAGG - Intronic
1058352627 9:104043966-104043988 ATGGGAAAAGAGAGGCAGGAGGG + Intergenic
1058703421 9:107619749-107619771 CTGGGCAGACAGAGGAACCAGGG + Intergenic
1059032312 9:110712013-110712035 CTGTGCAAACAGAGCCAGATTGG - Intronic
1060187359 9:121571869-121571891 CAGGACAGTCAGAGGCAGGAAGG + Intronic
1060197993 9:121635607-121635629 CAGGGCAACCACAGGAAGGAGGG + Intronic
1060956797 9:127647269-127647291 CTTATCAAATAGAGGCAGGAGGG - Intronic
1061048043 9:128177992-128178014 ATGGGGAAACAGACTCAGGAGGG + Intronic
1061136724 9:128738787-128738809 CTGGGGAGGCTGAGGCAGGAGGG - Intronic
1061312165 9:129770908-129770930 CTGGGAAAATAGCCGCAGGATGG + Intergenic
1061404522 9:130385987-130386009 CTGAGGAAACCGAGGCAGGAAGG - Intronic
1061431241 9:130532725-130532747 CTGGGGGAAAAGAGGCGGGATGG + Intergenic
1061611794 9:131751566-131751588 CTTGGGAAGCTGAGGCAGGAGGG + Intergenic
1061848797 9:133402807-133402829 CAAGGACAACAGAGGCAGGAAGG + Intronic
1062024534 9:134334186-134334208 CTGGGAAAAAAGAGGCTGGATGG - Intronic
1062315292 9:135964231-135964253 CTGGGGGAACAGAGAGAGGAGGG + Intergenic
1062482645 9:136759544-136759566 CTGGGGAGACTGAGGCAGGGAGG - Intergenic
1062484926 9:136769981-136770003 CAGGGCAAAGAGAGAGAGGAAGG - Intergenic
1185492270 X:526714-526736 CTGGGGAAAGAGACCCAGGAAGG - Intergenic
1185825385 X:3244271-3244293 ATGGATAAACAGAGGAAGGAAGG + Intergenic
1187044104 X:15629038-15629060 CTAGGCAACCAGAAGAAGGAGGG + Intronic
1188023551 X:25185064-25185086 ATAGGCAAACTAAGGCAGGAGGG + Intergenic
1188954496 X:36418155-36418177 CCAGGCAAACAGAGTCTGGAGGG - Intergenic
1189470963 X:41313827-41313849 CTTGGGAAGCTGAGGCAGGAGGG + Intergenic
1189630150 X:42943850-42943872 CTGGTCAAACAGTTACAGGAGGG + Intergenic
1190835257 X:54094787-54094809 CTGGGGAGGCTGAGGCAGGAGGG + Intronic
1191194346 X:57705526-57705548 GTGGGCAAGCAGAAGCAGGGTGG + Intergenic
1191783704 X:64895018-64895040 CTGGGCACACAGGTGCAGTAAGG + Intergenic
1192788583 X:74357577-74357599 CTTGGGAGACTGAGGCAGGAGGG + Intergenic
1193228498 X:79013712-79013734 GAGGGCAAGCAGAAGCAGGATGG - Intergenic
1194672859 X:96755969-96755991 CTTGGGAGACTGAGGCAGGAGGG - Intronic
1195666951 X:107440439-107440461 CTGAGCAAACAGAAGAGGGAGGG + Intergenic
1195704574 X:107729647-107729669 CTGGGCCGACAGAGGGAGGCAGG + Intronic
1195867598 X:109450033-109450055 GTGGGCAGAGAGAGGGAGGAAGG + Intronic
1196757003 X:119166769-119166791 CTAGGCAAAGAGTGGAAGGAAGG - Intergenic
1197112109 X:122788809-122788831 CTCGGGAGGCAGAGGCAGGAGGG - Intergenic
1197809307 X:130427386-130427408 CTTGGAACACAGAGGCAGCATGG + Intergenic
1198110861 X:133501653-133501675 CTGGGAAATCAGAGGCAAGATGG - Intergenic
1198218100 X:134575038-134575060 TTGGGAAATCAGAGGCAAGATGG + Intronic
1198414805 X:136409288-136409310 CTAGGAAAACACAGGCATGAGGG - Intronic
1198801552 X:140452791-140452813 CAGGGGTAGCAGAGGCAGGAAGG + Intergenic
1200068005 X:153514232-153514254 CTGTCCCAACAGTGGCAGGAGGG + Intergenic
1200259604 X:154606074-154606096 TGGGGCAACCAGAGACAGGATGG - Intergenic
1200757804 Y:7007556-7007578 CTTGGGAGACTGAGGCAGGAAGG - Intronic
1201253811 Y:12087759-12087781 ATGGATAAACAGAGGAAGGAAGG - Intergenic
1201376662 Y:13330374-13330396 GAGGGCAAACAGAAGCAGGGTGG + Intronic
1201897177 Y:19004376-19004398 CTGGGAAAGCAGAGTGAGGAGGG + Intergenic