ID: 1174846688

View in Genome Browser
Species Human (GRCh38)
Location 20:53949602-53949624
Sequence GAGGCTTGGTCTTTGGAAAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 1, 3: 47, 4: 222}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174846678_1174846688 29 Left 1174846678 20:53949550-53949572 CCAGGAAGGCGGTCAGGCAACCC 0: 1
1: 0
2: 1
3: 6
4: 117
Right 1174846688 20:53949602-53949624 GAGGCTTGGTCTTTGGAAAGCGG 0: 1
1: 0
2: 1
3: 47
4: 222
1174846677_1174846688 30 Left 1174846677 20:53949549-53949571 CCCAGGAAGGCGGTCAGGCAACC 0: 1
1: 0
2: 0
3: 8
4: 90
Right 1174846688 20:53949602-53949624 GAGGCTTGGTCTTTGGAAAGCGG 0: 1
1: 0
2: 1
3: 47
4: 222
1174846682_1174846688 9 Left 1174846682 20:53949570-53949592 CCCTGGGGAATGTGTCCAGCTTG 0: 1
1: 0
2: 3
3: 12
4: 195
Right 1174846688 20:53949602-53949624 GAGGCTTGGTCTTTGGAAAGCGG 0: 1
1: 0
2: 1
3: 47
4: 222
1174846683_1174846688 8 Left 1174846683 20:53949571-53949593 CCTGGGGAATGTGTCCAGCTTGA No data
Right 1174846688 20:53949602-53949624 GAGGCTTGGTCTTTGGAAAGCGG 0: 1
1: 0
2: 1
3: 47
4: 222
1174846685_1174846688 -6 Left 1174846685 20:53949585-53949607 CCAGCTTGAAAGTCTTCGAGGCT 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1174846688 20:53949602-53949624 GAGGCTTGGTCTTTGGAAAGCGG 0: 1
1: 0
2: 1
3: 47
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174846688 Original CRISPR GAGGCTTGGTCTTTGGAAAG CGG Intronic
900318961 1:2073131-2073153 GAGGTCTGGTCTTGGGAATGCGG + Intronic
901537092 1:9889531-9889553 GAGGCTTGGTCTCAGGAATCAGG - Intronic
902756281 1:18551211-18551233 GGGGCTTTGTCTTGGGACAGAGG - Intergenic
902979636 1:20113662-20113684 GAGGCTTTATCTTAGGACAGTGG + Exonic
903269232 1:22177409-22177431 GAGGCAGGCTCTTGGGAAAGAGG + Intergenic
905003800 1:34694468-34694490 GGGGCTTGGTCTTTGCAAGGTGG - Intergenic
907397377 1:54200532-54200554 CAGGCCTGGTCTTTGTACAGCGG - Exonic
907753675 1:57288404-57288426 GTGGCATGGTGTTTGGAAATGGG + Intronic
908789691 1:67769421-67769443 GAGGGTGGGTCTTTGGAGGGAGG + Intronic
909800176 1:79796851-79796873 GAGGCTAGGTCTTTAGGAAATGG + Intergenic
910241562 1:85092205-85092227 GTGGCCAGGTCTTAGGAAAGGGG + Intronic
910426398 1:87123497-87123519 CAGGCCTGATCTTTGGAACGTGG + Intronic
910442905 1:87271074-87271096 GAGGCTTAGCCTTTGCAGAGAGG - Intergenic
910894371 1:92052432-92052454 AAGTCTTTGGCTTTGGAAAGGGG - Intronic
913237834 1:116800103-116800125 GAGATTTACTCTTTGGAAAGAGG - Intergenic
913941872 1:125117631-125117653 GAGGGTTAGTGTTTGGAAAGGGG - Intergenic
918405378 1:184207168-184207190 GAGCCTTTGTCCTAGGAAAGTGG - Intergenic
918725375 1:187914993-187915015 AAAACTTGTTCTTTGGAAAGTGG + Intergenic
919767681 1:201137927-201137949 GAGGCTTGGTCTTAGCACTGTGG - Intronic
1064715341 10:18171244-18171266 TAGGGTTATTCTTTGGAAAGGGG + Intronic
1064843863 10:19629120-19629142 GAGGCTTGCTTTTTGGGAAGGGG - Intronic
1065180325 10:23118483-23118505 GAGGGTGGGTCTTTGGTGAGTGG + Intronic
1066782565 10:38969189-38969211 GAGGGTTAGTGTTTGGAAAGGGG - Intergenic
1066950828 10:42113870-42113892 GAGGGTTGGTGTTTGCAAAGGGG + Intergenic
1066954548 10:42151437-42151459 GAGGGTTAGTGTTTGGAAAGGGG + Intergenic
1069564917 10:69457372-69457394 GAGGCCTTGACTTTGCAAAGTGG + Intronic
1069608094 10:69752938-69752960 TAGGCTCGGCCCTTGGAAAGTGG + Intergenic
1070932501 10:80271312-80271334 GGGGATTGGTCTGTGGAGAGAGG - Intergenic
1071055173 10:81501836-81501858 GGGTCTTGTTCTTTGGAAAGTGG - Intergenic
1071817110 10:89243499-89243521 GAGTCTAGGTCTTTAGAATGGGG - Intronic
1073486559 10:103822716-103822738 GAGGATTGTTCCTTGGAGAGAGG - Intronic
1076797020 10:132803328-132803350 GAGACCTCGTCTTTGGAAGGAGG - Intergenic
1077697859 11:4411546-4411568 TAGCCTGGCTCTTTGGAAAGAGG + Intergenic
1078017450 11:7627111-7627133 GAGGCTTAGACTGTGGGAAGAGG - Intronic
1080437302 11:32257051-32257073 CAAGCTTGGGTTTTGGAAAGTGG - Intergenic
1083551235 11:63591625-63591647 GTTTATTGGTCTTTGGAAAGCGG - Intronic
1085014735 11:73166380-73166402 GAGTCTTGCTCTTTGGCGAGGGG + Intergenic
1085690282 11:78658661-78658683 GCGGCTCAGTCTTTGGCAAGGGG - Exonic
1088467130 11:110152965-110152987 GTGGATTGGTTTTTGGAAAGAGG + Exonic
1089278352 11:117355136-117355158 GAAGGTTGGCCTTTGGAGAGTGG - Intronic
1090186394 11:124741739-124741761 GAGACGTGGTCACTGGAAAGAGG + Intronic
1091016605 11:132056858-132056880 TAGGCTTGGCATTTGCAAAGTGG - Intronic
1091565202 12:1642916-1642938 GAGGCCTGTTCCTTGGAGAGAGG - Intronic
1092117832 12:6022072-6022094 GAGGCTTCCTCGTGGGAAAGGGG - Intronic
1092405218 12:8217095-8217117 GTTGCTTCCTCTTTGGAAAGGGG - Intergenic
1095448103 12:42302459-42302481 GTGGCAGGGTCTTGGGAAAGAGG + Intronic
1095719494 12:45385467-45385489 GAACCTTGGGCTTTGGTAAGTGG + Intronic
1098664390 12:73142930-73142952 GAGTCTTGATCTTTGGAAACAGG - Intergenic
1099389505 12:82062064-82062086 GAGGTGTGGCCTTTGGAAGGTGG + Intergenic
1100002293 12:89851688-89851710 CATACTTGGTCTCTGGAAAGTGG - Intergenic
1100378552 12:94040652-94040674 GGAGCTTGGTCTTTATAAAGAGG - Intergenic
1102649103 12:114424623-114424645 GGGACATGGTTTTTGGAAAGAGG + Intergenic
1103833569 12:123800234-123800256 GAGCCTTCGACTTTAGAAAGGGG + Exonic
1104401827 12:128482752-128482774 GAAGCTGGGGCTTTGGGAAGAGG - Intronic
1105892393 13:24690858-24690880 GATGCTTGGCCTTGGGAATGTGG + Intronic
1106132662 13:26952740-26952762 GAGGGTTGGCCCTTGGACAGTGG - Intergenic
1111683905 13:91477920-91477942 TTTGCTTGGTTTTTGGAAAGTGG + Intronic
1111824332 13:93249504-93249526 AAGGTTTGGTCTGTTGAAAGAGG + Intronic
1112329525 13:98466450-98466472 GTGGGTTGTTCTTTGGAATGAGG + Exonic
1113114116 13:106856797-106856819 CAGACTTGGTCTTTGGTAATTGG + Intergenic
1116790795 14:49337742-49337764 GAGGCTAGGCTTTTAGAAAGTGG - Intergenic
1120732797 14:88021962-88021984 GTGCCTTGGTCATTGGATAGTGG + Intergenic
1122349383 14:101078621-101078643 GGGGCTGGGGCTTTGGAAGGAGG - Intergenic
1123965393 15:25450876-25450898 GAGGTTTGGGATTTGGCAAGGGG - Intergenic
1124068246 15:26366330-26366352 TAGGCTTGTTCTTTCTAAAGAGG + Intergenic
1124421376 15:29526291-29526313 GAGCCTTGGTTTTTGGAAGATGG - Intronic
1126059604 15:44767381-44767403 GAGGCTTCACCTCTGGAAAGTGG + Exonic
1126971374 15:54115943-54115965 GTGGCATCTTCTTTGGAAAGCGG - Intronic
1128866776 15:71120305-71120327 GATGCGTTGTCTTGGGAAAGTGG + Intronic
1131158746 15:90090836-90090858 GAGGCTGGGGCTTTGGAGAGAGG + Intronic
1131342961 15:91619884-91619906 GAGGCTGGGTGTCTGGAGAGGGG + Intergenic
1131405128 15:92158194-92158216 GGGGTTTGATCTTTGCAAAGCGG - Intronic
1131454813 15:92575291-92575313 TAGGGTTGGTCTGTGGAGAGAGG + Intergenic
1131637266 15:94249421-94249443 CTGCCTTGGGCTTTGGAAAGGGG - Intronic
1134615929 16:15650857-15650879 CAGGGTGGGTTTTTGGAAAGAGG - Intronic
1136683801 16:31982643-31982665 GAGGCTTGGCCTTTGGCCACAGG + Intergenic
1136696688 16:32086492-32086514 GAGGGTTAGTGTTTGGAAAGGGG + Intergenic
1136784429 16:32926199-32926221 GAGGCTTGGCCTTTGGCCACAGG + Intergenic
1136797189 16:33029774-33029796 GAGGGTTAGTGTTTGGAAAGGGG + Intergenic
1136885354 16:33927607-33927629 GAGGCTTGGCCTTTGGCCACAGG - Intergenic
1136938998 16:34501945-34501967 GAGGGTTAGTGTTTGGAAAGGGG + Intergenic
1136960822 16:34846611-34846633 GAGGGTTAGTGTTTGGAAAGGGG - Intergenic
1137084585 16:36103179-36103201 GAGGGTTAGTGTTTGGAAAGGGG + Intergenic
1137219207 16:46429457-46429479 GAGGGTTAGTGTTTGGAAAGGGG + Intergenic
1139112120 16:63904513-63904535 AAGGCTTTGTCTTTGGAAACTGG + Intergenic
1139492769 16:67295438-67295460 GAGGCTAGGTCTTTGCGAAGGGG + Intronic
1203087088 16_KI270728v1_random:1190205-1190227 GAGGCTTGGCCTTTGGCCACAGG + Intergenic
1143620173 17:8076047-8076069 GGGGCTTGGCCTTGGGGAAGGGG - Intronic
1144007087 17:11110566-11110588 GAGGTGGGGTCTTTGGAAGGTGG + Intergenic
1145327008 17:21841327-21841349 GAGGGTTAGTGTTTGGAAAGGGG - Intergenic
1145689985 17:26730527-26730549 GAGGGTTAGTGTTTGGAAAGGGG - Intergenic
1145693846 17:26772740-26772762 GAGGGTTAGTGTTTGGAAAGGGG - Intergenic
1147144723 17:38478350-38478372 GAGGCTTGGCCTTTGGCCACAGG + Intronic
1147656204 17:42092644-42092666 GGGGTGTGGTCTTTGGAATGTGG - Intergenic
1148719017 17:49737376-49737398 GAGGCAGGGACTCTGGAAAGTGG + Intronic
1151280264 17:73068746-73068768 GAGGTTTTGACTTTGGACAGAGG - Intronic
1203191825 17_KI270729v1_random:198160-198182 GAGGGTTAGTGTTTGGAAAGGGG - Intergenic
1154516005 18:15165821-15165843 GAGGGTTAGTGTTTGGAAAGGGG + Intergenic
1156803002 18:41141190-41141212 GAGGATTGGACTTTTTAAAGGGG - Intergenic
1157957371 18:52113398-52113420 GAGGCTTTACCTTGGGAAAGGGG + Intergenic
1159027928 18:63203124-63203146 GGGGCTTGGTCCTGGCAAAGTGG - Intronic
1160625579 18:80202066-80202088 GAGGCTTGATATTGGGAAAATGG - Intronic
1161602553 19:5193398-5193420 GAGGCTTGGCCTTTTCAAACAGG - Intronic
1161840863 19:6679535-6679557 CAGGCATGGTCTTTGGAGGGAGG - Intronic
1162891906 19:13739615-13739637 GAGGCCTGGTATGTGGGAAGAGG - Intronic
1164147374 19:22520257-22520279 GGGGCTTAGTCTATGGAAGGGGG - Intronic
1164419615 19:28077478-28077500 GAAGCTTGGTGTTTTGAAAAAGG + Intergenic
1166799179 19:45445411-45445433 GAAGCTTACTCTTTGGAAATTGG + Intronic
1166831967 19:45644637-45644659 GAGGCCTGGTCTCTGGGAAAAGG - Intronic
1167100863 19:47403544-47403566 GAGGCTGGGTCTGTGGAGAGGGG + Exonic
1167728323 19:51234469-51234491 GAGCACTGGTCTTTGGACAGAGG - Intronic
1168117464 19:54231961-54231983 GCTGCTTGGTCCTTGGTAAGAGG + Intronic
1168145865 19:54419991-54420013 GAGCCTTCCTCTTTGGAAACTGG - Intronic
1202669433 1_KI270709v1_random:38362-38384 GAGGGTTAGTGTTTGGAAAGGGG - Intergenic
925717525 2:6797963-6797985 GGAGGTTGGTCTTTGGAGAGAGG - Intergenic
925726603 2:6878443-6878465 TACACTTGGTGTTTGGAAAGAGG + Intronic
925776835 2:7344066-7344088 GAGGCATGGTCTTTGGGATGAGG + Intergenic
926484604 2:13438981-13439003 GAGGCTGGGTTTTTGGAAGAGGG - Intergenic
929746617 2:44666116-44666138 TAGGTTTGATCTTTGGAAAGAGG + Intronic
929815993 2:45232072-45232094 GAGGTGGGGTCTTTGGAAGGTGG - Intergenic
930116156 2:47720096-47720118 GAGGCCAGGCCTCTGGAAAGGGG + Intronic
934251850 2:90361469-90361491 GAGGGTTAGTGTTTGGAAAGGGG + Intergenic
934257587 2:91441490-91441512 GAGGGTTAGTGTTTGGAAAGGGG - Intergenic
936935242 2:117833564-117833586 CAGACTTGGGCTTTGGAAAGCGG + Intergenic
937237889 2:120441809-120441831 GAGGCCAGGTCTTTGGTATGGGG - Intergenic
937875497 2:126822606-126822628 GAGATTTGTTTTTTGGAAAGAGG + Intergenic
938516336 2:132010838-132010860 GAGGGTTAGTGTTTGGAAAGGGG + Intergenic
940800875 2:158131243-158131265 CAGGGCTGGTCTTTGGAAAAAGG - Intronic
940901693 2:159131600-159131622 GAGGCTTGGTTTCTGGCCAGTGG + Intronic
941080459 2:161054903-161054925 GTGGCCTGGTCTGAGGAAAGGGG + Intergenic
943203451 2:184860242-184860264 GAGGCTTGGTCTGTGAGAACTGG + Intronic
943626728 2:190209674-190209696 GAGGACTGGTCTTTGAAAAAGGG - Intronic
944040619 2:195349832-195349854 GAGAACTGGCCTTTGGAAAGGGG - Intergenic
944907270 2:204275065-204275087 GAGGCTTAGTGTGTGGAGAGGGG - Intergenic
946235768 2:218323537-218323559 GGGGCTTGGTCTAAGGGAAGAGG + Intronic
946264154 2:218523816-218523838 GAGGTTTGGGGATTGGAAAGGGG - Intronic
948364682 2:237447041-237447063 GAGGTGGGGTCTTTGGGAAGGGG - Intergenic
948783910 2:240341052-240341074 GAGGCTTGTGCTTTGATAAGGGG - Intergenic
1168889686 20:1286837-1286859 GGGGCTTTGTCTGTGGAAAGGGG + Intronic
1170968079 20:21094024-21094046 GAGGTGTGGTATTTGGGAAGGGG + Intergenic
1171346851 20:24471497-24471519 CAGGCTTGCTCCTTGCAAAGGGG - Intronic
1172165513 20:32896638-32896660 GGGGTTTGGTCTCTGGAAACAGG + Intronic
1172614683 20:36275343-36275365 GAGGCTGGGGCTCTGGAAGGAGG + Intergenic
1173594676 20:44251044-44251066 CAGTCTTGGTTTTTGAAAAGGGG - Intronic
1174753375 20:53134511-53134533 GAAGCTGGGCATTTGGAAAGGGG + Intronic
1174846688 20:53949602-53949624 GAGGCTTGGTCTTTGGAAAGCGG + Intronic
1174857599 20:54061436-54061458 GAAGCTAGGTCTTTGGAGATGGG - Intronic
1175238273 20:57527195-57527217 GAGGCTTCGTGGTGGGAAAGAGG + Intergenic
1175886831 20:62296954-62296976 GAGGCTTGGGTTGTGGGAAGTGG + Intergenic
1177517540 21:22175280-22175302 GGGGCCTGGTCTTAGGAAAATGG + Intergenic
1182847534 22:33443777-33443799 GATCTTTGGTCTTTGGAAATGGG + Intronic
1183324927 22:37185981-37186003 GAGGCTTGTTCTCAGGAGAGGGG + Intronic
1184366321 22:44053901-44053923 GATGCTTGGTTTTGGCAAAGTGG - Intronic
1203325199 22_KI270738v1_random:6955-6977 GAGGGTTAGTGTTTGGAAAGGGG + Intergenic
950490273 3:13300473-13300495 GAGGTTGGGTCTTTGGGAGGTGG - Intergenic
951543433 3:23805086-23805108 AAGGTTTGGTTTTTGGAAATTGG - Intergenic
953896578 3:46807800-46807822 CAGGAGTGGTCTGTGGAAAGGGG + Intronic
954218463 3:49137765-49137787 GAGACATGGTATTGGGAAAGGGG - Intergenic
954295055 3:49669841-49669863 GACGCTTGGGCTTTGGAGAAGGG - Exonic
954421041 3:50419144-50419166 GAGGCTTAGGCTTTTGCAAGAGG + Intronic
955776417 3:62438393-62438415 CAGGCTTGATTTCTGGAAAGAGG - Intronic
960416701 3:117393764-117393786 AAGCAATGGTCTTTGGAAAGTGG - Intergenic
962043937 3:131735848-131735870 GAGGCAGGGTCTATGGAAATTGG - Intronic
962353365 3:134672792-134672814 GAGGCTTGGGCTGGGGCAAGGGG - Intronic
962760381 3:138507049-138507071 GAGGCTTTGTCCTTTAAAAGGGG - Intronic
962855400 3:139340458-139340480 GAGGTTTGGACTTTGAATAGGGG + Intronic
964322802 3:155515783-155515805 GGGGGTTGGTCTTTAGCAAGTGG - Intronic
965785477 3:172330475-172330497 GAGGCTTGGCATTTTAAAAGAGG - Intronic
967880157 3:194296073-194296095 GAGGCGTAGGCTTCGGAAAGAGG + Intergenic
969760896 4:9180898-9180920 GTTGCTTCCTCTTTGGAAAGGGG + Intergenic
970644005 4:18098571-18098593 GAGGGTTGGGCTGTGGGAAGGGG + Intergenic
972819025 4:42677777-42677799 AATGATTGGTCTTTAGAAAGAGG + Intergenic
973886689 4:55329271-55329293 GAAGCTTGGACTTTGGGAAGGGG - Intergenic
977425402 4:96862207-96862229 AAGGCAAGGTCTTTGGAGAGTGG + Intergenic
978408661 4:108405791-108405813 GAGGCTTGCACTTTCGGAAGTGG + Intergenic
980969202 4:139553776-139553798 GAGGCTCTGTTTATGGAAAGAGG + Intronic
981050464 4:140304706-140304728 GAAGGCTGGTCTTTGGGAAGGGG + Intronic
982503986 4:156195247-156195269 GAGGATTGTTCTTAGAAAAGAGG + Intergenic
982802206 4:159719378-159719400 GTGGGTTGGTCATTGGAAAAAGG - Intergenic
983911274 4:173242387-173242409 GAGGCATTGCCATTGGAAAGTGG + Intronic
984233200 4:177124816-177124838 GAGGTTTGAACTTTTGAAAGAGG - Intergenic
984632892 4:182079038-182079060 GAGGCTTTGACATGGGAAAGAGG + Intergenic
985208183 4:187563543-187563565 GTAGCTTGGTCTTTTCAAAGAGG - Intergenic
985479210 5:97197-97219 GGGGTTTGGACTTTGGAATGAGG - Intergenic
985900253 5:2783115-2783137 GTGGCTTGGTCCTGGGAAACAGG - Intergenic
985947136 5:3194545-3194567 GGGGCTTGTTGTTTGGAAATCGG + Intergenic
986607597 5:9537639-9537661 TAGGCTTCATGTTTGGAAAGAGG + Intronic
991507952 5:67344036-67344058 GATGCTTGGTTTCTGGAGAGTGG - Intergenic
992501074 5:77344641-77344663 GAGGCAGGGCCTTTGGGAAGTGG - Intronic
993728093 5:91391250-91391272 CAGTCCTGGTCTTTAGAAAGTGG + Intergenic
997032129 5:130142742-130142764 GATTCTCTGTCTTTGGAAAGTGG - Intronic
997839265 5:137224087-137224109 GAGGCTGGTTCTTTGGAAAGAGG + Intronic
998372140 5:141668791-141668813 CAGCCTTGGCCTTTGGAAATGGG + Intronic
998695262 5:144631051-144631073 GATCCTTTGCCTTTGGAAAGGGG + Intergenic
999180267 5:149665229-149665251 CAGGCTTGGTCCTTGGGAAGGGG - Intergenic
1001533201 5:172479397-172479419 GGGGCATGTTCTTTGGAAGGCGG - Intergenic
1002343796 5:178534336-178534358 GAGGCGGGGCCTTTGGAAGGTGG - Intronic
1002607477 5:180391626-180391648 GAGGCTGGGGGTTTGGTAAGGGG - Intergenic
1003174204 6:3743255-3743277 GAGGCCTGTTCTTTGGGTAGTGG - Intronic
1006027531 6:31157134-31157156 GGGGCTTTCTCTTTGGAAGGTGG - Intronic
1008484484 6:52020628-52020650 GCGGGTGGTTCTTTGGAAAGTGG - Intronic
1010120081 6:72365078-72365100 GTGGTTTGGTCTTTGCACAGAGG + Intronic
1012399554 6:98832889-98832911 GAGTCATGCTCTTTGGAGAGTGG - Intergenic
1013488450 6:110620511-110620533 AAGGATTGGTATTTGGAGAGAGG - Intronic
1014830747 6:126100040-126100062 TGGGCATGGTCTCTGGAAAGAGG - Intergenic
1015264423 6:131276280-131276302 GAGTTTTGGTTTTTGGCAAGAGG + Intronic
1015937860 6:138420645-138420667 CTTGCTTGGTCTTTGGCAAGAGG - Exonic
1017301069 6:152858609-152858631 GAGGCATGGTGATTTGAAAGTGG - Intergenic
1017504494 6:155055496-155055518 GAGGGTTTGTCTTTGGAAATAGG + Intronic
1021382346 7:19983541-19983563 GTGCCTTTGCCTTTGGAAAGAGG - Intergenic
1022080258 7:27012952-27012974 GAGGCTCCTCCTTTGGAAAGGGG + Intergenic
1023851312 7:44151913-44151935 GAGGGGTGGCCTTTGGAGAGGGG + Intronic
1024150356 7:46565545-46565567 GAGGCTTTGTAAGTGGAAAGAGG - Intergenic
1024806743 7:53150269-53150291 GAGGGTTAGTGTTTGGAAAGGGG + Intergenic
1025319946 7:58085920-58085942 GAGGGTTAGTGTTTGGAAAGGGG - Intergenic
1025478255 7:60954951-60954973 GAGGGTTAGTGTTTGGAAAGGGG - Intergenic
1025553766 7:62277556-62277578 GAGGGTTAGTGTTTGGAAAGGGG + Intergenic
1025561014 7:62375719-62375741 GAGGGTTAGTGTTTGGAAAGGGG - Intergenic
1026668049 7:72361236-72361258 GAGGCTTGGCCTTTGGATCTGGG - Intronic
1028827638 7:95291703-95291725 GAAACTTGTCCTTTGGAAAGTGG - Intronic
1031738531 7:125398145-125398167 TATGCTAGGTGTTTGGAAAGAGG - Intergenic
1032206464 7:129870155-129870177 GAGGCCTGGTGTTTGAGAAGAGG - Intronic
1032374075 7:131392230-131392252 GAGTCTTGGTTTTTGGTAAATGG + Intronic
1032487361 7:132297907-132297929 GAGGCTTGGTGTTCTGAAACAGG - Intronic
1034796060 7:154014757-154014779 GAGGCTTTGTTTTTAGAACGTGG - Intronic
1036271003 8:7302727-7302749 GTTGCTTCCTCTTTGGAAAGGGG + Intergenic
1036350346 8:8007617-8007639 GTTGCTTCCTCTTTGGAAAGGGG - Intergenic
1036845616 8:12168042-12168064 GTTGCTTCCTCTTTGGAAAGGGG - Intergenic
1036866982 8:12410361-12410383 GTTGCTTCCTCTTTGGAAAGGGG - Intergenic
1038027713 8:23606871-23606893 GAGTCTTGGTCTTGGGAACTGGG + Intergenic
1039687588 8:39822097-39822119 GAAGTATGGTATTTGGAAAGTGG - Intronic
1041412809 8:57575250-57575272 GCAGCTTGGTGTTTGGGAAGAGG + Intergenic
1045895728 8:107214270-107214292 GAGGGTTTGTCTTTGGGTAGTGG - Intergenic
1046143240 8:110121703-110121725 GAGGCTGTGCCTATGGAAAGGGG + Intergenic
1046619326 8:116511770-116511792 GAGACTTGGTGGTTGGGAAGGGG + Intergenic
1046661676 8:116954217-116954239 GAGGATGGGACTTTGGAATGGGG + Intronic
1048734134 8:137479522-137479544 GATACTTTGTCTTTGGGAAGTGG + Intergenic
1048823342 8:138399544-138399566 AAGGCTTGGTCTGTTGACAGTGG - Intronic
1048873712 8:138819972-138819994 AAGCCTTGGACTTTGAAAAGGGG - Intronic
1048989049 8:139750650-139750672 GCCGCATGGTCTTTGGAGAGAGG - Intronic
1049821868 8:144639904-144639926 GATGCTTTGTCTTAGGAAACTGG + Intergenic
1050562404 9:6847716-6847738 GAAGCTTGTTATTTGGAAACTGG - Intronic
1052023449 9:23550091-23550113 CAGGCTTGGTCTTATGAAAATGG - Intergenic
1052064702 9:24003568-24003590 GATGCTTGTTCATTAGAAAGTGG - Intergenic
1053146308 9:35714465-35714487 GGGGCTTGGTATTGGGAAAGAGG + Intronic
1053945832 9:43310106-43310128 GAGGGTTAGTGTTTGGAAAGGGG - Intergenic
1056425480 9:86471322-86471344 TAAGCTTGGTGTTTGGAACGGGG + Intergenic
1056702287 9:88920796-88920818 AGGGCTGGGTCTTTGGAAACAGG - Intergenic
1056783942 9:89574656-89574678 GTGGGATGGTATTTGGAAAGTGG - Intergenic
1056954997 9:91074528-91074550 GAGGCCTGGACTCTGGAGAGGGG - Intergenic
1059690140 9:116676739-116676761 AAGGCTTTATCTTTTGAAAGTGG + Intronic
1060666348 9:125434236-125434258 GAGGCCAGGCCATTGGAAAGTGG - Intergenic
1060753701 9:126193111-126193133 GAGGCTAGGTCTTGGGTAAGTGG - Intergenic
1061068337 9:128293257-128293279 GAGGCTTTGTGTGTGGAATGGGG - Intergenic
1061615450 9:131775992-131776014 GAGGTTAGGTCTTGGGAAAGTGG - Intergenic
1203588967 Un_KI270747v1:38687-38709 GAGGGTTAGTGTTTGGAAAGGGG - Intergenic
1186658718 X:11645719-11645741 GAAGCTTGGAATTAGGAAAGAGG + Intronic
1186709119 X:12174055-12174077 TAGGCTTAGGCTTTAGAAAGGGG + Intronic
1186782194 X:12924325-12924347 GAAGAGTGGGCTTTGGAAAGTGG + Intergenic
1188687092 X:33082529-33082551 AAGGCTTTGTCTTTTGACAGTGG - Intronic
1189375945 X:40466443-40466465 GGGGCAGGATCTTTGGAAAGGGG + Intergenic
1189744466 X:44155989-44156011 GAAGCTTTGTCTAGGGAAAGGGG - Intronic
1191692999 X:63960061-63960083 GAGACTTGGCCTGTGGAATGGGG - Intergenic
1191797662 X:65038562-65038584 AAGGGATGATCTTTGGAAAGAGG + Intergenic
1193078722 X:77383054-77383076 GACCCTTTGTCTTTGGAAAGGGG + Intergenic
1194447440 X:94006030-94006052 AAGGCTTTGTCTTTTGACAGTGG - Intergenic
1196064885 X:111453249-111453271 GTGACTTTGTGTTTGGAAAGGGG + Intergenic
1200926352 Y:8658412-8658434 GTGGCTAGGTATTTGGGAAGAGG - Intergenic
1201642170 Y:16191636-16191658 GTGGGTTGGTATTTGGAAATGGG + Intergenic
1201660645 Y:16393685-16393707 GTGGGTTGGTATTTGGAAATGGG - Intergenic
1201677439 Y:16603247-16603269 GAAGCTTGGTCTTTGCTAATGGG - Intergenic