ID: 1174847472

View in Genome Browser
Species Human (GRCh38)
Location 20:53956921-53956943
Sequence CAGAATAAAGACATGGAGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 291}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174847472_1174847475 19 Left 1174847472 20:53956921-53956943 CCCGACTCCATGTCTTTATTCTG 0: 1
1: 0
2: 2
3: 35
4: 291
Right 1174847475 20:53956963-53956985 TACTTGCCAAACACCATGCAAGG 0: 1
1: 0
2: 1
3: 20
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174847472 Original CRISPR CAGAATAAAGACATGGAGTC GGG (reversed) Intronic
901382219 1:8882044-8882066 AAGAAAAAAGAAATGGAGGCCGG + Intergenic
904109332 1:28113112-28113134 CAGAATAGAGAACTGGAGGCGGG + Intergenic
904839535 1:33363617-33363639 CAGAACAAAGACCTGGCATCTGG + Intronic
905227368 1:36488059-36488081 GAGAACAAAGACATGGAGGCTGG + Intergenic
905960622 1:42039650-42039672 GAGAATAAAGAAATGGATACTGG - Intergenic
906725067 1:48038434-48038456 CTGAACAAAGACCTGGAGGCAGG + Intergenic
906855043 1:49295083-49295105 GAGAACAAAGACATGGATGCTGG - Intronic
907402757 1:54234773-54234795 AAAAAAAAAGAGATGGAGTCTGG + Intronic
908343319 1:63205255-63205277 CTGAATAATGACATGGAGCCAGG - Intergenic
908399618 1:63758870-63758892 CAGAATGTAGATATGCAGTCAGG - Intergenic
908478518 1:64513029-64513051 CAGAATAAAGATTTGGACTCTGG - Intronic
910038701 1:82821013-82821035 AAGAATGAAGTCATGGGGTCCGG - Intergenic
910733141 1:90420974-90420996 AAGAATCAAGTCATGGAATCAGG - Intergenic
910805709 1:91188348-91188370 AAGAATCTAGACAGGGAGTCTGG + Intergenic
910977245 1:92919722-92919744 AAGAATAAAGAAATGGAGGGAGG + Intronic
911093993 1:94041087-94041109 CAGAACAAAGACACTGATTCTGG + Intronic
912080317 1:105928324-105928346 CATAATAAAGGCATAGAGTCGGG + Intergenic
912556711 1:110521548-110521570 AAGGATGAAGGCATGGAGTCAGG - Intergenic
912652891 1:111455906-111455928 AAGAACAAAGATATGGACTCAGG - Intronic
912670748 1:111621362-111621384 CATAATAAAGACAGAAAGTCTGG - Intronic
914390287 1:147215243-147215265 CAGAATAAAAACCTGAATTCTGG - Intronic
916295104 1:163210296-163210318 AAGAATAAAGACATACAGCCTGG - Intronic
918104231 1:181402643-181402665 CTGCATAAAGACAAGGAGCCAGG + Intergenic
919718890 1:200810590-200810612 AAGAATACAGACTTGGAGACTGG + Intronic
919830243 1:201535835-201535857 CAGAACCAAGGCATGGAGTCAGG + Intergenic
919853042 1:201686566-201686588 CAGCATAAAGAAATGTGGTCAGG - Intronic
920171899 1:204077128-204077150 CTGCATAAAGACCTGGAGACAGG + Intronic
920709265 1:208279515-208279537 CAGAGGAAACACATGGGGTCAGG - Intergenic
921669140 1:217907119-217907141 CTGAATAAAGGCAGGGAGTGGGG + Intergenic
921837681 1:219794836-219794858 CAGGTTAAAGACATGGGGTGGGG - Intronic
922650893 1:227337381-227337403 CTGAATAAAGACATGCAGCAAGG + Intergenic
923106485 1:230857666-230857688 GAAAATAAAGACCTGGATTCTGG - Intronic
924474417 1:244370766-244370788 CAGAATAGCGACATGGAGTTTGG + Intronic
1063572031 10:7224356-7224378 CAGAATTTACACATGGAATCTGG + Intronic
1064110703 10:12536259-12536281 TAAAATAAAGACATGAAGTATGG - Intronic
1065360241 10:24882592-24882614 AAGAATAAAGAAATGTAGTTTGG - Intronic
1069758174 10:70786597-70786619 CAGAGAAAAGACACAGAGTCTGG - Intergenic
1072047364 10:91670573-91670595 AAGAATAAAGAAAAGGATTCAGG + Intergenic
1072767257 10:98105597-98105619 GAGAATAAAGCCATAGAGGCAGG - Intergenic
1073159258 10:101375530-101375552 GAGAATAATGGCAGGGAGTCTGG + Intronic
1073225113 10:101911739-101911761 CATAAAAAAGACATGGGGCCAGG + Intronic
1075492226 10:122880905-122880927 CAGAATAAAGACACCAATTCAGG - Intergenic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1080962807 11:37180268-37180290 CAGAATAAAGATAAAAAGTCTGG - Intergenic
1081272193 11:41098168-41098190 CAGATTAGAGACTTGGAGTTTGG - Intronic
1081279187 11:41187419-41187441 CAGTAGAAAGACGTGGAGTTTGG + Intronic
1081388697 11:42503506-42503528 TGGATTTAAGACATGGAGTCAGG - Intergenic
1082814175 11:57497399-57497421 CTGAATAAAGCCAGAGAGTCAGG + Intronic
1083644214 11:64163398-64163420 CAGAATCGAGTCAGGGAGTCTGG - Intronic
1085169351 11:74435260-74435282 CAGAACAGAGACATGCAGACAGG - Intergenic
1085228430 11:74943795-74943817 CAGAAAAAAGAAATGTAGCCTGG - Intronic
1085482708 11:76836124-76836146 CAGATTAAAGACATGGAAAGCGG + Intergenic
1086478707 11:87209335-87209357 CAAAATAAAGAGATGGAGAAAGG + Intronic
1086607436 11:88712668-88712690 CAGAAAATAGACTAGGAGTCAGG + Intronic
1087269587 11:96097914-96097936 CACAGTAAAGATATGGAGGCAGG + Intronic
1088247785 11:107835954-107835976 AAGAATAAAGACAAGTTGTCTGG + Intronic
1088594695 11:111431916-111431938 GAGGATACAGACATGGAATCAGG + Intronic
1088877630 11:113949135-113949157 CAGAATCCAGTCATGGGGTCTGG + Intergenic
1089253677 11:117182277-117182299 CTGTACAGAGACATGGAGTCTGG + Intronic
1090030078 11:123198522-123198544 CTGGACAAAGACATGGAGTTAGG + Intergenic
1090667156 11:128922103-128922125 CAGAATGGAGACATGAGGTCAGG + Intergenic
1090872104 11:130757997-130758019 AAGAGTAGAGACATGGAGTAGGG + Intergenic
1091230397 11:133984398-133984420 GAGAATGAAGTCATCGAGTCAGG - Intergenic
1091421120 12:341603-341625 CATAATAGAGAAATGGAGGCTGG + Intronic
1091679413 12:2516136-2516158 TGGAATAAAGACGTGGAGGCTGG + Intronic
1091836006 12:3586257-3586279 CAGAATCAAGACATCGGCTCTGG + Intronic
1092850956 12:12626080-12626102 CAGAATAAAAACATAAATTCGGG - Intronic
1093026548 12:14250752-14250774 CACAATAAAGACAGGAATTCGGG + Intergenic
1093461101 12:19407596-19407618 AAGAAAAAAGAGATGGAGGCTGG - Intronic
1093466426 12:19453962-19453984 CAGAATAAAGACATAAACTGGGG - Intronic
1095475791 12:42586173-42586195 CACAATAAAGAGAAGGAGTTAGG - Intronic
1095710969 12:45287623-45287645 GAGAATAAGGAAAAGGAGTCAGG + Intronic
1096159170 12:49362819-49362841 CCTAATAAAAACATGGAATCTGG + Intergenic
1097450250 12:59729415-59729437 CAGAATAAAGAGAGAGAGGCAGG - Intronic
1097515492 12:60599966-60599988 AAAAATAAAGACATGCAGACTGG + Intergenic
1098823567 12:75264828-75264850 CAGAGTAAAAAAATGCAGTCAGG - Intergenic
1099157900 12:79202521-79202543 AAGAAGAAAGAGAAGGAGTCAGG + Intronic
1099386924 12:82025461-82025483 AATAGTAAAGACATGGAATCAGG + Intergenic
1100030593 12:90185492-90185514 AAGAAGAAATACATGGAGACAGG - Intergenic
1102688563 12:114742695-114742717 CAGAAAAGAGAGATGGAGGCAGG + Intergenic
1102909720 12:116703636-116703658 CAGAATAAAGACATGGGGGTGGG + Intergenic
1103329427 12:120143832-120143854 CAGAATAAAGACATTGCTACAGG + Intronic
1104753308 12:131253507-131253529 CAGAGTAAAGACATGAGCTCAGG - Intergenic
1107749409 13:43548441-43548463 CAGAATTAAGAGATGGAGAAAGG - Intronic
1107990683 13:45816351-45816373 TGGAATAAAGACATGAAGTGAGG + Intronic
1108079597 13:46721103-46721125 CAGGATAACGAAATGGTGTCTGG - Intronic
1108214313 13:48169086-48169108 AAGAATGGAGACATGGAGACTGG + Intergenic
1108956545 13:56165884-56165906 CAGGAGAAAGAGATGGAGTGGGG + Intergenic
1109372244 13:61437830-61437852 CAGAAGAGAGAAATGGATTCTGG + Intergenic
1109611261 13:64767765-64767787 CAGCCTAAAGACATGGATTCAGG - Intergenic
1110190348 13:72723157-72723179 AAGAACAAAGGCATGAAGTCAGG - Intronic
1111092755 13:83468336-83468358 CAAAATAAATATATGGAGACAGG + Intergenic
1111172111 13:84541162-84541184 TAGAATAAAGAACTGGAATCAGG - Intergenic
1112887417 13:104191695-104191717 CTGACTGAAGACATGGAGCCAGG + Intergenic
1114134838 14:19835312-19835334 CAGAATTAAAACATGCAGTTGGG + Intergenic
1114337383 14:21705172-21705194 AAGAATAAAAAGATGTAGTCTGG + Intergenic
1115998006 14:39213633-39213655 CAGAAAAAAGACATAGAGGCTGG + Intergenic
1117105199 14:52391239-52391261 CAGTATTAAGAAATGGAGTTGGG + Intergenic
1118196246 14:63629311-63629333 GAGAATAAAGAGATGAAGTTTGG - Intronic
1119857938 14:77914883-77914905 GAGTATAAAGACTTGGAGTTGGG + Intronic
1120647315 14:87089460-87089482 GAGAATAAAAAGATGGATTCTGG - Intergenic
1121432973 14:93900377-93900399 CAGCAGAAGGAGATGGAGTCAGG - Intergenic
1122188063 14:100017062-100017084 CAGAGTAATGACATGGATTCCGG - Intronic
1122457161 14:101863309-101863331 AAAAAAAAAGACATGGAGTCTGG + Intronic
1123108891 14:105856094-105856116 CAGGAGAAAGTGATGGAGTCGGG + Intergenic
1124409196 15:29421970-29421992 CAGAATGAGGACATGGGGCCGGG + Intronic
1124899517 15:33809347-33809369 CAGAATCAAGTCAGGGACTCTGG - Intronic
1125239457 15:37557752-37557774 CAGAATAAAGGCATTGAGAGTGG + Intergenic
1127001681 15:54515934-54515956 CAGAATAGAGCCAAGGAATCTGG + Intronic
1127454489 15:59144588-59144610 CAGAAAAAAGACCTGGAACCCGG - Intronic
1130759250 15:86800815-86800837 GAGAATAAAGAAATGGAGACTGG + Intronic
1130788608 15:87127405-87127427 CAGGATAAGGACATGGTCTCTGG - Intergenic
1131410923 15:92207829-92207851 CAGGCTAAAGACATGGTGTCAGG + Intergenic
1131468909 15:92678709-92678731 CAGAATAAAGACATAGAAGGTGG - Intronic
1133474074 16:6102902-6102924 TAGAAGAAAGTGATGGAGTCTGG + Intronic
1134432207 16:14220847-14220869 AAGAAAAAAAACCTGGAGTCAGG + Intronic
1134839715 16:17392010-17392032 CGAAATAAAGACATTGAGACTGG - Intronic
1137083546 16:36095781-36095803 CAAAATAAAGAGATGGAGGGAGG - Intergenic
1137687270 16:50394847-50394869 CAGAAATAAGACATGGAGTGGGG + Intergenic
1138124189 16:54425381-54425403 TAGAATAAAGAAATACAGTCAGG - Intergenic
1138904089 16:61309509-61309531 CAGATTCAAGACAAGGAGTATGG - Intergenic
1138990997 16:62391209-62391231 CAGGATGATGACAAGGAGTCAGG - Intergenic
1139084146 16:63563396-63563418 CATAATAAACACATGGGGTGGGG + Intergenic
1139234380 16:65319069-65319091 CTGAATAAAGGCCTGGAGGCAGG + Intergenic
1139256336 16:65546533-65546555 CAGAATTAAGAGATGGGGGCAGG - Intergenic
1140725443 16:77807421-77807443 CTGAACAAAGACATGGGGACTGG - Intronic
1142879857 17:2875848-2875870 AAGAATGAAGACCTGGAGTTGGG - Intronic
1145692642 17:26759240-26759262 CAGAAAAATGACATGAAGCCGGG + Intergenic
1145925952 17:28646770-28646792 TGGAATAAAGGCAGGGAGTCGGG + Intergenic
1146278945 17:31532667-31532689 GAGAATGAAGACAGGGAGCCAGG - Exonic
1148171763 17:45526797-45526819 TGGAATAAAGACATCGAGGCTGG + Intergenic
1148277611 17:46319606-46319628 TGGAATAAAGACATGCAGGCTGG - Intronic
1148299818 17:46537461-46537483 TGGAATAAAGACATGCAGGCTGG - Intronic
1148364258 17:47041752-47041774 TGGAATAAAGACATCGAGGCTGG - Intronic
1148643345 17:49204588-49204610 CAGAATGGTGAGATGGAGTCAGG + Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1149449084 17:56735532-56735554 AGGAACAAAGACATGGAATCAGG + Intergenic
1151800356 17:76375870-76375892 CTGGAAAAAGACATGGAGCCCGG - Intronic
1151986416 17:77546939-77546961 CAGAACAAAGGCCTGGAGACTGG + Intergenic
1153774163 18:8438206-8438228 CAGAGTAAAGACATGGCCTTGGG - Intergenic
1155774591 18:29744387-29744409 AAGAATACAGAAATGGAGTCAGG + Intergenic
1156575443 18:38309855-38309877 CAGAATAAAGAAAAGCAGTAAGG + Intergenic
1156757956 18:40551489-40551511 TAGAATTGAGACATGGAGGCAGG - Intergenic
1157171924 18:45415248-45415270 CAGAATTGAGACCTGGGGTCAGG + Intronic
1158008082 18:52695983-52696005 CAGAATAAAAACTTTGAGTATGG - Intronic
1158864822 18:61628271-61628293 GTGAGTAAAGACATGGAGACAGG - Intergenic
1159152754 18:64541120-64541142 CAAAACAAAGACACGGAGTCTGG - Intergenic
1159191975 18:65057900-65057922 CAGACAAAAGACATGCAGTCGGG - Intergenic
1159744344 18:72212596-72212618 CAGAATATAGACTTCAAGTCTGG + Intergenic
1161961804 19:7527501-7527523 CAGTCTAAGGACAGGGAGTCAGG - Exonic
1163945853 19:20533348-20533370 CAGAATAAAGACATTGAATGTGG - Intergenic
1165639110 19:37369182-37369204 CAGAATGAAGACATTGTGTGAGG + Intronic
1168257646 19:55175406-55175428 CAGAAGGAAGGCATGGAGTGAGG + Intronic
925825546 2:7845293-7845315 CAGAAGAAAGAAATGGGCTCTGG - Intergenic
926573596 2:14556353-14556375 CAGAAATAAGATATGGAGTGGGG + Intergenic
926864434 2:17342375-17342397 CAGAATAAGAACATGGAGATCGG + Intergenic
928185886 2:29110424-29110446 AAGAATGAAGACAGGGAGTTTGG + Intronic
928871979 2:35990806-35990828 CAAAATAGACACATGTAGTCTGG - Intergenic
928915976 2:36470931-36470953 CAGAATATTAACATGGAGTTTGG + Intronic
930499714 2:52198134-52198156 CAGAATAAAGGCATGGAATTGGG + Intergenic
930997051 2:57732648-57732670 ACGAATACAGGCATGGAGTCAGG + Intergenic
931662316 2:64577149-64577171 AAGAACAAAAACATGGAGACAGG - Intronic
931722487 2:65077429-65077451 CAGAGCAAAGACATGGAGGGAGG + Intronic
933148848 2:78890258-78890280 GATAATAAAGACCTGGAGTGTGG - Intergenic
933556906 2:83841986-83842008 CAGCATATAGACATGCAGTTGGG - Intergenic
935224254 2:101039326-101039348 CAGAATAATAACATGGAGTTAGG + Intronic
936488126 2:112944716-112944738 CAGAGTAAAGACATGACGTATGG - Intergenic
938947948 2:136230843-136230865 CAGAATCAAGTCATGGAGCCAGG - Intergenic
939028709 2:137044860-137044882 CAGAATAGTGACATGGATTCAGG - Intronic
939675337 2:145065433-145065455 CAGAATAAATACCAGGAGACTGG + Intergenic
941830738 2:169955897-169955919 TAGAATAAACACATGGACTGGGG - Intronic
942658018 2:178234840-178234862 CAGATTCAAGGAATGGAGTCTGG + Intronic
945752055 2:213799793-213799815 CAGAATAAATATATGGGTTCCGG + Intronic
946445794 2:219738863-219738885 CAAAAAAAGGACATGGATTCTGG + Intergenic
946683900 2:222247146-222247168 AGGAATAAAGACATGGACTTGGG - Intronic
947161187 2:227216425-227216447 CAGAATAAAGAGATGCGGTAAGG - Intronic
947545855 2:231009680-231009702 CAGGATGAAGACAGGGACTCCGG - Intronic
947583646 2:231337718-231337740 AAGAATATAGACATTGAGGCCGG - Intronic
1169864087 20:10181495-10181517 CAAAATAAAATCATGGAGACGGG + Intergenic
1170270990 20:14527118-14527140 CAGCAGAACGACATGGAGTTTGG - Intronic
1171320415 20:24238923-24238945 CAGACTGGAGACCTGGAGTCGGG - Intergenic
1174554476 20:51383936-51383958 CAGAAAAGAGACCTGGAGGCTGG + Intergenic
1174847472 20:53956921-53956943 CAGAATAAAGACATGGAGTCGGG - Intronic
1177738480 21:25122555-25122577 AAGAATAAAATAATGGAGTCAGG + Intergenic
1178684908 21:34703080-34703102 CAGGAGAAAGACATGGCGTCTGG - Intronic
1179176096 21:39009370-39009392 CAGAATTACGACAAGGTGTCTGG + Intergenic
1180685239 22:17661071-17661093 AAGAAAAAAGAAATGGAGCCAGG - Intronic
1181900599 22:26152323-26152345 CAGTATGAAGATATGGACTCTGG - Intergenic
1182106684 22:27694821-27694843 CTGAATAAAGAGATGGAGACAGG + Intergenic
1183020077 22:35019851-35019873 AAGAATAAAGACATGGAGGCTGG - Intergenic
1183559634 22:38561351-38561373 AGGAAAAAAGAGATGGAGTCAGG - Intronic
1184283378 22:43451885-43451907 CACAAGAAAGGCATGGAGGCGGG - Intronic
1185385008 22:50527561-50527583 CAGAAGCAGGCCATGGAGTCAGG + Intronic
949320154 3:2800735-2800757 AAAAGTTAAGACATGGAGTCAGG - Intronic
950135518 3:10578003-10578025 CAGAGTAGAGACTTGGACTCTGG - Intronic
950721848 3:14888790-14888812 CAGAACAAAGACACAGAGGCTGG + Intronic
951268666 3:20599839-20599861 CAAAATAAAGAGATGGAGAAAGG - Intergenic
951937844 3:28041726-28041748 CAGGATAAAGACTAGGAGTCTGG + Intergenic
953099464 3:39810332-39810354 CAGAATTAAGAGTTTGAGTCAGG - Intronic
954922661 3:54205057-54205079 AATAATGAAGACATGGAGTTAGG + Intronic
955903045 3:63777660-63777682 TAGAATTAAGACATAGATTCAGG + Intergenic
956289667 3:67648243-67648265 GAGATTAAAGACACGAAGTCTGG - Intronic
957000311 3:74876704-74876726 CAGAATCAGAACATGGAGACTGG - Intergenic
957898336 3:86452517-86452539 CAGTAAGAAGACATGGACTCAGG - Intergenic
958932963 3:100227174-100227196 CAGAAGGAAGTCAGGGAGTCAGG - Intergenic
960794301 3:121468443-121468465 CAGAATAAAGACATAAAATCAGG + Intronic
960813337 3:121647380-121647402 AGGAAGAAAGAGATGGAGTCAGG - Exonic
960996958 3:123346482-123346504 CAGATGGAAGACATGCAGTCAGG + Intronic
961265631 3:125640053-125640075 AACAGCAAAGACATGGAGTCAGG + Intergenic
962127531 3:132637067-132637089 CAGAATAAAGTCGTGAAGTAAGG - Intronic
963450094 3:145468390-145468412 CAGAAGAAAGATATGGATTCTGG + Intergenic
963514486 3:146291752-146291774 CAAAATAAAGAGATGGAGGAAGG - Intergenic
965906455 3:173713221-173713243 AAGAATAAAGAAAAGGAGTTAGG + Intronic
966427428 3:179794381-179794403 CAAAATAAAGTCCTTGAGTCAGG - Intergenic
967380781 3:188855454-188855476 CAGGATAAAGAGACAGAGTCTGG + Intronic
969273419 4:6118408-6118430 CAGACAAATGACATGGAGGCTGG + Intronic
970060701 4:12030200-12030222 CAGAACAAAGACTTTGAGGCAGG - Intergenic
970166300 4:13241752-13241774 AAGAATAAATAAATGGAGCCAGG - Intergenic
972950530 4:44316883-44316905 CAGAAGAATGACATGAACTCAGG + Intronic
973531315 4:51839285-51839307 AATATTAAAAACATGGAGTCTGG + Intergenic
975423937 4:74204143-74204165 AAGAGGATAGACATGGAGTCAGG + Intronic
975494631 4:75024294-75024316 CTGATTAATGACATGGAGTAAGG + Intronic
976039214 4:80862072-80862094 CAAAATAAAGCCATTTAGTCAGG + Intronic
976478719 4:85514143-85514165 TAGAATAGAAAGATGGAGTCTGG - Intronic
976556897 4:86460773-86460795 CAAAATAAAGAGATGGGCTCTGG - Intronic
976886130 4:89986699-89986721 CAGTCTAAAGACCTGGAGGCAGG - Intergenic
977843993 4:101745001-101745023 CAGAACAAAGACACTGAGTCCGG - Intronic
979785344 4:124710909-124710931 CAGAATTAACACTTGGAATCTGG - Exonic
982273090 4:153611400-153611422 AAGGATAAAGACTTGGATTCTGG - Intronic
982929303 4:161382269-161382291 CAGAATGAAGACATGGATAAGGG - Intergenic
984315868 4:178130377-178130399 TAGAATGAAGACATGGAGAAGGG + Intergenic
985115515 4:186586247-186586269 GAGAACAAAAAAATGGAGTCTGG + Intergenic
986132811 5:4946608-4946630 CAGGATCTGGACATGGAGTCTGG + Intergenic
987143764 5:14971154-14971176 CAGAGTAAAGACCTGGACACAGG + Intergenic
987441337 5:17960803-17960825 CAGAATAAAGACATTTTATCAGG + Intergenic
988739199 5:34053328-34053350 CAGAATAAAGAAATGTATTTGGG - Intronic
990289003 5:54329829-54329851 CAGTATAAAGTTATGAAGTCAGG + Intergenic
991234333 5:64376575-64376597 AAGAATCAAGACATGGAAACAGG + Intergenic
992137771 5:73764736-73764758 CATAAGAAAGACATGAAATCAGG - Intronic
992574158 5:78094606-78094628 CAGAATAAAGTTATGGAGGAGGG - Intronic
993110264 5:83648454-83648476 CAGAATAAATATATGTAGTTTGG + Intronic
995180629 5:109227303-109227325 CAGAAAAAAGACTTTGAGACAGG - Intergenic
995319454 5:110816109-110816131 CAGAACAATGACATAGTGTCTGG + Intergenic
995321001 5:110833893-110833915 CTGAAGGAAGACATGGAATCTGG - Intergenic
995754322 5:115486505-115486527 ATGAATAAAGGCAAGGAGTCTGG + Intergenic
996956411 5:129188084-129188106 CAGAGCTAAGGCATGGAGTCAGG - Intergenic
998106496 5:139472361-139472383 CAGAGTAAAGACCTGGAGAGAGG - Intergenic
998145210 5:139723879-139723901 AAGAATATCAACATGGAGTCTGG - Intergenic
998440504 5:142157393-142157415 CAAAATAAAGATGTGGAATCAGG - Intergenic
999054283 5:148557161-148557183 CAGAGTAATGACATGGGGGCAGG + Intronic
999512775 5:152270129-152270151 CAGAATCAAGAGATGGAGACAGG - Intergenic
1000839271 5:166196423-166196445 AATAATAAAGACATGGGGCCGGG + Intergenic
1001492869 5:172168116-172168138 CAGAATAAAGACAGGGAAATAGG - Intronic
1001848772 5:174944541-174944563 CAGTAAAAAGACATGGAGGATGG + Intergenic
1003149102 6:3533694-3533716 CAGAACAAACAGATGGAGACAGG + Intergenic
1003556132 6:7141628-7141650 CAGAATAAAAACATGTAGCAGGG + Intronic
1004029569 6:11853088-11853110 CAGCAAAGAGACTTGGAGTCAGG + Intergenic
1004909928 6:20273127-20273149 CAGAAGAATCACATGAAGTCAGG - Intergenic
1005265838 6:24111353-24111375 CAGAACAAAGACATTAGGTCAGG - Intergenic
1005859744 6:29891076-29891098 CACAAGAAACACATGGACTCTGG - Intergenic
1013018280 6:106181458-106181480 CAGAAAAAAGACTGGTAGTCAGG + Intergenic
1013178516 6:107698544-107698566 CAGCAAAAAAACATGGAGGCAGG + Intergenic
1015489470 6:133809679-133809701 CATAAGAAAGACATGGCATCTGG - Intergenic
1016003180 6:139063019-139063041 CAGAAGAAAGCCATGGACTTTGG + Intergenic
1016818377 6:148324687-148324709 AAGAATAAAGAAATAGACTCTGG + Intronic
1017397263 6:154016817-154016839 CAGCAGAAAGAGACGGAGTCTGG + Intronic
1019911864 7:4105684-4105706 CAGAATTAGGACATAGATTCTGG + Intronic
1020005047 7:4778491-4778513 AAGAAACAGGACATGGAGTCTGG + Intronic
1023270290 7:38455365-38455387 CAGAATAAAGAATTGTAGGCTGG - Intronic
1025987060 7:66463137-66463159 TAGAAATAAGACATGGAGGCTGG - Intergenic
1027210332 7:76141967-76141989 TAGAAATAAGACATGGAGGCTGG - Intergenic
1029943318 7:104504071-104504093 CAGATGAAAGGAATGGAGTCTGG - Intronic
1030411790 7:109189784-109189806 CAAAAAAAAGCCATGGAGTAGGG - Intergenic
1030673688 7:112363994-112364016 CAGAAGGAAGAATTGGAGTCTGG + Intergenic
1030922279 7:115406485-115406507 TTGAATAAACACTTGGAGTCAGG + Intergenic
1031853900 7:126899402-126899424 CAGGACAAAGGCATGGAGTAGGG - Intronic
1032160436 7:129505435-129505457 CAGAATATAGACATGGTGTCAGG + Intronic
1034253289 7:149709477-149709499 CAAAATAAAGTCATAAAGTCAGG + Intergenic
1034633688 7:152550630-152550652 CAGAAAAGAAACATGGGGTCTGG + Intergenic
1035185809 7:157125265-157125287 CAGAAGAAAGACAGCGTGTCTGG - Intergenic
1035841554 8:2817297-2817319 CAGCAGAAAGACATGGGGACTGG + Intergenic
1035963273 8:4160684-4160706 AAGAGTGAAGACATGGAGTGTGG - Intronic
1037584115 8:20264806-20264828 CAGAATAAAGGGTTGGAGCCTGG - Intronic
1037687959 8:21159533-21159555 CAGAATAAAGAGAGGGAGCGGGG + Intergenic
1038390570 8:27196231-27196253 GAGAATAATGACATGAAGCCTGG - Intergenic
1039176273 8:34810370-34810392 CAGCAGAAAGAGATGGAGGCTGG + Intergenic
1039544339 8:38397841-38397863 AAGAATAAAGACTTGAAGGCCGG + Intronic
1040366985 8:46727687-46727709 CAAAATAAAGGCATGGAGGAAGG + Intergenic
1041398719 8:57418962-57418984 CAGATTAAAAACAGGGAATCTGG - Intergenic
1042640298 8:70926810-70926832 CAGACTATAGACTAGGAGTCAGG + Intergenic
1043692895 8:83179676-83179698 GAGAAGAAATACATAGAGTCTGG + Intergenic
1044456934 8:92400261-92400283 CAGACTAAAGACACGGGGTGAGG - Intergenic
1045312522 8:101015482-101015504 CACAATAAAGACATGCTGTTAGG + Intergenic
1045959060 8:107945725-107945747 CAGAATATAGACCTGGAGTATGG - Intronic
1046897704 8:119490608-119490630 CAGAATAAAGACATAGTCTCTGG + Intergenic
1047509062 8:125502410-125502432 AAGAGCAAAGACATGGAGGCTGG - Intergenic
1048075861 8:131070373-131070395 CAGAATAATGACAAGGAGAATGG + Intergenic
1050013796 9:1211723-1211745 CAGGTTAAGGACATGGAGACTGG - Intergenic
1052122690 9:24738133-24738155 CAACAGAATGACATGGAGTCTGG + Intergenic
1053400845 9:37820434-37820456 CAGAATCACTACATGAAGTCCGG + Intronic
1053464536 9:38296096-38296118 AAGAAAAAAGACATGGAGAAGGG + Intergenic
1055160206 9:73117462-73117484 CAAAATAACTACATGGAGACTGG + Intergenic
1056558700 9:87711021-87711043 AAGAATAAAAAGATGGAGGCGGG + Intergenic
1056725338 9:89109386-89109408 CAGAATACATACATAGAGTTGGG + Intronic
1057835401 9:98440541-98440563 TAAAGTAAAGACCTGGAGTCTGG - Intronic
1058643369 9:107108296-107108318 AAGAATAAAGGCGTGGAGTCTGG + Intergenic
1059624179 9:116043554-116043576 CATAGTAAAGTCATGGACTCAGG + Intergenic
1059785541 9:117578736-117578758 CTGAACAAAGTCATGGAGACAGG + Intergenic
1062036992 9:134386784-134386806 CAGAAGAAAGACCTGGGCTCTGG + Intronic
1062605564 9:137347102-137347124 TAGAAAAATGACATGGAGGCTGG - Intronic
1186360047 X:8831472-8831494 TACAATAAAAATATGGAGTCAGG + Intergenic
1187726936 X:22213054-22213076 CAGAAAGAAGCCATGGAATCTGG + Intronic
1188595519 X:31895138-31895160 CACTACAAAGTCATGGAGTCTGG + Intronic
1188630805 X:32357582-32357604 CTGAATAATGACATGAAGTTCGG - Intronic
1189353107 X:40291922-40291944 CAGATGGAAGACATGGAGGCTGG - Intergenic
1189381174 X:40503373-40503395 CAGCCCAAAGACATGGAGTTGGG - Intergenic
1193416397 X:81229619-81229641 CAGCAGAACGACATGGAGTTTGG - Intronic
1194354412 X:92863930-92863952 CACGTTAAAGACATGGATTCAGG - Intergenic
1195379868 X:104260325-104260347 CAGAATAAAGACCTCTGGTCTGG - Intergenic
1195868016 X:109454312-109454334 CAGGATACAGACATGGACTGTGG - Intronic
1195869135 X:109467966-109467988 CAGAATTGAGATAAGGAGTCTGG - Intronic
1196308967 X:114138485-114138507 CAGAATAAAAGCTTGGAGCCAGG + Intergenic
1196715408 X:118806296-118806318 CAGTATTGAAACATGGAGTCTGG + Intergenic
1197343406 X:125301706-125301728 TAGAATAAAGACATGGAGGTAGG - Intergenic
1197687076 X:129451997-129452019 GAGAATAAAAAAATGGAGGCTGG - Intronic
1198064228 X:133080445-133080467 CAGCAGAAAGACATGGAATAGGG + Intronic
1199009561 X:142743124-142743146 TAGATTAAAGACAAGGAGGCTGG - Intergenic
1200213269 X:154356307-154356329 CAGAATGGAGACAGGGAGCCCGG - Intronic
1200662771 Y:5980958-5980980 CACATTAAAGACATGGATTCAGG - Intergenic