ID: 1174852620

View in Genome Browser
Species Human (GRCh38)
Location 20:54009285-54009307
Sequence GAGTGAAATCAACAGCATAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 212}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174852620 Original CRISPR GAGTGAAATCAACAGCATAA TGG Intronic
902236189 1:15059077-15059099 GAGAGAAATCAACAGAAAACAGG + Intronic
904268609 1:29333123-29333145 GCTTGTAATCTACAGCATAATGG + Intergenic
904394649 1:30211212-30211234 GAATGACATCAATAACATAAAGG - Intergenic
904668815 1:32146613-32146635 GTGTGATGACAACAGCATAAAGG - Intronic
907903461 1:58762811-58762833 GAGCTAAATCAACAATATAATGG + Intergenic
909259149 1:73464467-73464489 GAGTGACATCAGCAATATAATGG - Intergenic
909412065 1:75365929-75365951 GTGTGATATCAATAGCATACAGG - Intronic
909757656 1:79246513-79246535 AAATGAAAGCAACAGCATGAAGG + Intergenic
914340671 1:146757272-146757294 TAGTGAAATCTGCAGCATTAAGG - Intergenic
916329779 1:163601814-163601836 TAGTGAAATGAAAAGAATAAGGG + Intergenic
916361730 1:163977506-163977528 GAGTGAAGTAAACAGAATAAAGG - Intergenic
916961994 1:169897622-169897644 GAGTGACATCAAGAGCAAATAGG - Intergenic
917976092 1:180239561-180239583 GAGGGAAATCACCAGCAAAAAGG + Intronic
924310131 1:242732317-242732339 GGATGAATTCAACAGCAGAATGG + Intergenic
924700202 1:246443789-246443811 GAGTGAAATCTACAGCTGCAGGG - Intronic
1063124588 10:3127399-3127421 GAATGACATCAACCGCTTAATGG - Intronic
1064013095 10:11751484-11751506 AAGTGAAATCAACAGCAGATTGG + Intronic
1064376613 10:14802101-14802123 GTGGGAACTCAACAGCATTAAGG + Intergenic
1064998773 10:21318708-21318730 GAGTGAACTGAACGGCAAAACGG - Intergenic
1067282495 10:44883050-44883072 CAGTGAAAACAACAGAATCAGGG - Intergenic
1071377360 10:85022276-85022298 CAGTGAAGTCAACAGCATGAAGG + Intergenic
1072083474 10:92056298-92056320 GACTGAAATCAACAGAAGACAGG + Intronic
1075635585 10:124028178-124028200 AAGTGACAGCAACAGCAAAAGGG + Intronic
1076002010 10:126919805-126919827 GAGAGAAAGCAACAGGATTAAGG - Intronic
1078179770 11:9001853-9001875 GAGGGAAATCAACTCCATGACGG + Intronic
1078489866 11:11758754-11758776 AAGTGAAATCAAAACCACAATGG + Intergenic
1080806466 11:35658805-35658827 GAGTGGAATCAAGAGCTCAATGG + Intergenic
1081079725 11:38726679-38726701 CACTCACATCAACAGCATAAAGG + Intergenic
1086688674 11:89763171-89763193 GTGGGAAAGCAATAGCATAAAGG - Intergenic
1086717185 11:90076786-90076808 GTGGGAAAGCAATAGCATAAAGG + Intergenic
1087185223 11:95184263-95184285 GAGGGAAAGCAATAGCATGAGGG + Intronic
1088178405 11:107081164-107081186 GTATGAAAGCAACAGCAAAAAGG - Intergenic
1088330595 11:108647173-108647195 GAATGAAATCAAAATGATAATGG - Intergenic
1088465456 11:110131780-110131802 GAGGGAAAGAAAGAGCATAAAGG + Intronic
1093170998 12:15860147-15860169 GTGTGAAATTAGCAGCATATGGG - Intronic
1094580182 12:31727553-31727575 GAGTGAAATAAAAAGAGTAAAGG - Intronic
1095380710 12:41587857-41587879 CTTTGAAATCACCAGCATAATGG + Intergenic
1098892377 12:76022923-76022945 GAGGGGAGTAAACAGCATAATGG - Intergenic
1099980008 12:89588158-89588180 GAAAGAAATCAACACCATCACGG + Exonic
1100603490 12:96132281-96132303 GAGTGAAATAAAAAGCATGCAGG - Intergenic
1104135653 12:125935499-125935521 GAGTGAAATCATAAGAAGAAGGG - Intergenic
1108882362 13:55135904-55135926 GATTGAAAATAACAGCAAAATGG + Intergenic
1109210176 13:59525997-59526019 GAGGGAAAGCAAAGGCATAAGGG - Intergenic
1109996430 13:70133395-70133417 CAGTGAAAAAAATAGCATAAAGG + Intergenic
1113340549 13:109420142-109420164 GAGAGCAATCAGCAGCATGATGG - Intergenic
1113373061 13:109740139-109740161 GATTGAAAGCAAAAACATAAGGG - Intergenic
1113515592 13:110894440-110894462 GAGTGAAAACTACAGAATTAGGG + Intronic
1115933940 14:38530279-38530301 GAGTGATATAAAAATCATAAGGG + Intergenic
1116124059 14:40758794-40758816 GAGTGAATTCTATAGCAAAAAGG + Intergenic
1116755395 14:48941858-48941880 AAGTAAAACCAACAGAATAAAGG - Intergenic
1117992345 14:61446683-61446705 GACTGAGATTAACAGCATACAGG - Intronic
1120118335 14:80647283-80647305 GAGTGAACAAAACAGCAAAATGG - Intronic
1121880207 14:97493170-97493192 GAGTGGAATAAAAAGCACAATGG + Intergenic
1124346384 15:28924149-28924171 GAGGGAAAGCAACAGCACCAGGG - Intronic
1125051791 15:35307508-35307530 GAGGAAAAACAACAGTATAAAGG + Intronic
1127577651 15:60307705-60307727 AAATGAAATCTACAGCTTAAGGG + Intergenic
1127908180 15:63392981-63393003 GAGGCAAATAAACAGAATAAGGG + Intergenic
1129038472 15:72665094-72665116 GTGGGAAACCAAGAGCATAAGGG - Intronic
1129476125 15:75785649-75785671 GTGGGAAACCAAGAGCATAAGGG - Intergenic
1132030793 15:98437335-98437357 GAGTGAAGTCTACAGCCTAGAGG - Exonic
1132184474 15:99791701-99791723 CAGGGAAACCAAGAGCATAAAGG - Intergenic
1132432498 15:101772958-101772980 CAGGGAAACCAAGAGCATAAAGG + Intergenic
1137468125 16:48729735-48729757 GAGTGAAAAGATGAGCATAATGG + Intergenic
1139024732 16:62801727-62801749 GAGTGAATGCAAAAGCAGAAAGG - Intergenic
1139184080 16:64783599-64783621 TTGTGAAATCCACAGCAAAAAGG + Intergenic
1139993614 16:70960134-70960156 TAGTGAAATCTGCAGCATTAAGG + Intronic
1140200838 16:72893508-72893530 GATTGAAATAAACATCATACCGG + Intronic
1140307359 16:73815874-73815896 CAGTGAAACCAACTTCATAAAGG + Intergenic
1141264470 16:82483758-82483780 GGGTGAGCTCAACAGCAGAATGG + Intergenic
1146066372 17:29639068-29639090 GAATGAAGGGAACAGCATAAAGG + Intronic
1146483477 17:33224425-33224447 GAGTGAGATCAAGAGGAGAAAGG + Intronic
1147765742 17:42834379-42834401 GAGTGAAATAAATAGAAAAATGG + Intronic
1149877020 17:60245050-60245072 GAGTGACAACAATAGCACAAAGG - Intronic
1153342845 18:3993203-3993225 GTAGGAAATCAACAGCATAGGGG + Intronic
1153562483 18:6385097-6385119 GAGTGAGATAAAAAGCTTAAAGG + Intronic
1154381647 18:13856855-13856877 GAGAAAAATCAACACTATAATGG - Intergenic
1156488537 18:37482328-37482350 GAGTGAGATCAAGAGTATGAGGG + Intronic
1157181934 18:45505911-45505933 GAGAGAAATCCACATCAGAATGG - Intronic
1159296852 18:66501581-66501603 GAGTGATCTCAACAGCCTCACGG - Exonic
925318001 2:2940053-2940075 GAGAGAAATCAACAAGACAATGG + Intergenic
926263564 2:11291910-11291932 GAGGGAAATCAAGACCATCATGG + Intronic
926778253 2:16443474-16443496 GAATAAAATTAACAGCATATTGG + Intergenic
930761790 2:55046558-55046580 GAGGAAAATAAACAGGATAATGG - Intronic
930775332 2:55165152-55165174 TAGTGCAGTCAACAGCATACTGG - Intergenic
938129918 2:128706159-128706181 GTTTGAAAACAACAGCACAAAGG - Intergenic
939318720 2:140587079-140587101 GAATAAACTCAACAGCAGAATGG + Intronic
939422983 2:141997671-141997693 GAGAGAAAAAAAAAGCATAAAGG - Intronic
939835837 2:147128473-147128495 GAATGAAATAAAGAGCATAATGG + Intergenic
940538460 2:154978834-154978856 AAATGAAAACAACAGCATATGGG + Intergenic
942175936 2:173334744-173334766 AACTGAAATTAACAGCAGAAAGG - Intergenic
942688519 2:178560284-178560306 GAGTGAAATCAACAGGACTTCGG - Exonic
942782743 2:179665204-179665226 GTGTGAAATAAACAACATAAAGG + Intronic
943591819 2:189807684-189807706 AAGGAAAATCAACAGCAAAAGGG - Intronic
944076206 2:195733993-195734015 GAATGAAAGCAATGGCATAAGGG + Intronic
944076307 2:195734983-195735005 GAGGGCAATCACCAGCATAATGG - Exonic
945051969 2:205832587-205832609 GAGGAGAATCAACAGCAGAATGG + Intergenic
945224348 2:207517859-207517881 GTCTGAAAACAACAGAATAATGG + Intergenic
948514106 2:238492613-238492635 GGGTAAACTCAACAGCAGAAGGG - Intergenic
1170198220 20:13713128-13713150 GAGTGATATCAAAATAATAAGGG - Intergenic
1170484800 20:16805510-16805532 GAAGGCAATCCACAGCATAAAGG - Intergenic
1174839885 20:53891856-53891878 GAGTGCAATCAGCAGAACAATGG - Intergenic
1174852620 20:54009285-54009307 GAGTGAAATCAACAGCATAATGG + Intronic
1175043424 20:56078120-56078142 TAGTGAACTCAACAGAGTAATGG - Intergenic
1175306827 20:57981977-57981999 CAGTGAAATCAGCAAGATAAAGG + Intergenic
1176723315 21:10410784-10410806 GAGAGAAATCAAGAGCAAGAAGG - Intergenic
1176994583 21:15540829-15540851 CAGTGAAATCTACAGCACAGAGG - Intergenic
1177258609 21:18699325-18699347 GAGTGACATTTACAGTATAATGG - Intergenic
1177939915 21:27397183-27397205 ATGTAAAATGAACAGCATAAGGG + Intergenic
1178797220 21:35755988-35756010 GAGAGGAATTAACAGCATATAGG + Intronic
1179096113 21:38315948-38315970 GGATGAACTGAACAGCATAATGG + Intergenic
1179677918 21:42997180-42997202 AAATGAAATAAACAGCATATGGG - Intronic
1180304473 22:11063521-11063543 GAGAGAAATCAAGAGCAAGAAGG - Intergenic
1181895113 22:26100284-26100306 AAGTGATATCAAGAACATAAAGG + Intergenic
949420773 3:3863389-3863411 GTGTAAATTCAACAACATAAGGG + Intronic
950636480 3:14318823-14318845 GAGTTAACTCATCAGCATAATGG + Intergenic
952506091 3:34007951-34007973 GAGGGGAAGCAACAGCAGAATGG - Intergenic
954987458 3:54808363-54808385 GAGTGAAGTCAACAGCAGGGAGG - Intronic
959361848 3:105403331-105403353 GAGTGAAGTGGACACCATAAGGG - Intronic
960305038 3:116050633-116050655 GAATGTAAGCCACAGCATAACGG - Intronic
963326641 3:143870307-143870329 GAGTCAAAACAACAGGAAAATGG + Intergenic
965007963 3:163050064-163050086 AAGTGTTATCAACACCATAAGGG - Intergenic
966547529 3:181167160-181167182 GAGTGACATCAACAAGATAGTGG - Intergenic
967099573 3:186205313-186205335 GAGTGATCTCAAGAACATAAAGG + Intronic
969698574 4:8750706-8750728 GTGTGACAGCAACAGCACAAAGG + Intergenic
971856356 4:32049229-32049251 GAGTGACATCAGCAACATTATGG - Intergenic
972378582 4:38497749-38497771 GATTGCAATAAACAGCCTAAAGG - Intergenic
973980863 4:56307088-56307110 GAGGGAAATCAAGACCCTAAAGG - Intronic
974459497 4:62168825-62168847 GAGTGACATCACCATCATCAAGG - Intergenic
975259117 4:72275354-72275376 AAGTGAAATAAACAGAACAAGGG + Intergenic
977376504 4:96211956-96211978 GAATGAGATCAACAGAGTAATGG + Intergenic
978607774 4:110500960-110500982 GAGTGAAGGCATCAGCACAAGGG + Intronic
981163123 4:141522506-141522528 CATTGAAATCAACAGGACAATGG - Intergenic
982217451 4:153094736-153094758 GAGAGAAACCAAAAGCATAGTGG - Intergenic
982532295 4:156560056-156560078 AAGTAAAATCAATAGCAAAAGGG - Intergenic
983067781 4:163230976-163230998 GAGTTAAATCAACACCAAATTGG + Intergenic
984812286 4:183806134-183806156 GAGTGAAATCTACAGCACAGAGG - Intergenic
984919275 4:184749643-184749665 GAGGGGAAGCAACAGCAAAAAGG + Intergenic
985948907 5:3208064-3208086 CAGTGTAATCAACAGCAGAGGGG + Intergenic
986420881 5:7580460-7580482 GAGTGAGATTAACAACATATTGG + Intronic
987562931 5:19547760-19547782 TAGGGAAATCAACATCCTAAGGG + Intronic
988656868 5:33221344-33221366 GACTGTTATCAACAACATAAGGG + Intergenic
988964708 5:36404370-36404392 GATGGAAATCAACAGGATAGGGG - Intergenic
993469854 5:88294030-88294052 AAGTGATATCAACAGAATGAAGG + Intergenic
993775623 5:91991794-91991816 GAGTGAGAAAAACAGCAGAAGGG + Intergenic
993992075 5:94669863-94669885 CAGTGAAATAAAGAGCACAAAGG + Intronic
994771451 5:103987004-103987026 TAATGAAATCAAGAGAATAATGG - Intergenic
995560650 5:113377514-113377536 GACTGAAATCAACAGCTTGCAGG + Intronic
996214005 5:120845754-120845776 AAATGAAATCAACAATATAATGG + Intergenic
998156785 5:139791497-139791519 GAATGAACTCAACATGATAAAGG + Intergenic
998189819 5:140014058-140014080 TATGGAAATCAACAGCATATAGG - Intronic
998895659 5:146797122-146797144 CACTGAAATCAACAGAATAAAGG + Intronic
999390915 5:151189353-151189375 AGGTGAAATCAATAGCAGAATGG + Intronic
999838357 5:155398769-155398791 GAGTGACCTCATCAGCACAATGG + Intergenic
1001602137 5:172935834-172935856 GATAGAAATAATCAGCATAAAGG - Intronic
1001869885 5:175142977-175142999 GAGTGACAGCAACATCACAAGGG + Intergenic
1002723284 5:181278849-181278871 GAGAGAAATCAAGAGCAAGAAGG - Intergenic
1004488409 6:16090457-16090479 AAGTGAAAATAACATCATAAAGG + Intergenic
1005195716 6:23281564-23281586 CAGCGATATCAGCAGCATAAAGG + Intergenic
1007151054 6:39691352-39691374 GAGTTAAATTAAGAGCCTAAGGG + Intronic
1007328506 6:41083461-41083483 GAGTAAAATGAGCAGGATAAAGG + Intronic
1010452386 6:76017642-76017664 CAGTGAAACCATCACCATAATGG + Intronic
1012172999 6:96042802-96042824 GTGTGAAATGAACAGAATAATGG - Intronic
1012263443 6:97113712-97113734 AAGAGAAAGCAACAGCATATAGG - Intronic
1012592097 6:100994638-100994660 GAGTGAAATCAAAATCAAAGAGG + Intergenic
1012771593 6:103442335-103442357 GAGTTAAATCAAGATTATAAAGG + Intergenic
1012882856 6:104812582-104812604 GAAAGAAAACAACAGCATACTGG + Intronic
1014313027 6:119829580-119829602 CAGTGAAATAGATAGCATAAAGG - Intergenic
1015230325 6:130907857-130907879 AAATGAAATCAACAGTACAAAGG + Intronic
1015457295 6:133441249-133441271 GAGTGGACTTAACAGCATATTGG - Intronic
1016196418 6:141348200-141348222 GAGAGAACTCACCAGCATTAAGG + Intergenic
1016537817 6:145127781-145127803 GAGTGAAATCAACAGGATTTTGG + Intergenic
1018621631 6:165734595-165734617 GAATGAAATAAACAACATATTGG + Intronic
1019809390 7:3153645-3153667 AAGTAAAATAAACAGCATACTGG + Intronic
1020430608 7:8113054-8113076 GGGTCAAATCAACAGCTTCAAGG + Intergenic
1021386561 7:20038172-20038194 GAGATAATTCAACATCATAAGGG - Intergenic
1022281526 7:28915622-28915644 AAGTGAAATCGACAGTAAAATGG + Intergenic
1023086050 7:36571188-36571210 GAGTGAAATATACAGCACAGGGG + Intronic
1024233523 7:47380567-47380589 GAGTGGAATAATCAGCAGAACGG - Intronic
1024358947 7:48447591-48447613 GAGTGAAATCAAGAGGTTAAAGG + Intronic
1024359918 7:48457392-48457414 CAGTGAAATAAACACCATGAAGG - Intronic
1025477146 7:60937343-60937365 GAATGAAATCAACATCAAATGGG - Intergenic
1026137830 7:67679013-67679035 AAGTGAAATCAGCAGAATAAGGG + Intergenic
1026730544 7:72908056-72908078 GGGTGAACTCAATAGCAGAATGG - Intronic
1027113427 7:75459050-75459072 GGGTGAACTCAATAGCAGAATGG + Intronic
1027285676 7:76643645-76643667 GGGTGAACTCAATAGCAGAATGG + Intergenic
1027460460 7:78446503-78446525 GAGTTATCTCAACAGCAAAATGG + Intronic
1027779473 7:82504378-82504400 GAGCAGAATCAACAGCAGAATGG + Intergenic
1031668259 7:124512432-124512454 TATTGAAATCACCAGTATAAAGG + Intergenic
1032684534 7:134219616-134219638 GAGTGACATCAACAGGACAAGGG + Intronic
1032962858 7:137059671-137059693 AAGAGAAATAAACATCATAAAGG + Intergenic
1033433606 7:141312115-141312137 GAGTGGAGTCCACAGCATATGGG - Intronic
1034730605 7:153384268-153384290 GAGTGCAATCATGATCATAATGG - Intergenic
1035004783 7:155647831-155647853 GACTGAAAACAAAAACATAAAGG + Intronic
1035695556 8:1593057-1593079 GAGTGATTTCAACAAGATAATGG + Intronic
1039042959 8:33425458-33425480 GAGTGGAATAAACAGAAAAAAGG + Intronic
1039422641 8:37456313-37456335 AAGTGACAGCAACAGCAGAAAGG - Intergenic
1039530343 8:38255855-38255877 AATTGAAATCAATGGCATAAAGG + Intronic
1041122262 8:54599221-54599243 GAGTGGGCTCAACAGCATCATGG - Intergenic
1041159162 8:55019504-55019526 GAATGAACTCAAGAGCAGAATGG + Intergenic
1041243846 8:55872534-55872556 GAGTGAAAACAAAGGCATAAAGG + Intergenic
1041681191 8:60593997-60594019 GAATGGACTCAACAGCAGAATGG + Intronic
1042889607 8:73593199-73593221 GAGTGAAACCAAAGGCAGAAAGG - Intronic
1044736178 8:95280933-95280955 TAGTGACATCAACAGCCAAAAGG - Intergenic
1046507399 8:115153626-115153648 CAGTGAAAGAAACAGAATAAAGG - Intergenic
1046852503 8:118990987-118991009 GAGTACAATGAACAGCATTATGG - Intergenic
1048470317 8:134699002-134699024 GAGTGAGATCAACATTAAAAAGG + Intronic
1048755023 8:137728828-137728850 GAGTGAAAGCAACAACATAGAGG + Intergenic
1053885465 9:42642248-42642270 GAGAGAAATCAAGAGCAAGAAGG - Intergenic
1054224484 9:62449697-62449719 GAGAGAAATCAAGAGCAAGAAGG - Intergenic
1054746252 9:68856829-68856851 GAGTGTGATCCACAGAATAATGG + Intronic
1054914257 9:70481270-70481292 GAGAGAAGTCACCAGCACAAGGG - Intergenic
1056188141 9:84157208-84157230 GAGTTAGATTAACAGAATAAAGG + Intergenic
1058825921 9:108775891-108775913 GAGTGAAATCCAAACCATGAAGG - Intergenic
1058926852 9:109674100-109674122 GAATGAAATTAACAGCAGACTGG - Intronic
1059897834 9:118888099-118888121 GAGGGAAATCTTCAGCATCATGG - Intergenic
1060765235 9:126290746-126290768 GTGTGAAATCATCATCATCAAGG - Intergenic
1187060260 X:15780239-15780261 GAGTGAAAAGAGCAGCAAAATGG - Intronic
1187239957 X:17503253-17503275 AAGTGAAATGAAAAGGATAATGG - Intronic
1189019925 X:37324562-37324584 GAATCATATCAACAGAATAAAGG + Intergenic
1189077776 X:37935917-37935939 AAGTGAATTAAACAGCATAACGG + Intronic
1190447827 X:50547528-50547550 CAATGAACTCAACAGCAGAATGG + Intergenic
1191724136 X:64261086-64261108 CAGTGTAATCAGCAGCATCAGGG + Intergenic
1192752874 X:74012584-74012606 GTGTGACATCAAGAACATAATGG + Intergenic
1193429343 X:81381871-81381893 CAGTGAAATCTAAAGCTTAAAGG - Intergenic
1193514123 X:82442416-82442438 CAGTGGAATAAACAGCAAAATGG + Intergenic
1194320286 X:92438307-92438329 GAGTGAAAGCAACAGCACCGAGG - Intronic
1194994087 X:100574232-100574254 CAGAAAAATCAACAGCATTAGGG - Intergenic
1198143217 X:133827440-133827462 TTGTGACAACAACAGCATAAAGG + Intronic
1199707551 X:150443639-150443661 GAATCAAATCAAGAGGATAATGG - Intronic
1199739933 X:150725662-150725684 GGATGACAACAACAGCATAAAGG - Intronic
1199860961 X:151800193-151800215 GGGTGAAATCAATAGCAGAAGGG - Intergenic
1200628406 Y:5551437-5551459 GAGTGAAAGCAACAGCACCGAGG - Intronic