ID: 1174854278

View in Genome Browser
Species Human (GRCh38)
Location 20:54028392-54028414
Sequence CTTCCCTGCAGGGACATCAT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 200}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174854273_1174854278 5 Left 1174854273 20:54028364-54028386 CCAAGTGGATACACCTTGGCACA 0: 1
1: 0
2: 0
3: 11
4: 91
Right 1174854278 20:54028392-54028414 CTTCCCTGCAGGGACATCATCGG 0: 1
1: 0
2: 1
3: 16
4: 200
1174854270_1174854278 23 Left 1174854270 20:54028346-54028368 CCGAGCATGCATTCAGAACCAAG 0: 1
1: 0
2: 1
3: 14
4: 170
Right 1174854278 20:54028392-54028414 CTTCCCTGCAGGGACATCATCGG 0: 1
1: 0
2: 1
3: 16
4: 200
1174854269_1174854278 24 Left 1174854269 20:54028345-54028367 CCCGAGCATGCATTCAGAACCAA 0: 1
1: 0
2: 0
3: 14
4: 135
Right 1174854278 20:54028392-54028414 CTTCCCTGCAGGGACATCATCGG 0: 1
1: 0
2: 1
3: 16
4: 200
1174854267_1174854278 26 Left 1174854267 20:54028343-54028365 CCCCCGAGCATGCATTCAGAACC 0: 1
1: 0
2: 0
3: 3
4: 75
Right 1174854278 20:54028392-54028414 CTTCCCTGCAGGGACATCATCGG 0: 1
1: 0
2: 1
3: 16
4: 200
1174854274_1174854278 -8 Left 1174854274 20:54028377-54028399 CCTTGGCACACTTACCTTCCCTG 0: 1
1: 0
2: 1
3: 22
4: 248
Right 1174854278 20:54028392-54028414 CTTCCCTGCAGGGACATCATCGG 0: 1
1: 0
2: 1
3: 16
4: 200
1174854268_1174854278 25 Left 1174854268 20:54028344-54028366 CCCCGAGCATGCATTCAGAACCA 0: 1
1: 0
2: 0
3: 4
4: 81
Right 1174854278 20:54028392-54028414 CTTCCCTGCAGGGACATCATCGG 0: 1
1: 0
2: 1
3: 16
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174854278 Original CRISPR CTTCCCTGCAGGGACATCAT CGG Exonic