ID: 1174855652

View in Genome Browser
Species Human (GRCh38)
Location 20:54042832-54042854
Sequence CCCTAGGCAAATTGGGAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 136}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174855652_1174855659 -2 Left 1174855652 20:54042832-54042854 CCTATTTCCCAATTTGCCTAGGG 0: 1
1: 0
2: 0
3: 9
4: 136
Right 1174855659 20:54042853-54042875 GGCTGGCCCAGCAGCGAGGCAGG 0: 1
1: 0
2: 3
3: 46
4: 380
1174855652_1174855658 -6 Left 1174855652 20:54042832-54042854 CCTATTTCCCAATTTGCCTAGGG 0: 1
1: 0
2: 0
3: 9
4: 136
Right 1174855658 20:54042849-54042871 CTAGGGCTGGCCCAGCAGCGAGG 0: 1
1: 0
2: 3
3: 25
4: 221
1174855652_1174855663 28 Left 1174855652 20:54042832-54042854 CCTATTTCCCAATTTGCCTAGGG 0: 1
1: 0
2: 0
3: 9
4: 136
Right 1174855663 20:54042883-54042905 CAATGAGCATCAGCTTTGAATGG 0: 1
1: 0
2: 1
3: 12
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174855652 Original CRISPR CCCTAGGCAAATTGGGAAAT AGG (reversed) Intronic
900243842 1:1628894-1628916 CCCTAGGCAGCCTGGGAAAGGGG + Intronic
906966507 1:50462569-50462591 CCCTAGGCAGTGTGGGAAAGTGG + Intronic
907480676 1:54743675-54743697 CCCTAGGTCAATTGGGAAAGTGG + Intergenic
910261247 1:85295708-85295730 CCCTTGTGGAATTGGGAAATGGG + Intergenic
911881413 1:103243300-103243322 ATTTAGGCAAATTGGGAAAAGGG + Intergenic
912260745 1:108109773-108109795 CCCTAGGCCTTGTGGGAAATGGG + Intergenic
912312256 1:108634497-108634519 ATCTTGACAAATTGGGAAATGGG + Intronic
913365978 1:118039358-118039380 CCCTAAGGAAATTGTGAAAAAGG - Exonic
918327484 1:183424076-183424098 GTCTAGGTAAATAGGGAAATAGG - Intergenic
919641706 1:200051612-200051634 CCCAAGGCAAACTGTGAAGTGGG - Intronic
921698717 1:218243333-218243355 GCTGAGGCAAATTGGGAAAGGGG + Intergenic
1063784245 10:9362637-9362659 CCCATGGCCTATTGGGAAATGGG + Intergenic
1063892654 10:10646260-10646282 CCTTAGGGAAATTGTGAAGTAGG - Intergenic
1067443853 10:46328274-46328296 GCCTATACAAATTGAGAAATGGG + Intronic
1069322926 10:67195374-67195396 CCCTACTCACATTGGGAAAGTGG + Intronic
1070105170 10:73424861-73424883 CCTTAGGCAATTTGGGGGATGGG - Intronic
1072304378 10:94093614-94093636 CACCAGGCAAATTGGGCAGTGGG - Intronic
1073456936 10:103643016-103643038 CCCTAGACAAATTGTGGAGTGGG - Intronic
1079154302 11:17930269-17930291 CTATAGGCAAGTTGGGAAGTGGG - Intronic
1079194373 11:18312614-18312636 CCCTTGGCAACTAGGGAACTGGG - Intronic
1080696645 11:34608485-34608507 CCCTAGGGTATTTGGGAAACTGG + Intergenic
1081650245 11:44818900-44818922 CATTTGGCAAATGGGGAAATAGG - Intronic
1081650249 11:44818908-44818930 ACCTAGGCCATTTGGCAAATGGG - Intronic
1086920392 11:92580294-92580316 CACTAGACAAAGTGGGACATTGG - Intronic
1087979472 11:104593377-104593399 TTCTAGTCAAACTGGGAAATTGG + Intergenic
1088457584 11:110049374-110049396 CAATAGGCAAATAGGCAAATAGG - Intergenic
1092626067 12:10330216-10330238 CCCTGGAAAAATTGGGGAATTGG + Intergenic
1094825211 12:34264387-34264409 CCCTAGGCAACGAGGGAAAGAGG - Intergenic
1099500481 12:83407776-83407798 CAGTAGGCAAATTTGGAATTGGG + Intergenic
1107393500 13:39992152-39992174 TCCTAGGCAAATGAGGAAGTTGG + Intergenic
1108204708 13:48075907-48075929 CTCTAGAAAAATTGGAAAATAGG - Intronic
1108294867 13:49004434-49004456 CCTTAGGCAAATTGACCAATGGG + Intronic
1109672106 13:65622609-65622631 GCCTAGGTAAAAGGGGAAATGGG - Intergenic
1114832612 14:26163567-26163589 CCCTAACCAAAATGGGAACTTGG - Intergenic
1117406061 14:55405345-55405367 CCCTAAACAAATTGAGAAATGGG - Intronic
1118780888 14:69006867-69006889 CCAGAGCCAAACTGGGAAATAGG - Intergenic
1120239880 14:81937939-81937961 GCGTAGGCATATAGGGAAATGGG + Intergenic
1139406499 16:66723121-66723143 CACTAAGCAAAATGGGAATTAGG - Exonic
1140378988 16:74469432-74469454 ACCTGAGCAAATTGGGAATTTGG + Intronic
1141754934 16:85984550-85984572 CCCAAGGTGAATTGGGACATTGG - Intergenic
1141942770 16:87289410-87289432 TCCTATGCAAAGTGGAAAATGGG - Intronic
1143003948 17:3814646-3814668 CCTTAGGAAAATTCGGACATAGG + Intronic
1144939202 17:18925737-18925759 CACTATGGAACTTGGGAAATGGG - Intronic
1146527644 17:33580497-33580519 CACTAGGCAAATTGGATGATGGG + Intronic
1146564110 17:33897066-33897088 GGGTAGGCACATTGGGAAATAGG + Intronic
1147398786 17:40166158-40166180 CAATAGGCAAAATGGGTAATAGG - Intronic
1147787138 17:42987066-42987088 TCCTAGGCAATTTGTCAAATGGG - Intronic
1148528609 17:48366978-48367000 CTCTAGGTAAATTGTTAAATAGG + Intronic
1155630931 18:27891276-27891298 AACAAGGCAAATTGGGAGATAGG + Intergenic
1156509303 18:37622475-37622497 AACTAGGCAAATTGTTAAATTGG - Intergenic
1166346216 19:42167789-42167811 CCATAGGCAATATGGGCAATGGG - Intronic
1167265687 19:48481998-48482020 CCCTTGGGAATTTGGGAATTTGG + Intronic
928720874 2:34119470-34119492 CCCTATGCAACTTGGGAAGGGGG - Intergenic
929352402 2:40973570-40973592 CCATAGGGGAAGTGGGAAATTGG + Intergenic
929738669 2:44578639-44578661 TACAAGGCAAATTGGGTAATGGG + Intronic
930108787 2:47659941-47659963 CCCTAGGGAAATCGTTAAATGGG - Intergenic
931538363 2:63302619-63302641 CCCTGTGCAAATTGGTAAAAGGG + Intronic
939494005 2:142906873-142906895 CCCTAGGAAAATTGTGAAAGTGG + Intronic
940186935 2:150996261-150996283 GCCTAGGGGAAGTGGGAAATGGG + Intergenic
940252165 2:151691004-151691026 CCAGAGGCAACTTGGGAAGTGGG - Intronic
941942713 2:171059938-171059960 TCCTTGGCCTATTGGGAAATGGG - Intronic
942014236 2:171795005-171795027 CCCAAGGCAATTAGGAAAATGGG - Intronic
942830416 2:180232683-180232705 CCCCAGGAAAATTGTGAAAGTGG - Intergenic
948168930 2:235885441-235885463 TCCTAGGCAAATTGGACAAGGGG - Intronic
1169792821 20:9429377-9429399 CCCTAAACTAAATGGGAAATAGG + Intronic
1169921190 20:10735802-10735824 CTCTAGGCACATGGGAAAATTGG - Intergenic
1171867726 20:30500521-30500543 CCCTAGGCAACTAGGGAGAGAGG + Intergenic
1173010317 20:39176179-39176201 GCCTAGGAATCTTGGGAAATTGG - Intergenic
1173186415 20:40843762-40843784 CCCTAGGCAAATTTTGAGACAGG - Intergenic
1174855652 20:54042832-54042854 CCCTAGGCAAATTGGGAAATAGG - Intronic
1175431276 20:58905781-58905803 CCCTAAGCATTTAGGGAAATAGG + Intronic
1176666908 21:9696078-9696100 CCTTAAGCAGATTGGGAATTTGG - Intergenic
1182020730 22:27079611-27079633 TACTAGACAAATGGGGAAATGGG + Intergenic
1183999102 22:41659295-41659317 CCTTAGGCAAATTCAGAAGTCGG + Intronic
949620702 3:5808701-5808723 CCCTATCCAAAGGGGGAAATTGG + Intergenic
954778042 3:53037410-53037432 CCATATGCAAATTGGGAAACAGG - Intronic
959303271 3:104629598-104629620 CCGTTGGCAAATTGTGAAATTGG - Intergenic
962222145 3:133573356-133573378 CCCTCGGCCAATCGGGAAACCGG + Intergenic
965932810 3:174067976-174067998 CCTGAGGCAAACTGGGAAGTAGG + Intronic
968391508 4:196699-196721 CCCCAGGAAAATTGTGAAAGTGG + Intergenic
973001751 4:44960914-44960936 CCCTAGGGAGATGGGGAAAGGGG - Intergenic
977079373 4:92504368-92504390 ACCTAAGCAAGTTGGAAAATAGG + Intronic
977112509 4:92976586-92976608 CAATAGGCAAGTTGGGAAGTGGG - Intronic
978531158 4:109715380-109715402 CCCAAGTCAAATTAGGACATTGG - Intronic
980264250 4:130494608-130494630 CCTTGGGCCAAATGGGAAATAGG - Intergenic
981744581 4:148040183-148040205 CCCCAGGCAAGTGGGGAACTTGG + Intronic
982839318 4:160162061-160162083 CTCTAGGCCAATTGTGATATGGG + Intergenic
985408103 4:189656270-189656292 CCTGAAGCAAATTGGGAATTTGG + Intergenic
986046852 5:4046378-4046400 CAGAAGGCAAATTGGGGAATAGG - Intergenic
986984409 5:13483645-13483667 CACTAGGAAAATTGGCAAAATGG + Intergenic
989146479 5:38256031-38256053 CCATAGGCGATTTGGGAAATAGG - Intergenic
990891926 5:60659523-60659545 CCCCAGGAAAATTGTGAAAGTGG - Intronic
992954833 5:81897024-81897046 GCCTGGGAAGATTGGGAAATAGG - Intergenic
993873258 5:93276594-93276616 TCCTGGGCAAACTGGGACATAGG + Intergenic
994003065 5:94804347-94804369 CCATAGCCAACTTGTGAAATGGG - Intronic
994313456 5:98304248-98304270 CTTTAGCCAAATTTGGAAATTGG - Intergenic
997639445 5:135439051-135439073 CCCAAGGCTGATGGGGAAATTGG - Intergenic
999440143 5:151594630-151594652 CCCCAGGCAAATAGGGGAAATGG - Intergenic
1001683320 5:173574972-173574994 CCCAAGGCAAATTGAGAAGTGGG - Intergenic
1005225919 6:23641775-23641797 ACCGAGGCAAATTGAGAAGTAGG + Intergenic
1006175108 6:32116814-32116836 CCCTAGGCAGGTGGGGAAACAGG + Exonic
1006613191 6:35307757-35307779 TCCTTGGCAAACTGGGAAGTGGG - Intronic
1010472984 6:76251812-76251834 CCCTAGGCAAATCTTGAGATGGG - Intergenic
1011190222 6:84720151-84720173 CCCCAGGAAAATTGTGAAAGCGG + Intronic
1012808344 6:103925035-103925057 CCCTGGGTAAATGGGTAAATGGG + Intergenic
1013072075 6:106738489-106738511 CACAAGGCAAATTGGTAGATCGG - Intergenic
1013255231 6:108378887-108378909 CCCTAGGCAAGCAGGGAAAAGGG - Intronic
1014513079 6:122348855-122348877 TCCTAGGCAAAGTGGGAAGTGGG - Intergenic
1015126505 6:129761002-129761024 TCATAGGCAAATTGGAAAATAGG + Intergenic
1020234292 7:6343809-6343831 CCCTAAACAAATTTGGAAAATGG + Intronic
1022831595 7:34072858-34072880 CCCTATTCAAATGGAGAAATTGG + Intronic
1024655789 7:51450477-51450499 CCCTATGCCAACTGGGAAAGTGG + Intergenic
1027905374 7:84173762-84173784 CCCATGGCAGATTGGGAACTGGG + Intronic
1028466013 7:91152839-91152861 CCATAGGCAAATCAGGAAAATGG - Intronic
1032725442 7:134586440-134586462 CCCCAGGAAAATTGTGAAAGTGG - Intergenic
1037637228 8:20710971-20710993 CCCTTGGCCTTTTGGGAAATTGG - Intergenic
1037875721 8:22546868-22546890 CCCTGGGCAAGTGGGGAATTGGG + Intronic
1037898024 8:22671152-22671174 CCCTAGGGAAATAGGAGAATGGG + Intergenic
1038220619 8:25603591-25603613 CCCCATGCAAACTGGGAAGTTGG + Intergenic
1042101014 8:65275058-65275080 CCCTTGGGAAAGTGGGAAAGTGG + Intergenic
1044014084 8:87029460-87029482 ACATAGACACATTGGGAAATGGG + Intronic
1044265722 8:90179010-90179032 GCCAAGGCAAGTTGTGAAATAGG + Intergenic
1045365759 8:101474404-101474426 CCCCAGGCAAAATGCAAAATGGG - Intergenic
1045866695 8:106874291-106874313 ACCTAGGGAACTTTGGAAATTGG - Intergenic
1048792365 8:138115547-138115569 CCTGAGGCAAATTGTGGAATTGG + Intergenic
1050075110 9:1855144-1855166 CCCAAAGAAAATTGGGAAAGTGG + Intergenic
1050697163 9:8292105-8292127 TGCTAGGTTAATTGGGAAATTGG + Intergenic
1055565035 9:77559750-77559772 CATTAGGTAAATTGGGAAAGGGG - Intronic
1057726226 9:97570483-97570505 CACTATGGAAATTGGCAAATTGG + Intronic
1186996391 X:15128095-15128117 CCATTGACAAATTGGGAAAATGG - Intergenic
1187419283 X:19121523-19121545 CCTTAGGAAAAGTGGGAGATTGG - Intronic
1188196232 X:27238973-27238995 AGATAGGCAAATTTGGAAATAGG - Intergenic
1189292805 X:39897750-39897772 GCCTAGGCAAGTTGGGAAGCTGG - Intergenic
1191953519 X:66619729-66619751 CTCTGGGCAAGTTGGGAAGTTGG - Intronic
1193507611 X:82363075-82363097 CCTATGGGAAATTGGGAAATGGG - Intergenic
1194496895 X:94627364-94627386 CCCCAGAGAAAGTGGGAAATAGG - Intergenic
1199069976 X:143464563-143464585 CCCTGGGAAAATTGGGGAGTAGG + Intergenic
1199557506 X:149125078-149125100 CCCTACCCACTTTGGGAAATAGG + Intergenic
1199973277 X:152876228-152876250 CCCTATACAAAATGGGGAATGGG - Intergenic
1200256856 X:154586930-154586952 CGGGAGGCAATTTGGGAAATGGG + Intergenic
1200260913 X:154617473-154617495 CGGGAGGCAATTTGGGAAATGGG - Intergenic
1200266955 X:154651841-154651863 CGGGAGGCAATTTGGGAAATGGG - Intergenic
1200709700 Y:6472479-6472501 CCCTAGGCAGATGGGGAACATGG + Intergenic
1200963973 Y:9019761-9019783 CCCCAGGCCAATGGGGAAAATGG + Intergenic
1201024412 Y:9692229-9692251 CCCTAGGCAGATGGGGAACATGG - Intergenic
1202148184 Y:21821631-21821653 CCCTAGGCTGACTGGGAAAATGG - Intergenic