ID: 1174855993

View in Genome Browser
Species Human (GRCh38)
Location 20:54046186-54046208
Sequence GTGGTTAAGTCAATCATTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 201}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174855993_1174856002 23 Left 1174855993 20:54046186-54046208 CCCAAAATGATTGACTTAACCAC 0: 1
1: 0
2: 0
3: 9
4: 201
Right 1174856002 20:54046232-54046254 TGCATTAAGAATTCAGGGCCGGG 0: 1
1: 1
2: 1
3: 35
4: 301
1174855993_1174856001 22 Left 1174855993 20:54046186-54046208 CCCAAAATGATTGACTTAACCAC 0: 1
1: 0
2: 0
3: 9
4: 201
Right 1174856001 20:54046231-54046253 ATGCATTAAGAATTCAGGGCCGG 0: 1
1: 0
2: 3
3: 21
4: 223
1174855993_1174856003 28 Left 1174855993 20:54046186-54046208 CCCAAAATGATTGACTTAACCAC 0: 1
1: 0
2: 0
3: 9
4: 201
Right 1174856003 20:54046237-54046259 TAAGAATTCAGGGCCGGGTGCGG 0: 1
1: 4
2: 37
3: 305
4: 1516
1174855993_1174855998 17 Left 1174855993 20:54046186-54046208 CCCAAAATGATTGACTTAACCAC 0: 1
1: 0
2: 0
3: 9
4: 201
Right 1174855998 20:54046226-54046248 ATTCCATGCATTAAGAATTCAGG 0: 1
1: 0
2: 4
3: 17
4: 218
1174855993_1174855999 18 Left 1174855993 20:54046186-54046208 CCCAAAATGATTGACTTAACCAC 0: 1
1: 0
2: 0
3: 9
4: 201
Right 1174855999 20:54046227-54046249 TTCCATGCATTAAGAATTCAGGG 0: 1
1: 0
2: 0
3: 17
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174855993 Original CRISPR GTGGTTAAGTCAATCATTTT GGG (reversed) Intronic
909342634 1:74548913-74548935 TTGTTTCTGTCAATCATTTTTGG - Intergenic
910077251 1:83296027-83296049 GTGCTTAAGGCAATCAATTTTGG - Intergenic
911254754 1:95621005-95621027 GTGTATAAGTAAATCATTTCAGG + Intergenic
912172485 1:107117425-107117447 GTTGATAATTCAACCATTTTTGG - Intergenic
915620024 1:157075988-157076010 GTGGTTAAGGCACTGATATTTGG - Intergenic
917613723 1:176715793-176715815 GGGTTTGAGTCAAGCATTTTAGG - Intronic
917721058 1:177787049-177787071 CAGGTTAACTCAATCACTTTTGG - Intergenic
918382283 1:183968201-183968223 GTGGTTAAGTGACACATTTCTGG + Intronic
919347048 1:196396031-196396053 GTGGTTAAGTCACTGAAGTTTGG - Intronic
919644334 1:200078807-200078829 GTGGTTAAGTAAATTTTTTGAGG - Intronic
919873432 1:201842370-201842392 GTGGTTCAATCAATCATGGTAGG - Intronic
923810808 1:237313316-237313338 GTGATTAAGTTAAGGATTTTGGG + Intronic
923843282 1:237697991-237698013 GTACTTAGGTCATTCATTTTAGG + Intronic
1063757198 10:9026345-9026367 CTGGTTAACTCAATCAGTTAAGG - Intergenic
1063803709 10:9612660-9612682 TTGGTTAGGTTAAACATTTTAGG - Intergenic
1064451130 10:15442898-15442920 GTGGTTAAGTCAGGGCTTTTAGG + Intergenic
1064592411 10:16907787-16907809 ATTGTTAGGTCATTCATTTTGGG - Intronic
1067009417 10:42695914-42695936 ATTGTTAGGTCATTCATTTTAGG - Intergenic
1067314301 10:45147337-45147359 ATTGTTAGGTCATTCATTTTAGG + Intergenic
1068291290 10:55004537-55004559 GTGGGTAAGACAATCATGATAGG - Intronic
1069606566 10:69742494-69742516 GAGGTTAAGTGACTCATCTTGGG + Intergenic
1070677928 10:78425937-78425959 GTCCTAAAGTCAATCATTTAAGG - Intergenic
1071687263 10:87772562-87772584 GTGGTTAAGTCAATATTTGGGGG + Intronic
1072168939 10:92841743-92841765 GTGGTTAAGTGAATGGGTTTTGG + Intronic
1072787170 10:98291874-98291896 GTTGTTAAGCAAAGCATTTTTGG + Intergenic
1074938951 10:118216072-118216094 TTATTTAAGTCTATCATTTTTGG - Intergenic
1076077225 10:127544004-127544026 GTTGTTAAGTCACTGAGTTTTGG - Intergenic
1078248187 11:9595498-9595520 GTGGTTCAGCCAAACACTTTAGG - Intergenic
1078997134 11:16713897-16713919 GTGGGGAAGTAAAACATTTTTGG - Intronic
1080435926 11:32244292-32244314 GAGCTTAAATCAAGCATTTTGGG - Intergenic
1081317562 11:41649462-41649484 GTGGGTAACTCAATCTTTGTGGG + Intergenic
1084093979 11:66898081-66898103 TTGGTTGAGTTAAACATTTTTGG - Intronic
1085794772 11:79528987-79529009 TTGCCTAAGTCAATGATTTTAGG - Intergenic
1085991684 11:81855058-81855080 ATGGTTAAGTCTCTCATATTGGG + Intergenic
1086557819 11:88132387-88132409 TTGGTTAAGTCACTATTTTTAGG + Intronic
1086871826 11:92046984-92047006 GTGGTGAAGTCTAGGATTTTAGG + Intergenic
1088398506 11:109396137-109396159 GTGAATCAGTAAATCATTTTGGG - Intergenic
1089062928 11:115641032-115641054 GTGGTTAAGAAAATCGATTTTGG - Intergenic
1092919444 12:13218020-13218042 GTGGTTAAGTAAATACTCTTAGG + Exonic
1093802144 12:23386975-23386997 GTTTTTAAGTCAATAAGTTTTGG + Intergenic
1095934416 12:47661258-47661280 GTGGTTAATAAAGTCATTTTTGG - Exonic
1096025253 12:48355218-48355240 GTGGTGAACACAATCATTTAAGG + Intergenic
1098106875 12:67077059-67077081 TTGATTGATTCAATCATTTTAGG + Intergenic
1099161790 12:79250587-79250609 ATGGTGAAGTCAGTGATTTTAGG + Intronic
1099966300 12:89449367-89449389 GTGTTTCAGTAAATCAATTTAGG - Intronic
1100956166 12:99911105-99911127 GTGGTGAAATAAATCATTCTCGG + Intronic
1101044415 12:100789977-100789999 GCGATTAAGTAAGTCATTTTGGG + Intronic
1101459015 12:104870089-104870111 ATGATTAAGTCAAGAATTTTGGG + Intronic
1101747487 12:107554420-107554442 GTGGTTAAGTAACTTATTTAAGG - Intronic
1103125808 12:118421437-118421459 ATGGTTAGGACAATCATTTGAGG + Intergenic
1103241347 12:119415995-119416017 GAGGTTAAGTCAATTATTCAAGG - Intronic
1106768196 13:32937118-32937140 GTGTTTAAGAAAATAATTTTGGG + Intergenic
1107929895 13:45298592-45298614 GTGATAAAGACAAGCATTTTTGG - Intergenic
1108261131 13:48657898-48657920 GTGGTCAAGTCAAGGCTTTTAGG + Intronic
1108517694 13:51218573-51218595 GTGGCTAAGTCACCCATTTATGG - Intergenic
1108691538 13:52863413-52863435 GTGGTCAAGTCAGTGCTTTTAGG + Intergenic
1108879017 13:55086542-55086564 TTGGTGAAGTCAATCAATTGTGG + Intergenic
1109116358 13:58391702-58391724 CTGCTTAGGTCCATCATTTTGGG + Intergenic
1111786342 13:92791784-92791806 GTGTATAATTCAATGATTTTTGG + Intronic
1113059258 13:106303582-106303604 GTGGTCAAGTCAGTGCTTTTAGG - Intergenic
1114355853 14:21907316-21907338 GTGATGAAGTCAATGACTTTTGG + Intergenic
1114934956 14:27523094-27523116 GTTGTTGAGTAAATCATATTAGG - Intergenic
1115799259 14:36973712-36973734 GTGGTTAAGTCAATCCAGTTAGG + Intronic
1118156950 14:63251706-63251728 GTTATTAAGTCAATGATGTTTGG - Intronic
1119914742 14:78387412-78387434 GAGGTTAAGTCACTTATTTAAGG - Intronic
1121133571 14:91472952-91472974 GGTGTTAAGTCAGTCTTTTTAGG - Intronic
1124791553 15:32731789-32731811 ATGGTTAAGTGAATTAATTTAGG - Exonic
1126998425 15:54473795-54473817 GTGGTGAAGTCAGTGCTTTTAGG + Intronic
1129374699 15:75121696-75121718 TTGCTTAAGTCATTCATTGTAGG + Intergenic
1131702293 15:94951054-94951076 GTGCTTTCTTCAATCATTTTAGG + Intergenic
1140224743 16:73068165-73068187 GAGGTTAAGTCACTCACTTAAGG + Intergenic
1141251132 16:82360049-82360071 GTGGGTAGGTCATTCCTTTTTGG + Intergenic
1143889661 17:10092946-10092968 GTGGTTAAGTTAAGGATTTGGGG - Intronic
1144252402 17:13430876-13430898 ATGGTTCAGGTAATCATTTTAGG + Intergenic
1144369649 17:14577744-14577766 ATGTTTAATTCAATAATTTTTGG - Intergenic
1144372778 17:14608019-14608041 TTGGTAAAGACAATCTTTTTTGG + Intergenic
1144503963 17:15814019-15814041 GTGGCTCAATCAACCATTTTGGG + Intergenic
1147547449 17:41413530-41413552 GTGGTGAATTCATTCATCTTAGG - Intergenic
1149018205 17:51933230-51933252 GTAATTAAGTTAATCGTTTTGGG + Intronic
1149702824 17:58669499-58669521 GAGGTTAAGTGGATCATTTGAGG + Intronic
1149840376 17:59959067-59959089 GAGGTTAAGGCAATAAATTTTGG - Intronic
1150752491 17:67878298-67878320 GTGGTTATTTTAATGATTTTTGG + Intronic
1152097513 17:78280489-78280511 GAGGCAAAGTCAATGATTTTTGG + Intergenic
1152449966 17:80372552-80372574 GTGGTTCAGTTCATCATTTCTGG - Exonic
1153691457 18:7598393-7598415 GAGGTTAAGACAAACATGTTTGG + Intronic
1155967346 18:32048552-32048574 GAGGTTAAGTCAATCATACAAGG + Intronic
1156107869 18:33687644-33687666 GCTGTTAAGGCAATCTTTTTGGG + Intronic
1158202562 18:54956856-54956878 GTGTATAATTCAATGATTTTTGG - Intronic
1158220389 18:55144581-55144603 GTGTTAAAGTCAATGTTTTTTGG + Intergenic
1159611395 18:70529867-70529889 GTTGTTAATTCAGTCAGTTTTGG + Intergenic
1159629668 18:70735145-70735167 GTGATTATGTTAATCATATTGGG + Intergenic
1161621092 19:5297578-5297600 GTGGTTTATTTAATTATTTTTGG - Intronic
1163481923 19:17561748-17561770 GTGGTGAAGTCAGAGATTTTGGG + Intronic
1163891447 19:20019840-20019862 GTGGTGAAGTCAGTGCTTTTAGG - Intronic
1166112806 19:40633261-40633283 GTGTATAATTCAATGATTTTTGG - Intergenic
1167986852 19:53325541-53325563 GTGATTAACTCAAACTTTTTTGG + Intergenic
1168180840 19:54662231-54662253 GTGATTAAGTCAAGGATCTTGGG + Intronic
925613132 2:5720124-5720146 TTGGTTAAGCCACTCCTTTTGGG + Intergenic
925782782 2:7398186-7398208 TTGGTTAATTCAATGTTTTTAGG + Intergenic
925961552 2:9021893-9021915 ATGGTTAAGTCAATATGTTTGGG - Intergenic
926325117 2:11778777-11778799 GTGGATAAGTTAATGACTTTTGG + Intronic
926406052 2:12554087-12554109 GTGGTCAAGTCAAGGCTTTTAGG - Intergenic
928014911 2:27647010-27647032 GAGTTTAAGTAAATCATTTGAGG + Intronic
928550211 2:32362998-32363020 GTAGATAAGACAAACATTTTTGG - Intronic
929575981 2:43052167-43052189 GTGCTTAAGTCACTAAGTTTTGG - Intergenic
929728138 2:44454727-44454749 GTGTAGAAGTCAAGCATTTTTGG + Intronic
931142865 2:59482873-59482895 GTGGTTGAGTAACTCACTTTTGG + Intergenic
933528936 2:83480977-83480999 CTGGTTAACTCAATCAAATTAGG + Intergenic
934064454 2:88327814-88327836 GAGCTTAAATCATTCATTTTAGG - Intergenic
934696846 2:96406154-96406176 CTGGTTCAGTCAATCAGATTGGG - Intergenic
935109697 2:100081183-100081205 GTGGTGAAGTCAGGGATTTTAGG - Intronic
936125277 2:109784026-109784048 GTGGTGAAGTCAGGGATTTTAGG + Intergenic
936219416 2:110587442-110587464 GTGGTGAAGTCAGGGATTTTAGG - Intergenic
940245689 2:151613124-151613146 CTGGTTAAATCAAGCACTTTTGG - Intronic
944129284 2:196329142-196329164 GTGGATAAGCCAATTATTTTTGG - Intronic
945417199 2:209588841-209588863 CTTGGAAAGTCAATCATTTTAGG - Intronic
1170028133 20:11913078-11913100 TAGGTTATGTTAATCATTTTTGG + Intronic
1172683590 20:36736587-36736609 ATGTTTAAGTCAATAGTTTTAGG - Intronic
1173702429 20:45084771-45084793 GTGGTTAAGTCCAGCAAGTTGGG - Intergenic
1174855993 20:54046186-54046208 GTGGTTAAGTCAATCATTTTGGG - Intronic
1176670321 21:9727999-9728021 TGGCTTAAGTCATTCATTTTGGG + Intergenic
949104056 3:182132-182154 GAGGTTAAGTCAATCGTCTAAGG - Intergenic
952592082 3:34968279-34968301 TTGGACAAGTCAATCATATTTGG + Intergenic
954813975 3:53265902-53265924 GTGTATAATTCAATGATTTTTGG + Intergenic
955799222 3:62668868-62668890 GTGGGTAGGTCATTCCTTTTTGG - Intronic
956426879 3:69145044-69145066 ATGGTTAAGTCACTGATGTTTGG - Intergenic
956670877 3:71688525-71688547 GTCGTTAAGTCAGGCACTTTAGG - Intronic
957399527 3:79690747-79690769 GTGAATAAGTGAATCATTGTAGG - Intronic
957534651 3:81486048-81486070 GTGGCTAACTCCCTCATTTTAGG + Intergenic
959263457 3:104109531-104109553 GTTTTTACATCAATCATTTTAGG + Intergenic
959493670 3:107022965-107022987 GTGTTAAAGTGAAACATTTTAGG - Intergenic
962013544 3:131417913-131417935 ATGGTTCATTCAATCATTTATGG - Intergenic
962757782 3:138479927-138479949 GTGGTTAAGTTTTTCATGTTTGG + Intronic
966949427 3:184803061-184803083 GTGGTTAAGAAAATGCTTTTAGG - Intergenic
969966951 4:11006483-11006505 GTGGTGAAGTCAAGGCTTTTAGG + Intergenic
970067983 4:12120888-12120910 GTGGTTAAGTCACTAAATTTTGG + Intergenic
972249601 4:37286178-37286200 TTGGGTAAGTTAATCATTTTCGG + Intronic
972330086 4:38056444-38056466 GTGATTAACTCAAACATTCTTGG + Intronic
976494539 4:85712308-85712330 GTTAATTAGTCAATCATTTTTGG - Intronic
978284127 4:107054745-107054767 CTGGCTAAGAGAATCATTTTAGG + Intronic
980017940 4:127675052-127675074 GTAGTTAAGTCTATCTCTTTAGG - Intronic
980740540 4:136945001-136945023 GTGGTCAAGTCAGTGCTTTTAGG + Intergenic
981689311 4:147489226-147489248 GTGGTGAAGTCAAGGCTTTTAGG + Intronic
981769393 4:148290051-148290073 GTGGTTAAATCAACAATTTCTGG + Intronic
982746679 4:159110940-159110962 GTGATTATGTCAGTCATTGTAGG + Intronic
984509911 4:180666950-180666972 GTGGTCATGTCATTCAATTTGGG - Intergenic
985404457 4:189623535-189623557 TGGCTTAAGTCATTCATTTTGGG - Intergenic
986660856 5:10058770-10058792 GAGCTTAAGTCCATGATTTTTGG - Intergenic
987411903 5:17623251-17623273 ATGGTTAACCCAATGATTTTTGG - Intergenic
987413750 5:17641209-17641231 CTGGTTAAGCCAATAACTTTTGG - Intergenic
988623930 5:32851032-32851054 GTGGTCAAGTCAGGGATTTTTGG + Intergenic
991095640 5:62737147-62737169 GTGGTTAAGTCAGCAGTTTTAGG + Intergenic
991448458 5:66726320-66726342 GTGGTTAAGTGAATCTACTTTGG - Intronic
993608902 5:90031029-90031051 GTGTATAAGTCAGTGATTTTTGG - Intergenic
993631953 5:90297179-90297201 CTCGTTAAATCAATCATCTTGGG - Intergenic
997627392 5:135340218-135340240 GGGGTTAAGTAAATCATCTGAGG - Intronic
998654625 5:144163167-144163189 TTGGATAAATCAATAATTTTTGG - Intronic
999704727 5:154261882-154261904 GAGGTTAATTCATTCATTCTGGG - Intronic
1005242523 6:23848044-23848066 GTGGTTAAATCAATGTGTTTTGG - Intergenic
1005368212 6:25101143-25101165 GTAGTTAAGGCAAGCATATTGGG - Intergenic
1005782446 6:29206731-29206753 GTGTACAAGTCAATGATTTTTGG + Intergenic
1008636128 6:53412689-53412711 GTGCTTAAGACAATCAATTCTGG - Intergenic
1008828451 6:55728526-55728548 GTGTTTGAGACATTCATTTTTGG - Intergenic
1011973512 6:93260709-93260731 TTGTTTAAGACAATCAATTTTGG - Intronic
1014039183 6:116804664-116804686 GTGTTTAAATAAAACATTTTAGG + Intronic
1018421157 6:163642054-163642076 GTGTTTAAGTCACTGAGTTTTGG + Intergenic
1020797182 7:12689655-12689677 ATGAATGAGTCAATCATTTTAGG - Exonic
1022014715 7:26339468-26339490 GTGGTGAAGTCAGGCATTTAGGG + Intronic
1023784924 7:43696533-43696555 GTAGTTTGGTCATTCATTTTAGG - Intronic
1027295023 7:76761241-76761263 GTGCTTAAGGCAATCAATTTTGG - Intergenic
1027705732 7:81531083-81531105 GTAGTCAAGTCAAGGATTTTAGG - Intergenic
1028298772 7:89170301-89170323 TTGGTTAGGTAAATCAATTTGGG - Intronic
1028759994 7:94485403-94485425 GTGGTGAAGTCAGTGCTTTTGGG + Intergenic
1029455007 7:100665306-100665328 GAGGTTAAGTCACTGAATTTTGG + Intergenic
1030279204 7:107752877-107752899 GTGTCTAAATCACTCATTTTAGG + Intronic
1034764070 7:153701167-153701189 GTGATTATGCCACTCATTTTGGG - Intergenic
1034856362 7:154552016-154552038 GTGCCCAAGTAAATCATTTTAGG + Intronic
1037771610 8:21804122-21804144 GTGGTAAAGCGAATGATTTTTGG - Intronic
1038284081 8:26191249-26191271 GTGGTCAAGTCAAGGCTTTTAGG - Intergenic
1039758226 8:40545780-40545802 TTGTTTACGTCACTCATTTTTGG + Intronic
1041483442 8:58348491-58348513 GTGTTTCTGTCAAACATTTTAGG - Intergenic
1041600486 8:59711722-59711744 CTGGTTGAGTGAATCATTTCAGG + Intergenic
1041799269 8:61781086-61781108 GTGATTAAGTTAAAGATTTTGGG + Intergenic
1042015583 8:64306172-64306194 GTGGATAAGTAAATTATTCTTGG + Intergenic
1043060345 8:75492531-75492553 GTGGTGAAGGCCATCATTATTGG - Intronic
1047827041 8:128588046-128588068 GTGGTGAAGTCGAGGATTTTAGG + Intergenic
1050354617 9:4770976-4770998 GTAGTTAAATCAATAGTTTTTGG + Intergenic
1051099909 9:13509064-13509086 GTGGCCAAGTTAATCATTTAAGG - Intergenic
1053392803 9:37747833-37747855 GTGGTTTAGTCACTCACCTTAGG + Intronic
1055186416 9:73460956-73460978 CTGGTTATGTCAAACATTATAGG + Intergenic
1056293633 9:85169567-85169589 GTGGTAAAGGCAATGATTTCAGG - Intergenic
1056294789 9:85181814-85181836 TTGTTTAAGTCACTCAGTTTTGG + Intergenic
1056794617 9:89649060-89649082 GTGCTTGAGTCAGTCATTTAGGG + Intergenic
1057014671 9:91641426-91641448 GTGGCTCTGTCAATCATTTTGGG + Intronic
1059691510 9:116689258-116689280 GTGGTTAAGTAACTCATTCAAGG - Intronic
1059974021 9:119696819-119696841 GTGGTGAAGTCAAGGCTTTTAGG - Intergenic
1186895102 X:13997522-13997544 ATGGTTAAGTCACTAAGTTTGGG + Intergenic
1186947110 X:14580916-14580938 GTGTTTAAATTATTCATTTTGGG - Intronic
1187755257 X:22518256-22518278 GTGGTTAATTCAACCATTCCTGG - Intergenic
1187932325 X:24304781-24304803 GTGGTTAAGACAATGAATTTTGG + Intergenic
1188407320 X:29827712-29827734 GTGGTTAAGTAATTTGTTTTAGG - Intronic
1189094105 X:38119796-38119818 GTGGTTCACTCAAACATTGTTGG - Intronic
1189129800 X:38485814-38485836 GTGGTTAAGTCTGGGATTTTAGG + Intronic
1190119469 X:47648827-47648849 GTGGTTAAATCACTCATCTAAGG + Intronic
1190299534 X:49048701-49048723 GTGATTAAGTTAAGGATTTTGGG + Intergenic
1194992576 X:100560748-100560770 GTGGTAAAGTCAAGCAATTTGGG - Intergenic
1195010273 X:100726840-100726862 GTGGTTAAGTCAGAGACTTTAGG + Intronic
1195592028 X:106640843-106640865 GTGTTTAAGTCACTCAGTTGTGG - Intronic
1199733840 X:150665517-150665539 GTGGTTAAGTACATTCTTTTAGG - Intronic
1201254672 Y:12095496-12095518 GTGGTGAAGTCAAGGCTTTTAGG + Intergenic
1201312714 Y:12611496-12611518 GTGTTTGAGTAAATCAGTTTTGG - Intergenic