ID: 1174859283

View in Genome Browser
Species Human (GRCh38)
Location 20:54075243-54075265
Sequence CTGTCTCAGCTGGAGCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174859283_1174859289 25 Left 1174859283 20:54075243-54075265 CCACCCTGCTCCAGCTGAGACAG No data
Right 1174859289 20:54075291-54075313 TCTGTATGCCACCCATCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174859283 Original CRISPR CTGTCTCAGCTGGAGCAGGG TGG (reversed) Intergenic
No off target data available for this crispr