ID: 1174860464

View in Genome Browser
Species Human (GRCh38)
Location 20:54086473-54086495
Sequence GTGCATGCCAAGAGTGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174860464_1174860474 18 Left 1174860464 20:54086473-54086495 CCTGCCCCACTCTTGGCATGCAC No data
Right 1174860474 20:54086514-54086536 ACAGGCCTGGGTTTGAATCCTGG No data
1174860464_1174860470 5 Left 1174860464 20:54086473-54086495 CCTGCCCCACTCTTGGCATGCAC No data
Right 1174860470 20:54086501-54086523 GCCCTGGAATCAGACAGGCCTGG No data
1174860464_1174860472 6 Left 1174860464 20:54086473-54086495 CCTGCCCCACTCTTGGCATGCAC No data
Right 1174860472 20:54086502-54086524 CCCTGGAATCAGACAGGCCTGGG 0: 2
1: 2
2: 18
3: 172
4: 663
1174860464_1174860469 0 Left 1174860464 20:54086473-54086495 CCTGCCCCACTCTTGGCATGCAC No data
Right 1174860469 20:54086496-54086518 ACGCAGCCCTGGAATCAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174860464 Original CRISPR GTGCATGCCAAGAGTGGGGC AGG (reversed) Intergenic
No off target data available for this crispr