ID: 1174871098

View in Genome Browser
Species Human (GRCh38)
Location 20:54183128-54183150
Sequence AGTGTTGGGGAGGATGTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174871098_1174871105 13 Left 1174871098 20:54183128-54183150 CCCTCTACATCCTCCCCAACACT No data
Right 1174871105 20:54183164-54183186 TAAATTTTAGCCATTCTATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174871098 Original CRISPR AGTGTTGGGGAGGATGTAGA GGG (reversed) Intergenic
No off target data available for this crispr