ID: 1174871105

View in Genome Browser
Species Human (GRCh38)
Location 20:54183164-54183186
Sequence TAAATTTTAGCCATTCTATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174871100_1174871105 3 Left 1174871100 20:54183138-54183160 CCTCCCCAACACTCCTTGTGATC No data
Right 1174871105 20:54183164-54183186 TAAATTTTAGCCATTCTATTAGG No data
1174871101_1174871105 0 Left 1174871101 20:54183141-54183163 CCCCAACACTCCTTGTGATCTTC No data
Right 1174871105 20:54183164-54183186 TAAATTTTAGCCATTCTATTAGG No data
1174871102_1174871105 -1 Left 1174871102 20:54183142-54183164 CCCAACACTCCTTGTGATCTTCT No data
Right 1174871105 20:54183164-54183186 TAAATTTTAGCCATTCTATTAGG No data
1174871098_1174871105 13 Left 1174871098 20:54183128-54183150 CCCTCTACATCCTCCCCAACACT No data
Right 1174871105 20:54183164-54183186 TAAATTTTAGCCATTCTATTAGG No data
1174871099_1174871105 12 Left 1174871099 20:54183129-54183151 CCTCTACATCCTCCCCAACACTC No data
Right 1174871105 20:54183164-54183186 TAAATTTTAGCCATTCTATTAGG No data
1174871103_1174871105 -2 Left 1174871103 20:54183143-54183165 CCAACACTCCTTGTGATCTTCTA No data
Right 1174871105 20:54183164-54183186 TAAATTTTAGCCATTCTATTAGG No data
1174871104_1174871105 -10 Left 1174871104 20:54183151-54183173 CCTTGTGATCTTCTAAATTTTAG No data
Right 1174871105 20:54183164-54183186 TAAATTTTAGCCATTCTATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174871105 Original CRISPR TAAATTTTAGCCATTCTATT AGG Intergenic
No off target data available for this crispr