ID: 1174874579

View in Genome Browser
Species Human (GRCh38)
Location 20:54212858-54212880
Sequence ATTTTGATGAATATGGAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1063
Summary {0: 1, 1: 0, 2: 0, 3: 38, 4: 1024}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174874579_1174874582 25 Left 1174874579 20:54212858-54212880 CCAACTTCCATATTCATCAAAAT 0: 1
1: 0
2: 0
3: 38
4: 1024
Right 1174874582 20:54212906-54212928 CTAGACATAGTGTGATGTAAAGG 0: 1
1: 0
2: 0
3: 12
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174874579 Original CRISPR ATTTTGATGAATATGGAAGT TGG (reversed) Intronic
905637867 1:39567332-39567354 ATTTTGAAGATTTTGGAGGTGGG - Intronic
907217319 1:52875558-52875580 ATGTTGATGCAAATGCAAGTAGG + Intronic
907217334 1:52875791-52875813 ATGTTGATGCAAATGCAAGTAGG + Intronic
907932230 1:59011263-59011285 ATTTTTATGGAAGTGGAAGTGGG - Intergenic
909155496 1:72069484-72069506 ATTTTGATTAAGATGGTAGGTGG + Intronic
909277873 1:73711029-73711051 GTTTTGAAAAATTTGGAAGTTGG - Intergenic
909349430 1:74632989-74633011 ATTTTAAGGAATATTTAAGTAGG + Intronic
911807143 1:102224224-102224246 CATTTGATGAATATGCAGGTAGG + Intergenic
913497202 1:119439257-119439279 TTTTTGATGACTTTGGATGTGGG - Intergenic
913500380 1:119467478-119467500 TTTTTGATGACTTTGGATGTGGG - Intergenic
913533086 1:119747020-119747042 AAGTTGGTGAATAAGGAAGTTGG + Intergenic
916091137 1:161308779-161308801 ATCTTGATGTATAAGGAAGAGGG - Intronic
916217335 1:162408743-162408765 CTTTAGATGAATATGCAAGATGG + Intronic
916229266 1:162523582-162523604 ACTATGATGAAAATTGAAGTGGG + Exonic
916676794 1:167070778-167070800 AATTTGAGGAGTATGAAAGTGGG + Intronic
917831268 1:178889979-178890001 AATTTTTTGAATATGTAAGTAGG - Intronic
919245843 1:194982639-194982661 ATGTTGATGAATCTGTGAGTGGG + Intergenic
919797168 1:201327850-201327872 ATTTTGCTGAATAGGGAATCAGG + Intronic
921656255 1:217741861-217741883 ATTTGGATGGATATGGATGATGG + Intronic
922128514 1:222753864-222753886 ATTGTGATGATTTTGGAGGTGGG + Intergenic
922794652 1:228334080-228334102 TTTTTGAACAATAAGGAAGTAGG - Intronic
923820345 1:237432542-237432564 ATTTCGAAGAATTTGGAAGTGGG - Intronic
924086514 1:240457337-240457359 AGTTTGAAGAATGTGGAAGGTGG - Intronic
1064113462 10:12558009-12558031 ATTCTGATAAACATGGAGGTAGG + Intronic
1064822707 10:19356346-19356368 CTTTTGATGTTTATGGAAGTTGG + Intronic
1064956069 10:20911516-20911538 ATTTTGATGTGTATGGTAGTAGG - Intronic
1065072919 10:22046170-22046192 ATAGTGATGCACATGGAAGTAGG + Intergenic
1065182071 10:23136294-23136316 ATTTTGCTGAAGATGGATGTGGG + Intergenic
1066613094 10:37270156-37270178 GTTTTCTTGAATATTGAAGTTGG + Intronic
1066821351 10:39494597-39494619 ATTTTGTAGAATCTGGAAGTGGG + Intergenic
1068365264 10:56040647-56040669 ATTATGATGAACATGAAAATTGG + Intergenic
1068515335 10:58018699-58018721 AATTTGTTGCATATGTAAGTTGG + Intergenic
1068525858 10:58128715-58128737 ATGTTGATAACTATGGAAGCTGG - Intergenic
1068531294 10:58189628-58189650 ATTTGGATGGATCTGCAAGTTGG - Intergenic
1070981818 10:80654675-80654697 ATTTTGATGAAAATAAAATTTGG + Intergenic
1071124924 10:82322358-82322380 ATGGTGAAGAATATGTAAGTAGG + Intronic
1071167088 10:82819400-82819422 CTTTTGATGAATAAGTAAATGGG - Intronic
1071719428 10:88128446-88128468 ATTTTGTTGAAAATGGATGCTGG + Intergenic
1073526293 10:104185263-104185285 ATTTTAATTGGTATGGAAGTAGG + Intronic
1073910415 10:108336374-108336396 ATTTTGTTGAATTCAGAAGTTGG + Intergenic
1074249399 10:111729518-111729540 CATTTGATGAAGATGGAAGTAGG + Intergenic
1074376894 10:112948518-112948540 ATTCTGATTAATATCAAAGTTGG + Intergenic
1074798415 10:116973119-116973141 ATTTTGATGTTGATGGTAGTTGG - Intronic
1074900639 10:117813549-117813571 ACATTGATGGAGATGGAAGTTGG + Intergenic
1078041498 11:7867856-7867878 ATTTTTATAAATATGGCATTTGG + Intergenic
1078360999 11:10667515-10667537 ATTTTTATGAGTAGGGAATTGGG - Intronic
1079302391 11:19289747-19289769 GTTTTTATGAATGTGCAAGTGGG - Intergenic
1080595404 11:33769689-33769711 TTTGTGATGAATATAGAAGGAGG + Intronic
1081074681 11:38655994-38656016 ATTTTGAAAAATATTTAAGTGGG - Intergenic
1081220181 11:40450549-40450571 TTTCTGATGCATATGTAAGTAGG + Intronic
1081295610 11:41383936-41383958 GTTTCGATGAAAATAGAAGTAGG + Intronic
1081296243 11:41393186-41393208 ATTTTGATGTATAAGAAATTTGG - Intronic
1081318001 11:41654868-41654890 TTTTTGCTGAATGTGGAATTTGG + Intergenic
1081499407 11:43651461-43651483 ATTTTGTTGGATATGTAAATTGG + Intronic
1081693050 11:45091239-45091261 ATTTTAATGAAAAAGGAAATAGG - Intergenic
1082275920 11:50221434-50221456 ATATTGATGAAAATGGAAAATGG - Intergenic
1083642013 11:64150700-64150722 ATTGTGATGAGTATGGGAGCCGG - Intronic
1085682593 11:78592052-78592074 ATGTTGAAAAATATTGAAGTTGG + Intergenic
1085798071 11:79562026-79562048 GGGTTGGTGAATATGGAAGTAGG + Intergenic
1086080096 11:82895215-82895237 ATTTTGCTGATTATGAAAATAGG + Intronic
1086421166 11:86638883-86638905 ATTTTGATGAGGAGGCAAGTCGG - Intronic
1086905945 11:92418077-92418099 ATTTTGATCAAGAGGCAAGTGGG - Intronic
1087828797 11:102796680-102796702 ATTTTGATGAAGATGAAAGGTGG - Exonic
1088081923 11:105927829-105927851 ATTTTTATGAATATCGAACTAGG + Intronic
1088146463 11:106686319-106686341 ACTTTCATGAATACTGAAGTAGG - Intronic
1090300415 11:125632288-125632310 ATTTCTATGGATATAGAAGTGGG + Intronic
1090830791 11:130419584-130419606 ATTTTAATGAATTTGGATTTAGG - Intronic
1090877924 11:130807437-130807459 ATTTTGAAGCATATGTAATTTGG - Intergenic
1091517713 12:1201372-1201394 GTTTTGTTGAATGTGGGAGTAGG + Intronic
1092077000 12:5682183-5682205 TTTTTGATAAATATAGGAGTTGG - Intronic
1092681325 12:10984494-10984516 ATTTTGATGAACAAGTAAATTGG - Intronic
1093027067 12:14254754-14254776 GTTTTGATAAAGATGGAAGGGGG + Intergenic
1093220968 12:16420239-16420261 ATTTTGCTTCAGATGGAAGTGGG - Intronic
1093240094 12:16659446-16659468 ATATTGAAGAAAATGAAAGTTGG + Intergenic
1093443386 12:19226976-19226998 ATTTTACTGTATAAGGAAGTCGG + Intronic
1093864719 12:24211318-24211340 ATTTTGATGTGTATGTCAGTGGG - Intergenic
1094878509 12:34682412-34682434 TTTTTGTAGAATATGCAAGTGGG + Intergenic
1096949634 12:55453286-55453308 ATTTTGATAAAGATGGGATTAGG - Intergenic
1098697906 12:73582930-73582952 ATTTAGATGCATATAAAAGTAGG + Intergenic
1099032017 12:77538252-77538274 ATTTTGGTGCATATGGTTGTTGG + Intergenic
1101058717 12:100948243-100948265 ATTGGGATGAATAATGAAGTTGG + Intronic
1101091638 12:101292826-101292848 ATTTTAGTGAATTTGGAAGTAGG + Intronic
1103164505 12:118758465-118758487 ATTTTGATGCATCTGTAAATGGG + Intergenic
1104654752 12:130565848-130565870 ATTTTGCTGGAGATGGAAGAGGG + Intronic
1105108936 13:16582450-16582472 TTTTTGTTGAATCTGCAAGTGGG + Intergenic
1105113735 13:16661410-16661432 TTTTTGTTGAATCTGCAAGTGGG + Intergenic
1106090787 13:26591431-26591453 ATTTTGATGTATTTAGAAGGTGG + Intronic
1106577684 13:30991092-30991114 ATATTTATGAAAATGGAACTCGG - Intergenic
1106929035 13:34643791-34643813 ACTTTCATGAAGATGGAAGTTGG + Intergenic
1106929137 13:34645012-34645034 ATTTTTAAAAATATGGAATTAGG + Intergenic
1107662003 13:42648414-42648436 ATGTTGATGAATATAGGTGTGGG + Intergenic
1107962910 13:45574833-45574855 ATTTAGATGAAAACGTAAGTTGG - Exonic
1108073548 13:46654632-46654654 ATTTTGATGTATGGGGAAGTCGG + Intronic
1108133112 13:47324951-47324973 ATCTTCATGAATAGGGCAGTAGG + Intergenic
1108782102 13:53848928-53848950 ATGTTGATGAAAAGGGAAGATGG + Intergenic
1108887318 13:55202145-55202167 ATTCTGAGGAATTTGCAAGTAGG + Intergenic
1110024446 13:70517417-70517439 AATTTGATGAGTTTGGAAATAGG - Intergenic
1110330252 13:74263951-74263973 ATCTTGACTAATATGAAAGTTGG + Intergenic
1112064673 13:95780591-95780613 GTTTTGCTGAAAATGGAATTTGG + Intronic
1113314483 13:109163779-109163801 ATTTTGCTGAAGAAGGAATTAGG - Intronic
1114160227 14:20157468-20157490 ATTTCCATGAATATGAATGTAGG + Intergenic
1114234139 14:20810111-20810133 CTTTAGAAGAATAAGGAAGTGGG + Intergenic
1114577019 14:23724816-23724838 ATTTTGATGTATAGTGAAGATGG + Intergenic
1116340638 14:43718937-43718959 ATTTTGAGGAATATTGAGGAAGG - Intergenic
1118838298 14:69492258-69492280 ATTTGGAAGGAAATGGAAGTGGG - Intronic
1119013124 14:71017912-71017934 ATTGTGATAAATATGGAATTGGG + Intronic
1119217040 14:72876940-72876962 AATCTCATGAATATGGGAGTGGG - Intronic
1119264386 14:73255371-73255393 ATAAAGAGGAATATGGAAGTTGG - Intronic
1120327027 14:83043081-83043103 ATTGTGATGAATTAGGAAATGGG - Intergenic
1120542589 14:85768579-85768601 ACTTTGGTAAATATAGAAGTAGG + Intergenic
1123225946 15:17029614-17029636 TTTTTGTAGAATCTGGAAGTGGG + Intergenic
1124210437 15:27759187-27759209 TTTTTGATGGATATAGAAATTGG - Intronic
1125171182 15:36768343-36768365 AGTTTGATGAATAAGAGAGTTGG + Intronic
1125221574 15:37342900-37342922 ATTTTGATGAGTTTGGACATAGG - Intergenic
1125458209 15:39882639-39882661 GTTTTGGTGAATAAAGAAGTGGG - Intronic
1125765069 15:42129926-42129948 AATTTGATGAGTTTGGACGTAGG - Intergenic
1126847275 15:52772470-52772492 ATTATGATGAAAGAGGAAGTTGG + Intronic
1128902765 15:71440097-71440119 ATTTGGGTGAATGTGGAGGTGGG - Intronic
1129502140 15:76049500-76049522 TTGTTGATGAATAGGGAAGAAGG - Intronic
1130240599 15:82184768-82184790 ATTGTGAGGAATTTGGGAGTTGG - Intronic
1130889573 15:88121937-88121959 ATTTTGATCAACATGGCAGTTGG + Intronic
1131636274 15:94236131-94236153 ATGTTGGTGATTATGGAAGGTGG + Intronic
1133413836 16:5590513-5590535 ATTATGATGAGCTTGGAAGTTGG + Intergenic
1133958276 16:10466850-10466872 AATTTTAAAAATATGGAAGTAGG - Intronic
1134502930 16:14783220-14783242 AATTTGATGTATAAGGAAGAAGG + Intronic
1134577634 16:15345676-15345698 AATTTGATGTATAAGGAAGAAGG - Intergenic
1135236431 16:20760617-20760639 ACTTTGATGAATGTGGAGTTGGG + Intronic
1136918424 16:34237992-34238014 TTTTTGAAGAATCTGTAAGTGGG + Intergenic
1137077186 16:35983765-35983787 TTTTTGAAGAATCTGCAAGTGGG + Intergenic
1137080951 16:36053047-36053069 TTTTTGTTGAATCTGCAAGTGGG + Intergenic
1137098022 16:36335249-36335271 TTTTTGTAGAATCTGGAAGTGGG - Intergenic
1137321581 16:47388856-47388878 ACTTTGAGGAATATGGAGTTGGG - Intronic
1137524664 16:49224297-49224319 ATTTGGATGAAAATGGACTTGGG + Intergenic
1138080066 16:54082100-54082122 ATCTTCATGAATATTTAAGTAGG - Intronic
1139191338 16:64866986-64867008 ATAATGATGAATATGGCTGTAGG - Intergenic
1139237361 16:65354174-65354196 ATTTTTATCAATGTGGAAGATGG - Intergenic
1139324403 16:66140863-66140885 ATTTTGATTAAAATGTAATTTGG + Intergenic
1139416717 16:66817826-66817848 ATGTTAATTAATATGGAAGTGGG + Intronic
1139676070 16:68524437-68524459 ATTTTCATGTATATCGAAATGGG - Intergenic
1140634040 16:76889614-76889636 ATATTGATAAATATTGAAGAAGG + Intergenic
1141541274 16:84723991-84724013 ATTGTAATGAATATGAAAGTTGG + Intronic
1145685093 17:26647571-26647593 ATTTTGTAGAATTTGAAAGTGGG + Intergenic
1147052890 17:37810078-37810100 ATTTTCATGACTATGCATGTGGG - Intergenic
1149943061 17:60891832-60891854 ATGATGATGAAAATGGAAATAGG - Intronic
1150518064 17:65835609-65835631 TTTTTGAAGAATAGTGAAGTTGG - Intronic
1150839555 17:68595247-68595269 ATTTTGATCTATTTGGAAGCAGG + Intronic
1153083875 18:1260740-1260762 ATTTTGTTGAAGATGGTTGTAGG - Intergenic
1155109001 18:22695510-22695532 ATTTTGAAGAATAAGAAACTTGG + Intergenic
1155164369 18:23220647-23220669 ATTTTGGTGAAGATGGAGCTCGG + Intronic
1155378666 18:25191556-25191578 ATTTCGATCACTATGGAGGTTGG - Intronic
1156771040 18:40725905-40725927 ATTTTGATAAATATGTCATTAGG + Intergenic
1156907408 18:42370472-42370494 TTTTTGATTAATATGTTAGTAGG + Intergenic
1156956038 18:42964616-42964638 ATTTTTATGTATGTGGGAGTAGG - Intronic
1158243537 18:55404893-55404915 ATTTTAATGAATCTTAAAGTTGG + Intronic
1159262043 18:66026730-66026752 TTTTTTATGAATATGTATGTGGG - Intergenic
1159598491 18:70406110-70406132 ATTTAGAGCAATATGGAAGATGG + Intergenic
1160319969 18:77881206-77881228 ATTTTTATAAAGATGAAAGTAGG + Intergenic
1160365195 18:78318806-78318828 ATTTTGATGATGAAGGAATTTGG + Intergenic
1163922471 19:20304300-20304322 ATTTTTATGTATAGAGAAGTTGG - Intergenic
1165748108 19:38242729-38242751 ATTTTGATGAAGATTGCTGTGGG + Intergenic
925225231 2:2178430-2178452 ATTTTGCTTAACATGGAAGAAGG - Intronic
926313397 2:11691725-11691747 TATTTGATCAATATTGAAGTGGG - Intronic
926587737 2:14707061-14707083 AATTAGAAGAATATGGAATTAGG - Intergenic
926897087 2:17704413-17704435 ATTTTTATGAATTTGGAATCTGG - Intronic
929202375 2:39250252-39250274 ATGTTGATGAAAATGCAATTGGG - Exonic
930044182 2:47154758-47154780 ATTTTTATAAATATTAAAGTAGG + Intronic
930487825 2:52030337-52030359 ATTTTGTTGAATATGGAATATGG + Intergenic
931538067 2:63300329-63300351 ATTTTGATGAATGTTGTACTTGG - Intronic
931965271 2:67526476-67526498 ATTTCTATGAAAATGCAAGTTGG - Intergenic
932150465 2:69366565-69366587 AGTTTAATGAATAAGGAACTTGG - Intronic
933442982 2:82337897-82337919 CTTTTGTTAAATATGGTAGTTGG + Intergenic
936904258 2:117518528-117518550 ACTCTGATGCATATTGAAGTTGG - Intergenic
936961130 2:118075892-118075914 ATTTTAATGGGTTTGGAAGTAGG + Intergenic
937816983 2:126261659-126261681 ATTTTTATGAAAATGGAGTTTGG + Intergenic
938191687 2:129288197-129288219 ATATTGATGTATATTGATGTTGG - Intergenic
940963378 2:159810640-159810662 ATCTTGATGAATATGTAAGACGG + Exonic
941029731 2:160496994-160497016 ATGTTGATGAATGTTGAAGCTGG - Intergenic
941071398 2:160958807-160958829 ATATTGCTGAATAAGGGAGTGGG - Intergenic
941170776 2:162132967-162132989 ATGTTGATAATTATTGAAGTTGG - Intergenic
941218896 2:162749290-162749312 ATGTTAAGGAATATGGAAATGGG + Intronic
941576677 2:167241304-167241326 ATTTTGTTGCTTAAGGAAGTAGG + Intronic
941839123 2:170060327-170060349 TTTCTGATAAAAATGGAAGTAGG + Intronic
943162065 2:184267508-184267530 ATTTGCATGCATATGAAAGTTGG - Intergenic
943841775 2:192592363-192592385 ATTTTGCTGAATATAGATCTTGG + Intergenic
945388798 2:209238219-209238241 TTTTTGATGAATATAGGAGGAGG - Intergenic
945684050 2:212947602-212947624 ATTTTCATGAATATTGCACTTGG + Intergenic
946828478 2:223703639-223703661 ATTTTTATAAATATTGAAATGGG - Intergenic
946983019 2:225239240-225239262 CTCATGATGAATAAGGAAGTAGG + Intergenic
1168951779 20:1807136-1807158 ATTTTGTTGACTAAGGAAGAAGG + Intergenic
1168987231 20:2059951-2059973 ATTTTCATGGATAAGGAAATAGG + Intergenic
1169283958 20:4291618-4291640 ATTTTAACTAATAAGGAAGTGGG - Intergenic
1169839987 20:9925152-9925174 GTTTTGTAGAGTATGGAAGTAGG - Intergenic
1170533918 20:17321707-17321729 ATTCTGCTGAAGATGGCAGTTGG - Intronic
1171591542 20:26609592-26609614 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171591697 20:26611969-26611991 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171592079 20:26617747-26617769 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171592257 20:26620468-26620490 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171592442 20:26623184-26623206 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171592627 20:26625903-26625925 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171592809 20:26628622-26628644 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171593104 20:26633043-26633065 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171593463 20:26638889-26638911 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171593644 20:26641609-26641631 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171593754 20:26643311-26643333 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171593942 20:26646202-26646224 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171594189 20:26649729-26649751 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171594372 20:26652449-26652471 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171594554 20:26655169-26655191 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171594734 20:26657889-26657911 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171594914 20:26660608-26660630 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171595098 20:26663328-26663350 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171595280 20:26666050-26666072 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171595392 20:26667750-26667772 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171595576 20:26670470-26670492 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171595758 20:26673188-26673210 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171595941 20:26675907-26675929 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171596122 20:26678629-26678651 TTTTTGTGGAATATGAAAGTGGG + Intergenic
1171596291 20:26681178-26681200 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171596585 20:26685598-26685620 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171596838 20:26689334-26689356 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171597021 20:26692054-26692076 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171597200 20:26694774-26694796 TTTTTGTGGAATATGAAAGTGGG + Intergenic
1171597542 20:26699873-26699895 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171597720 20:26702591-26702613 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171597899 20:26705311-26705333 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171598081 20:26708030-26708052 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171598263 20:26710749-26710771 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171598410 20:26712957-26712979 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171598591 20:26715676-26715698 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171598773 20:26718396-26718418 TTTTTGTGGAATATGAAAGTGGG + Intergenic
1171598955 20:26721116-26721138 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171599317 20:26726555-26726577 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171599495 20:26729275-26729297 TTTTTGTGGAATATGAAAGTGGG + Intergenic
1171599665 20:26731824-26731846 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171599844 20:26734536-26734558 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171600028 20:26737255-26737277 TTTTTGTGGAATATGAAAGTGGG + Intergenic
1171600231 20:26740318-26740340 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171600414 20:26743039-26743061 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171600592 20:26745758-26745780 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171600780 20:26748472-26748494 TTTTTGGGGAATATGCAAGTGGG + Intergenic
1171600983 20:26751533-26751555 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171601166 20:26754254-26754276 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171601347 20:26756973-26756995 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171601415 20:26757991-26758013 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171601576 20:26760368-26760390 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171601764 20:26763087-26763109 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171602126 20:26768522-26768544 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171602308 20:26771243-26771265 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171602490 20:26773963-26773985 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171602669 20:26776682-26776704 TTTTTGTGGAATATGAAAGTGGG + Intergenic
1171602867 20:26779743-26779765 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171603048 20:26782462-26782484 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171603157 20:26784163-26784185 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171603318 20:26786540-26786562 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171603498 20:26789258-26789280 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171603681 20:26791977-26791999 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171603860 20:26794697-26794719 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171603974 20:26796398-26796420 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171604134 20:26798776-26798798 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171604317 20:26801495-26801517 TTTTTGTGGAATATGAAAGTGGG + Intergenic
1171604430 20:26803196-26803218 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171604589 20:26805573-26805595 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171604770 20:26808292-26808314 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171604950 20:26811010-26811032 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171605131 20:26813729-26813751 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171605331 20:26816792-26816814 CTTTTGTGGAATATGCAAGTGGG + Intergenic
1171605514 20:26819512-26819534 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171605625 20:26821213-26821235 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171605784 20:26823591-26823613 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171605965 20:26826314-26826336 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171606109 20:26828353-26828375 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171606401 20:26832771-26832793 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171606513 20:26834472-26834494 CTTTTGTGGAATATGCAAGTGGG + Intergenic
1171606692 20:26837192-26837214 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171606873 20:26839912-26839934 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171606961 20:26841272-26841294 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171607144 20:26843991-26844013 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171607346 20:26847052-26847074 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171607526 20:26849770-26849792 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171607709 20:26852490-26852512 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171607910 20:26855553-26855575 TTTTTGTGGAATATGAAAGTGGG + Intergenic
1171608092 20:26858272-26858294 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171608276 20:26860990-26861012 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171608477 20:26864052-26864074 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171608950 20:26871190-26871212 CTTTTGTGGAATATGCAAGTGGG + Intergenic
1171609110 20:26873567-26873589 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171609294 20:26876287-26876309 TTTTTGTGGAATATGTAAGTGGG + Intergenic
1171609473 20:26879006-26879028 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171609582 20:26880707-26880729 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171609770 20:26883426-26883448 CTTTTGTGGAATATGCAAGTGGG + Intergenic
1171609951 20:26886145-26886167 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171610137 20:26888865-26888887 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171610339 20:26891924-26891946 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171610521 20:26894643-26894665 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171610702 20:26897363-26897385 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171610930 20:26900759-26900781 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171611116 20:26903478-26903500 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171611297 20:26906198-26906220 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171611476 20:26908920-26908942 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171611658 20:26911640-26911662 TTTTTGTGGAATATGAAAGTGGG + Intergenic
1171612021 20:26917076-26917098 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171612198 20:26919795-26919817 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171612381 20:26922513-26922535 CTTTTGTGGAATATGCAAGTGGG + Intergenic
1171612490 20:26924214-26924236 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171612672 20:26926938-26926960 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171612851 20:26929658-26929680 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171613031 20:26932377-26932399 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171613215 20:26935099-26935121 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171613399 20:26937816-26937838 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171613582 20:26940536-26940558 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171613762 20:26943255-26943277 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171613944 20:26945975-26945997 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171614124 20:26948696-26948718 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171614308 20:26951415-26951437 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171614490 20:26954134-26954156 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171614684 20:26957193-26957215 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171614796 20:26958894-26958916 CTTTTGTGGAATATGCAAGTGGG + Intergenic
1171614981 20:26961614-26961636 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171615292 20:26966201-26966223 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171615409 20:26967899-26967921 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171615609 20:26970961-26970983 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171615791 20:26973680-26973702 TTTTTGTGGAATATGAAAGTGGG + Intergenic
1171616157 20:26979117-26979139 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171616306 20:26981326-26981348 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171617213 20:26994926-26994948 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171617396 20:26997645-26997667 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171617604 20:27000706-27000728 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171617795 20:27003597-27003619 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171617973 20:27006316-27006338 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171618131 20:27008694-27008716 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171618241 20:27010396-27010418 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171618423 20:27013116-27013138 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171618712 20:27017537-27017559 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171618896 20:27020256-27020278 TTTTTGTGGAATATGAAAGTGGG + Intergenic
1171619098 20:27023319-27023341 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171619192 20:27024678-27024700 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171619375 20:27027396-27027418 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171619557 20:27030115-27030137 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171619920 20:27035554-27035576 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171620006 20:27036918-27036940 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171620318 20:27041680-27041702 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171620431 20:27043380-27043402 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171620613 20:27046100-27046122 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171620781 20:27048648-27048670 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171621103 20:27053402-27053424 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171621285 20:27056122-27056144 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171621471 20:27058842-27058864 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171621652 20:27061561-27061583 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171621839 20:27064279-27064301 TTTTTGTGGAATATGAAAGTGGG + Intergenic
1171621985 20:27066662-27066684 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171622161 20:27069381-27069403 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171622341 20:27072101-27072123 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171622525 20:27074822-27074844 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171622868 20:27079924-27079946 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171623056 20:27082642-27082664 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171623166 20:27084341-27084363 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171623337 20:27086889-27086911 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171623522 20:27089609-27089631 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171623721 20:27092671-27092693 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171623832 20:27094373-27094395 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171624013 20:27097092-27097114 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171624164 20:27099478-27099500 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171624346 20:27102197-27102219 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171624530 20:27104916-27104938 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171624712 20:27107636-27107658 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171624891 20:27110353-27110375 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171625075 20:27113073-27113095 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171625365 20:27117491-27117513 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171625534 20:27120038-27120060 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171625903 20:27125478-27125500 CTTTTGTGGAATATGCAAGTGGG + Intergenic
1171626085 20:27128193-27128215 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171626197 20:27129894-27129916 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171626308 20:27131597-27131619 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171626490 20:27134317-27134339 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171626786 20:27138734-27138756 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171626967 20:27141453-27141475 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171627081 20:27143155-27143177 CTTTTGTGGAATATGCAAGTGGG + Intergenic
1171627260 20:27145875-27145897 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171627441 20:27148594-27148616 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171627783 20:27153690-27153712 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171627963 20:27156409-27156431 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171628148 20:27159128-27159150 CTTTTGTGGAATATGCAAGTGGG + Intergenic
1171628448 20:27163543-27163565 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171628632 20:27166263-27166285 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171628905 20:27170341-27170363 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171629085 20:27173060-27173082 TTTTTGTGGAATATGAAAGTGGG + Intergenic
1171629196 20:27174761-27174783 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171629375 20:27177481-27177503 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171629563 20:27180200-27180222 CTTTTGTGGAATATGCAAGTGGG + Intergenic
1171629742 20:27182919-27182941 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171629912 20:27185468-27185490 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171630202 20:27189890-27189912 TTTTTGTGGAATATGAAAGTGGG + Intergenic
1171630383 20:27192610-27192632 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171630567 20:27195329-27195351 CTTTTGTGGAATATGCAAGTGGG + Intergenic
1171630750 20:27198048-27198070 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171630930 20:27200768-27200790 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171631116 20:27203487-27203509 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171631296 20:27206206-27206228 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171631478 20:27208925-27208947 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171631658 20:27211644-27211666 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171631948 20:27216062-27216084 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171632054 20:27217765-27217787 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171632347 20:27222184-27222206 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171632527 20:27224904-27224926 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171632893 20:27230343-27230365 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171633077 20:27233066-27233088 TTTTTGTGGAATATGAAAGTGGG + Intergenic
1171633258 20:27235786-27235808 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171633443 20:27238505-27238527 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171633627 20:27241224-27241246 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171633797 20:27243772-27243794 CTTTTGTGGAATATGCAAGTGGG + Intergenic
1171634186 20:27249553-27249575 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171634369 20:27252279-27252301 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171634549 20:27254999-27255021 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171634595 20:27255679-27255701 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171634781 20:27258398-27258420 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171635147 20:27263834-27263856 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171635331 20:27266553-27266575 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171635494 20:27268931-27268953 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171635673 20:27271650-27271672 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171635835 20:27274029-27274051 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171636015 20:27276748-27276770 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171636255 20:27280317-27280339 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171636437 20:27283036-27283058 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171636621 20:27285759-27285781 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171636804 20:27288481-27288503 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171637005 20:27291542-27291564 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171637184 20:27294262-27294284 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171637634 20:27301184-27301206 TTTTTGTGGAATATGAAAGTGGG + Intergenic
1171637816 20:27303904-27303926 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171637997 20:27306624-27306646 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171638179 20:27309342-27309364 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171638363 20:27312062-27312084 CTTTTGTGGAATATGCAAGTGGG + Intergenic
1171638565 20:27315122-27315144 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171638745 20:27317842-27317864 CTTTTGTGGAATATGCAAGTGGG + Intergenic
1171638855 20:27319543-27319565 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171638968 20:27321245-27321267 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171639148 20:27323964-27323986 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171639331 20:27326684-27326706 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171639516 20:27329403-27329425 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171639868 20:27334499-27334521 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171640042 20:27337049-27337071 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171640401 20:27342486-27342508 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171640762 20:27347925-27347947 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171640874 20:27349628-27349650 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171641045 20:27352177-27352199 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171641339 20:27356596-27356618 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171641543 20:27359658-27359680 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171641837 20:27364077-27364099 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171642018 20:27366796-27366818 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171642202 20:27369516-27369538 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171642386 20:27372235-27372257 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171642570 20:27374952-27374974 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171642748 20:27377671-27377693 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171642934 20:27380391-27380413 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171643115 20:27383108-27383130 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171643296 20:27385826-27385848 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171643476 20:27388545-27388567 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171643660 20:27391266-27391288 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171643843 20:27393986-27394008 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171644025 20:27396706-27396728 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171644210 20:27399426-27399448 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171644340 20:27401470-27401492 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171644521 20:27404190-27404212 TTTTTGTGGAATATGAAAGTGGG + Intergenic
1171644728 20:27407252-27407274 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171645003 20:27411331-27411353 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171645181 20:27414050-27414072 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171645382 20:27417111-27417133 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171645563 20:27419829-27419851 CTTTTGTGGAATATGCAAGTGGG + Intergenic
1171645746 20:27422550-27422572 TTTTTGTGGAATATGAAAGTGGG + Intergenic
1171646002 20:27426286-27426308 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171646344 20:27431378-27431400 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171646530 20:27434098-27434120 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171646705 20:27436642-27436664 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171646888 20:27439361-27439383 CTTTTGTGGAATATGCAAGTGGG + Intergenic
1171647056 20:27441910-27441932 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171647238 20:27444629-27444651 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171647418 20:27447348-27447370 TTTTTGTGGAATATGAAAGTGGG + Intergenic
1171647620 20:27450409-27450431 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171647899 20:27454489-27454511 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171648085 20:27457209-27457231 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171648196 20:27458911-27458933 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171648378 20:27461630-27461652 CTTTTGTGGAATATGCAAGTGGG + Intergenic
1171648559 20:27464349-27464371 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171648745 20:27467068-27467090 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171649038 20:27471485-27471507 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171649238 20:27474546-27474568 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171649424 20:27477265-27477287 CTTTTGTGGAATATGCAAGTGGG + Intergenic
1171649623 20:27480327-27480349 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171649806 20:27483045-27483067 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171649992 20:27485763-27485785 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171650176 20:27488482-27488504 CTTTTGTGGAATATGCAAGTGGG + Intergenic
1171650537 20:27493920-27493942 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171650898 20:27499357-27499379 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171651082 20:27502075-27502097 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171651342 20:27506068-27506090 TTTTTGTGGAATATGAAAGTGGG + Intergenic
1171651539 20:27509130-27509152 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171651719 20:27511849-27511871 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171651880 20:27514226-27514248 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171652066 20:27516946-27516968 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171652241 20:27519738-27519760 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171652350 20:27521439-27521461 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171652457 20:27523141-27523163 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171652588 20:27525184-27525206 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171652770 20:27527903-27527925 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171652950 20:27530622-27530644 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171653130 20:27533341-27533363 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171653497 20:27538952-27538974 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171653609 20:27540653-27540675 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171653779 20:27543202-27543224 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171653893 20:27544903-27544925 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171654074 20:27547623-27547645 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171654256 20:27550342-27550364 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171654438 20:27553062-27553084 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171654801 20:27558501-27558523 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171655284 20:27565639-27565661 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171655467 20:27568360-27568382 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171655647 20:27571079-27571101 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171655762 20:27572777-27572799 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171656112 20:27578045-27578067 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171656291 20:27580762-27580784 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171656479 20:27583648-27583670 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171656660 20:27586367-27586389 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171656932 20:27590446-27590468 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171657113 20:27593165-27593187 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171657297 20:27595886-27595908 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171657478 20:27598605-27598627 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171658056 20:27607270-27607292 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171658166 20:27608971-27608993 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171658366 20:27612035-27612057 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171658567 20:27615096-27615118 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171658746 20:27617815-27617837 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171658853 20:27619516-27619538 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171659033 20:27622233-27622255 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171659194 20:27624610-27624632 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171659378 20:27627329-27627351 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171659540 20:27629707-27629729 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171659713 20:27632255-27632277 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171659887 20:27634802-27634824 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171660088 20:27637860-27637882 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171660274 20:27640580-27640602 CTTTTGTGGAATATGCAAGTGGG + Intergenic
1171660456 20:27643299-27643321 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171660658 20:27646360-27646382 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171660907 20:27650100-27650122 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171661090 20:27652821-27652843 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171661595 20:27660302-27660324 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171661759 20:27662679-27662701 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171662015 20:27666416-27666438 CTTTTGTGGAATATGCAAGTGGG + Intergenic
1171662121 20:27668117-27668139 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171662212 20:27669476-27669498 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171662396 20:27672193-27672215 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171662579 20:27674912-27674934 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171662760 20:27677632-27677654 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171662941 20:27680353-27680375 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171663050 20:27682054-27682076 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171663405 20:27687323-27687345 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171663738 20:27692250-27692272 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171663910 20:27694798-27694820 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171664091 20:27697518-27697540 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171664273 20:27700237-27700259 CTTTTGTGGAATATGCAAGTGGG + Intergenic
1171664450 20:27702956-27702978 TTTTTGTGGAATATGAAAGTGGG + Intergenic
1171664560 20:27704657-27704679 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171664737 20:27707378-27707400 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171664940 20:27710441-27710463 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171665099 20:27712817-27712839 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171665269 20:27715365-27715387 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171665448 20:27718084-27718106 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171665916 20:27725222-27725244 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171666088 20:27727770-27727792 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171666273 20:27730490-27730512 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171666456 20:27733209-27733231 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171666638 20:27735929-27735951 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171666890 20:27739667-27739689 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171667247 20:27745104-27745126 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171667428 20:27747824-27747846 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171667609 20:27750543-27750565 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171667793 20:27753262-27753284 TTTCTGTGGAATATGGAAGTGGG + Intergenic
1171667880 20:27754621-27754643 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171668048 20:27757168-27757190 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171668500 20:27763796-27763818 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171668682 20:27766515-27766537 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171668847 20:27769062-27769084 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171669027 20:27771779-27771801 TTTTTGTGGAATATGAAAGTGGG + Intergenic
1171669316 20:27776199-27776221 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171669498 20:27778918-27778940 CTTTTGTGGAATATGCAAGTGGG + Intergenic
1171669681 20:27781640-27781662 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171669795 20:27783342-27783364 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171669975 20:27786062-27786084 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171670176 20:27789122-27789144 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171670359 20:27791843-27791865 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171670540 20:27794562-27794584 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171670991 20:27801185-27801207 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171671172 20:27803904-27803926 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171671594 20:27810188-27810210 CTTTTGTGGAATATGCAAGTGGG + Intergenic
1171671957 20:27815626-27815648 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171672139 20:27818345-27818367 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171672224 20:27819710-27819732 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171672577 20:27824977-27824999 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171672930 20:27830246-27830268 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171673111 20:27832964-27832986 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171673224 20:27834665-27834687 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171673408 20:27837385-27837407 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171673589 20:27840107-27840129 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171673773 20:27842826-27842848 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171673884 20:27844527-27844549 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171674066 20:27847246-27847268 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171674235 20:27849794-27849816 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171674349 20:27851495-27851517 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171674530 20:27854216-27854238 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171674710 20:27856935-27856957 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171674889 20:27859655-27859677 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171675001 20:27861356-27861378 TTTTTGTGGAATATGAAAGTGGG + Intergenic
1171675112 20:27863058-27863080 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171675222 20:27864759-27864781 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171675409 20:27867480-27867502 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171675592 20:27870201-27870223 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171675846 20:27874005-27874027 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171676019 20:27876554-27876576 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171676201 20:27879273-27879295 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171676381 20:27881992-27882014 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171676541 20:27884369-27884391 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171676910 20:27889975-27889997 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171677258 20:27895240-27895262 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171677369 20:27896941-27896963 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171677551 20:27899659-27899681 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171677733 20:27902378-27902400 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171678184 20:27909177-27909199 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171678355 20:27911725-27911747 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171678538 20:27914446-27914468 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171678701 20:27916825-27916847 CTTTTGTGGAATATGCAAGTGGG + Intergenic
1171678857 20:27919210-27919232 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171679039 20:27921930-27921952 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171679221 20:27924649-27924671 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171679402 20:27927368-27927390 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171679514 20:27929070-27929092 TTTTTGTGGAATATGAAAGTGGG + Intergenic
1171679791 20:27933318-27933340 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171679974 20:27936037-27936059 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171680144 20:27938585-27938607 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171680323 20:27941306-27941328 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171680412 20:27942665-27942687 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171680596 20:27945385-27945407 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171680838 20:27948954-27948976 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171681252 20:27955070-27955092 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171681364 20:27956771-27956793 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171681715 20:27962037-27962059 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171682012 20:27966453-27966475 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171682196 20:27969172-27969194 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171682379 20:27971890-27971912 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171683170 20:27983784-27983806 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171683350 20:27986505-27986527 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171683530 20:27989225-27989247 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171683715 20:27991944-27991966 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171684041 20:27996707-27996729 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171684217 20:27999426-27999448 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171684513 20:28003848-28003870 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171684866 20:28009282-28009304 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171685326 20:28016248-28016270 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171685505 20:28018968-28018990 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171685689 20:28021687-28021709 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171685928 20:28025253-28025275 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171686109 20:28027972-28027994 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171686368 20:28031710-28031732 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171686480 20:28033411-28033433 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171686666 20:28036130-28036152 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171686849 20:28038851-28038873 TTTTTGTGGAATATGAAAGTGGG + Intergenic
1171687019 20:28041397-28041419 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171687190 20:28043946-28043968 CTTTTGTGGAATATGCAAGTGGG + Intergenic
1171687341 20:28046324-28046346 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171687509 20:28048872-28048894 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171687911 20:28054992-28055014 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171688094 20:28057713-28057735 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171688227 20:28059752-28059774 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171688862 20:28069097-28069119 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171689114 20:28072833-28072855 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171689349 20:28076400-28076422 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171689462 20:28078103-28078125 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171689646 20:28080822-28080844 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171689756 20:28082524-28082546 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171689957 20:28085585-28085607 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171690127 20:28088134-28088156 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171690379 20:28091873-28091895 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171690549 20:28094421-28094443 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171690756 20:28097482-28097504 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171690924 20:28100033-28100055 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171691186 20:28103945-28103967 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171691298 20:28105646-28105668 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171691470 20:28108194-28108216 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171691653 20:28110914-28110936 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171691835 20:28113633-28113655 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171692019 20:28116353-28116375 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171692173 20:28118733-28118755 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171692349 20:28121281-28121303 TTTTTGTGGAATATGAAAGTGGG + Intergenic
1171692531 20:28124000-28124022 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171692701 20:28126549-28126571 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171693060 20:28131820-28131842 TTTTTGTGGAATATGAAAGTGGG + Intergenic
1171693243 20:28134539-28134561 CTTTTGTGGAATATGCAAGTGGG + Intergenic
1171693494 20:28138277-28138299 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171693676 20:28140996-28141018 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171693790 20:28142699-28142721 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171694033 20:28146267-28146289 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171694205 20:28148814-28148836 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171694389 20:28151535-28151557 TTTTTGTGGAATATGTAAGTGGG + Intergenic
1171694573 20:28154256-28154278 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171694817 20:28158001-28158023 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171695356 20:28165986-28166008 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171695525 20:28168535-28168557 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171695656 20:28170578-28170600 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171695701 20:28171258-28171280 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171695892 20:28174148-28174170 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171696063 20:28176698-28176720 TTTTTGTGGAATATGAAAGTGGG + Intergenic
1171696233 20:28179246-28179268 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171696439 20:28182078-28182100 CTTTTGTGGAATATGCAAGTGGG + Intergenic
1171696548 20:28183777-28183799 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171696724 20:28186325-28186347 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171696894 20:28188873-28188895 TTTTTGTGGAATATGAAAGTGGG + Intergenic
1171697066 20:28191425-28191447 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171697259 20:28194315-28194337 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171697419 20:28196693-28196715 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171697657 20:28200259-28200281 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171697828 20:28202808-28202830 CTTTTGTGGAATATGCAAGTGGG + Intergenic
1171697997 20:28205357-28205379 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171698164 20:28207905-28207927 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171698331 20:28210454-28210476 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171698520 20:28213346-28213368 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171698695 20:28215894-28215916 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171698874 20:28218615-28218637 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171699045 20:28221163-28221185 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171699154 20:28222864-28222886 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171699325 20:28225412-28225434 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171699432 20:28227113-28227135 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171699786 20:28232551-28232573 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171699956 20:28235099-28235121 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171700193 20:28238672-28238694 TTTTTGTGGAATATGAAAGTGGG + Intergenic
1171700361 20:28241221-28241243 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171700491 20:28243265-28243287 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171700792 20:28247856-28247878 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171700900 20:28249557-28249579 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171701012 20:28251256-28251278 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171701262 20:28254994-28255016 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171701440 20:28257799-28257821 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171701606 20:28260347-28260369 TTTTTGTGGAATATGAAAGTGGG + Intergenic
1171701716 20:28262048-28262070 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171701826 20:28263749-28263771 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171702016 20:28266640-28266662 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171702128 20:28268341-28268363 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171702239 20:28270042-28270064 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171702421 20:28272761-28272783 CTTTTGTGGAATATGCAAGTGGG + Intergenic
1171702532 20:28274463-28274485 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171702701 20:28277011-28277033 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171702813 20:28278714-28278736 TTTTTGTGGAATATGAAAGTGGG + Intergenic
1171702924 20:28280415-28280437 CTTTTGTGGAATATGCAAGTGGG + Intergenic
1171703093 20:28282963-28282985 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171703223 20:28285006-28285028 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171703396 20:28287556-28287578 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171703646 20:28291292-28291314 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171703812 20:28293840-28293862 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171704153 20:28298935-28298957 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171704273 20:28300805-28300827 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171704444 20:28303352-28303374 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171704557 20:28305053-28305075 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171704667 20:28306754-28306776 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171704775 20:28308460-28308482 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171704946 20:28311007-28311029 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171705076 20:28313050-28313072 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171705242 20:28315598-28315620 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171705548 20:28320139-28320161 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171705722 20:28322687-28322709 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171705893 20:28325236-28325258 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171706003 20:28326939-28326961 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171706170 20:28329487-28329509 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171706341 20:28332036-28332058 CTTTTGTGGAATATGCAAGTGGG + Intergenic
1171706510 20:28334583-28334605 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171706622 20:28336285-28336307 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171706933 20:28341036-28341058 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171707105 20:28343583-28343605 TTTTTGTGGAATATGGAAGTGGG + Intergenic
1171707275 20:28346131-28346153 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171707558 20:28350382-28350404 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171707668 20:28352083-28352105 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171707840 20:28354631-28354653 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171707952 20:28356333-28356355 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171708234 20:28360581-28360603 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171708400 20:28363130-28363152 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171708745 20:28368226-28368248 CTTTTGTGGAATATGCAAGTGGG + Intergenic
1171708857 20:28369927-28369949 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171709025 20:28372475-28372497 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171709193 20:28375023-28375045 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171709528 20:28380120-28380142 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171709702 20:28382669-28382691 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171709874 20:28385217-28385239 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171710021 20:28387424-28387446 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171710188 20:28389973-28389995 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171710527 20:28395070-28395092 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171710708 20:28397789-28397811 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171710876 20:28400338-28400360 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171710985 20:28402039-28402061 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171711158 20:28404588-28404610 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171711570 20:28410701-28410723 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171711740 20:28413253-28413275 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171711851 20:28414953-28414975 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171712017 20:28417506-28417528 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171712276 20:28421417-28421439 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171712445 20:28423965-28423987 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171712621 20:28426516-28426538 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171712793 20:28429066-28429088 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171712962 20:28431615-28431637 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171713131 20:28434163-28434185 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171713300 20:28436711-28436733 TTTTTGTGGAATATGAAAGTGGG + Intergenic
1171713470 20:28439258-28439280 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171713639 20:28441806-28441828 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171713999 20:28447223-28447245 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171714169 20:28449771-28449793 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171714343 20:28452320-28452342 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171714514 20:28454867-28454889 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171714683 20:28457417-28457439 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171714854 20:28459966-28459988 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171715198 20:28465061-28465083 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171715364 20:28467609-28467631 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171715532 20:28470157-28470179 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171715701 20:28472705-28472727 TTTTTGTGGAATATGAAAGTGGG + Intergenic
1171715869 20:28475254-28475276 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171716207 20:28480351-28480373 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171716377 20:28482899-28482921 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171716547 20:28485449-28485471 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171716716 20:28487999-28488021 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171716888 20:28490548-28490570 CTTTTGTGGAATATGCAAGTGGG + Intergenic
1171717058 20:28493095-28493117 TTTTTGTGGAATATGCAAGTGGG + Intergenic
1171728397 20:28650743-28650765 TTTTTGTTGTATATGCAAGTGGG + Intergenic
1171728728 20:28656710-28656732 TTTTTGTTGTATATGCAAGTGGG + Intergenic
1171730792 20:28694658-28694680 TTTTTGTTGTATATGCAAGTGGG + Intergenic
1171731314 20:28704073-28704095 TTTTTGTTGTATATGCAAGTGGG + Intergenic
1171731910 20:28715142-28715164 TTTTTGTTGTATATGCAAGTGGG + Intergenic
1171732020 20:28717184-28717206 TTTTTGTTGTATATGCAAGTGGG + Intergenic
1171732143 20:28719417-28719439 TTTTTGTTGTATATGCAAGTGGG + Intergenic
1171743677 20:28937198-28937220 TTTTTGAAGAATCTGCAAGTGGG + Intergenic
1171744599 20:28956346-28956368 TTTTTGTAGAATCTGGAAGTGGG + Intergenic
1171825486 20:29898782-29898804 ATTTTGTAGAATCTGCAAGTGGG + Intergenic
1173785088 20:45787153-45787175 ATCTTGATGCCTATGGAAGGTGG - Intronic
1174874579 20:54212858-54212880 ATTTTGATGAATATGGAAGTTGG - Intronic
1175433795 20:58928199-58928221 ATATTGATAATTATTGAAGTTGG + Intergenic
1176317920 21:5267618-5267640 TTTTTGTTGTATATGCAAGTGGG - Intergenic
1176475783 21:7204393-7204415 TTTTTGTTGTATATGCAAGTGGG - Intergenic
1176677848 21:9797306-9797328 CTTTTGAAGAAAATGGAAGTAGG - Intergenic
1176703638 21:10091593-10091615 ATCTTGATGAACAAGGAAATGGG - Intergenic
1176968514 21:15238783-15238805 ATTTTCATGAATGTGAAAATTGG + Intergenic
1177087340 21:16722851-16722873 ATTTTGATGATTATGGGATTGGG + Intergenic
1178033327 21:28553659-28553681 TTATTGATGAATATGGTAATTGG - Intergenic
1178058087 21:28821487-28821509 AGTTTGAGGAATTTGGAAGGAGG + Intergenic
1180399775 22:12402590-12402612 TTTTTGTAGAATCTGGAAGTGGG + Intergenic
1183215688 22:36478344-36478366 ATTTTGTTCAGTAAGGAAGTGGG - Intronic
1183926297 22:41208718-41208740 ATTTTGATGTATATTGAACGGGG + Intronic
949694351 3:6677088-6677110 ATTTAGACAAATATGGAAATGGG - Intergenic
952393238 3:32898820-32898842 TTTTTGTTGAATATAAAAGTTGG + Intergenic
956037166 3:65106506-65106528 ATATTGAAGAATAAGGGAGTTGG + Intergenic
956105574 3:65814225-65814247 ATGTAGATGAATATGAAAGAAGG - Intronic
958207850 3:90427963-90427985 TTTTTGATGGATCTGCAAGTGGG - Intergenic
959748495 3:109805365-109805387 ATTGTGGTCAAGATGGAAGTGGG + Intergenic
960293773 3:115917869-115917891 ATTTTTATATTTATGGAAGTTGG - Intronic
960648227 3:119914365-119914387 ATTCTGATAAATTTGGAAGAGGG - Intronic
961766556 3:129216209-129216231 GATTTTATGAATATGTAAGTAGG - Intergenic
962732059 3:138292629-138292651 ATGGTGAGGAATATAGAAGTGGG + Intronic
963534783 3:146513995-146514017 ATTGTGCTGAATATGAAAGAGGG + Intergenic
963909695 3:150805622-150805644 TTTGTGATGATTGTGGAAGTGGG + Intergenic
964184668 3:153928414-153928436 ATATTGATGCATATGCAGGTTGG + Intergenic
964929107 3:161994484-161994506 ATTATTATGAATATAGAGGTTGG - Intergenic
965114068 3:164465397-164465419 GTTTGGATGATTATGGAAGTGGG + Intergenic
965154326 3:165027570-165027592 ATGTTGTTGAATTTGGAATTTGG - Intronic
965953908 3:174344949-174344971 ATTTTGATAAATCAGGAAGCTGG - Intergenic
966611915 3:181875968-181875990 AATTTTATGAATCTGTAAGTAGG + Intergenic
967986811 3:195101300-195101322 ATTTTGATGAAGGTGGCAGTGGG - Intronic
968951773 4:3699026-3699048 ATATTGATGATTGTTGAAGTGGG + Intergenic
970013066 4:11481833-11481855 ATGTTGAAGAATAGGGAAATGGG - Intergenic
970049018 4:11890840-11890862 ATTTTGAGAAATTTGTAAGTAGG + Intergenic
972210093 4:36825861-36825883 AGTTAGATGAATATGTATGTAGG - Intergenic
972249307 4:37282788-37282810 ACTTTGATGATTGTGGAAATGGG - Intronic
972310145 4:37873827-37873849 TTGTTGATGAATATTGAGGTTGG + Intergenic
973201666 4:47510359-47510381 ATTTTGGTGAAGATAGAATTAGG - Intronic
973324263 4:48841724-48841746 TTTTTTATGATAATGGAAGTTGG - Intronic
974756379 4:66213915-66213937 TTTTGGATGAATATAGAATTTGG - Intergenic
975548239 4:75582929-75582951 ATTTTATTGGATATGGAATTTGG - Intronic
976124938 4:81823709-81823731 ATGTTGCTTGATATGGAAGTAGG - Intronic
977065463 4:92307487-92307509 ATTTTCATGTATATATAAGTTGG - Intronic
977146343 4:93445570-93445592 ATTTAGCTGAACATGGAAGTTGG - Intronic
977408789 4:96634852-96634874 ATTTTGAAGAGTATTGAATTAGG - Intergenic
978261355 4:106764052-106764074 ATATTTATAAATATGAAAGTTGG + Intergenic
978398323 4:108306043-108306065 ATGTTGATGATTAGGGGAGTGGG - Intergenic
978737554 4:112101064-112101086 ACTTTGAAGAATATGGAATATGG + Intergenic
979192461 4:117878666-117878688 TTTTTCATGAATGTGGAAGGAGG - Intergenic
979287627 4:118943727-118943749 ATTTTTATGAAAATGGCATTGGG - Intronic
980239512 4:130155473-130155495 AGTTTTATCAATATGGAAATTGG - Intergenic
980375854 4:131947939-131947961 ATCTTGATGAACAAGGAAATGGG - Intergenic
980530409 4:134045923-134045945 AATTTGATGAAAATGGTAATGGG - Intergenic
981063667 4:140457357-140457379 GATTTGATAAATATGAAAGTCGG + Intronic
981218077 4:142195540-142195562 AACTTGATGAATTTGGACGTAGG - Intronic
981621165 4:146700270-146700292 ATTTTGATAAAAATGGAATCAGG + Intergenic
981910681 4:149978303-149978325 ATTTTGATGCATATAAAAGCAGG - Intergenic
983087387 4:163464106-163464128 ATTTTTATGAATATATACGTTGG - Intergenic
983211458 4:164962597-164962619 ATTTTGATAAATATGCTAATTGG - Intronic
983331598 4:166335700-166335722 ATTTTGCTGAATATAGATTTGGG - Intergenic
983890219 4:173022657-173022679 ATTTTGGTGAAAATGTAAATGGG - Intronic
983943138 4:173557377-173557399 ATCTTGATGAATTTGGACCTGGG + Intergenic
984360070 4:178718231-178718253 ATTTTTAGGAGTATGAAAGTGGG + Intergenic
984836554 4:184027811-184027833 GATTTGATAAATATGGAAATAGG + Intergenic
985397678 4:189561483-189561505 CTTTTGAAGAAAATGGAAGTAGG + Intergenic
985886069 5:2679956-2679978 ATTTAGTTTAATGTGGAAGTTGG + Intergenic
987024854 5:13915520-13915542 ATTTTAACGTATAAGGAAGTTGG + Intronic
987879576 5:23725933-23725955 ATTTTGATGTATATCACAGTAGG - Intergenic
988387080 5:30578253-30578275 ATTATGATGAATATGTAGATGGG + Intergenic
988460939 5:31437409-31437431 ATTATGAGGAATAGGGAAGGTGG - Intronic
988833938 5:35013400-35013422 CTTTTGAGGTATATGGAAGAGGG - Intronic
989589490 5:43100311-43100333 ATTTTGATAATATTGGAAGTGGG - Intronic
989775412 5:45200767-45200789 ATGAGAATGAATATGGAAGTGGG - Intergenic
989858025 5:46324066-46324088 TTTTTGTAGAATCTGGAAGTGGG - Intergenic
989861568 5:46384393-46384415 TTTTTGAAGAATTTGCAAGTGGG + Intergenic
990127994 5:52542810-52542832 ATTTAAATGAACATAGAAGTTGG - Intergenic
990576108 5:57125033-57125055 ATATTGATAATTATAGAAGTTGG - Intergenic
990731630 5:58815166-58815188 ATTGTGTTGAATGTGGAACTTGG - Intronic
991267090 5:64732746-64732768 ATTTTGATGAAGAATAAAGTGGG + Intronic
992071037 5:73149572-73149594 ATGTTGTTGAATATGTGAGTGGG - Intergenic
992617686 5:78560804-78560826 TTTTTGAAGATTATGAAAGTGGG - Intronic
993031552 5:82712436-82712458 TTTTGGATGAGTATGGAAGGAGG + Intergenic
993109512 5:83639481-83639503 ATTTTGTTGAAAATACAAGTGGG - Exonic
993145531 5:84089051-84089073 GTTTTGATGAAAATGGAAATAGG + Intronic
993883145 5:93386321-93386343 ATTTTGATACATATGAAAGGAGG - Intergenic
995250090 5:109983356-109983378 AGTGTGATGAATAAGTAAGTTGG - Intergenic
995310456 5:110704598-110704620 AATCTAATTAATATGGAAGTAGG + Intronic
995443337 5:112215830-112215852 ATTTTGAAGAGTATGTCAGTCGG + Intronic
995928394 5:117404940-117404962 ACTTTCATGAATATGAAAGTTGG + Intergenic
996482066 5:123987126-123987148 AATTTCCTGAATTTGGAAGTTGG + Intergenic
996743281 5:126821916-126821938 ATGTGGATGAATATGTAATTTGG + Intronic
997019607 5:129983375-129983397 ATGTTGACAAATATGGATGTAGG - Intronic
999577561 5:152996528-152996550 ACTTTTATGAATATGGATGGAGG - Intergenic
1000437261 5:161228137-161228159 ATATTGATGGCTATTGAAGTTGG + Intergenic
1000756724 5:165170262-165170284 ATTTTGATGGATTGGGAATTAGG + Intergenic
1000781092 5:165482514-165482536 ATTTTGATGATTAGTGAAATGGG - Intergenic
1001968057 5:175927862-175927884 ATTTTTATCAAGATGGAGGTTGG - Intronic
1002830835 6:818992-819014 ATTTTGATGATCATGCAGGTAGG + Intergenic
1003800248 6:9656611-9656633 ATTTTGCTGAATATTGAAAATGG + Intronic
1005382681 6:25252966-25252988 AATATGCTGAAGATGGAAGTAGG - Intergenic
1005387264 6:25297819-25297841 ACTCTGATGAATAAAGAAGTTGG - Intronic
1005437790 6:25833667-25833689 ATATTGATAATTATTGAAGTGGG - Intronic
1005630942 6:27707273-27707295 ATTTTGATGAATGCCAAAGTTGG + Intergenic
1009552861 6:65121360-65121382 ATTTTCATTAAGATGGAATTAGG + Intronic
1010383151 6:75247380-75247402 ATTTTTATAAAATTGGAAGTTGG - Intronic
1011352793 6:86441057-86441079 AATGTGATGAATTAGGAAGTGGG + Intergenic
1011499500 6:87972368-87972390 ATATTGATAAATATGGAGATAGG - Intergenic
1011526512 6:88271153-88271175 CTTTTGATGGAAATGGAAGTGGG + Intergenic
1012849805 6:104432901-104432923 ATTTTTATGCATATTGGAGTTGG - Intergenic
1014702105 6:124702612-124702634 AGTGTGATGAGTATGGAAGTGGG - Intronic
1015260251 6:131229012-131229034 CTTTTGCTGCATATTGAAGTAGG + Intronic
1015592419 6:134834783-134834805 ATTTTGAAGACTATGAAAATGGG - Intergenic
1016197411 6:141362024-141362046 ATTTTGATGTGAAGGGAAGTAGG - Intergenic
1016861758 6:148727373-148727395 ATTTTCTTGTATATGGAAATTGG + Intergenic
1018274216 6:162113018-162113040 ATTTTCATGAAAATGGAAGCAGG + Intronic
1018496456 6:164351335-164351357 ATGTTCAAGAATAAGGAAGTAGG + Intergenic
1019182442 6:170199079-170199101 AATGTGATGAATGGGGAAGTTGG + Intergenic
1019256238 7:53949-53971 ATTTCAATGAATGTGGCAGTAGG - Intergenic
1019923110 7:4175192-4175214 ATGTTGATGAATGTTGAAGACGG + Intronic
1020372883 7:7453673-7453695 ATTTCTATTAATATGGAAATAGG - Intronic
1021763236 7:23921665-23921687 GTTTTGAAGAAAATGGTAGTTGG + Intergenic
1022701889 7:32769187-32769209 CTTTGGATGAATATTGAAGTGGG - Intergenic
1022906125 7:34859345-34859367 CTTTGGATGAATACTGAAGTGGG - Intronic
1023385800 7:39656718-39656740 AGATTGGTGAATGTGGAAGTGGG + Intronic
1023951733 7:44851353-44851375 ATTTTGATGAAAGTGGAGTTAGG + Intergenic
1024192678 7:47028896-47028918 ATTTTAATGAAAATTGAATTGGG - Intergenic
1024312769 7:47984810-47984832 ATTTACATGTATGTGGAAGTTGG - Intergenic
1024367680 7:48540157-48540179 TTTTTGTTGAATTTGGAGGTAGG + Intronic
1024537910 7:50453505-50453527 AAATTCATGAATATGGAAATGGG - Intronic
1024707237 7:51973633-51973655 ATTTTGATGGATAAGGAAATGGG + Intergenic
1025313259 7:57979803-57979825 TTTTTGTAGAATATGCAAGTAGG - Intergenic
1026405097 7:70056844-70056866 ATTTTGATGCATTTGGGAATAGG + Intronic
1027838779 7:83279948-83279970 ATGGTGAGGAATATGAAAGTAGG - Intergenic
1028674750 7:93445882-93445904 ATTTTTATGAATTTGTAAATTGG - Intronic
1030370865 7:108697662-108697684 ATTTTGATAACTATGGTAGAGGG + Intergenic
1030710047 7:112739425-112739447 ATTTTGATGGTAATGGGAGTGGG + Intergenic
1031491653 7:122397099-122397121 ATTCTAATGAATATAAAAGTTGG + Intronic
1032613823 7:133444326-133444348 AAATTGATGCATATGGAAGGAGG - Intronic
1034117665 7:148598486-148598508 ATTTTCATGATTAAGGAAGCAGG - Intronic
1034294987 7:149964243-149964265 TTTTTGATGAATAAGGAATAGGG + Intergenic
1034811074 7:154132703-154132725 TTTTTGATGAATAAGGAATAGGG - Intronic
1035113017 7:156500228-156500250 ATTTGGAAGAAGATGGAAGAAGG + Intergenic
1035388089 7:158488147-158488169 CTTTTGATGATAATGGAAGCAGG - Intronic
1036482727 8:9152371-9152393 ATTATGTTGAATATGGCATTTGG + Intronic
1037052281 8:14391009-14391031 AGTTTTCTGAATCTGGAAGTAGG - Intronic
1038294684 8:26280264-26280286 ATTATGGTAAAAATGGAAGTGGG + Intergenic
1038872059 8:31505378-31505400 ACTGCAATGAATATGGAAGTGGG + Intergenic
1039715648 8:40105802-40105824 ATTTTTATAAATATGCAAGAAGG + Intergenic
1040482048 8:47835045-47835067 ATTTTGTTGGTTCTGGAAGTGGG - Intronic
1040565084 8:48557755-48557777 ATTTTGATGAATTTGCCAGAAGG + Intergenic
1041621490 8:59975144-59975166 ATTTTGTTCAACATGTAAGTAGG + Intergenic
1042480156 8:69293447-69293469 ATTTTGATGAATTTTTAACTTGG + Intergenic
1042778082 8:72457344-72457366 ATTTTTGTGAACATGGTAGTAGG + Intergenic
1044271052 8:90244567-90244589 ATTTTTATGAATCTGCAATTTGG + Intergenic
1044298901 8:90560937-90560959 TTTTAGATGAAAATGGTAGTTGG + Intergenic
1044516113 8:93140676-93140698 ATTTTAATGAATAGGTAATTGGG - Intronic
1044522487 8:93215443-93215465 CTTTTGAAGAATAAAGAAGTTGG + Intergenic
1045138692 8:99254303-99254325 TTTTTGCTGAATATAGAATTTGG + Intronic
1047127377 8:121977215-121977237 GTTTTGATGAAGAGGGAAATGGG + Intergenic
1047157355 8:122334696-122334718 ACTATGATGTATATGGAGGTGGG - Intergenic
1047194178 8:122706431-122706453 ATTTTGATGATGATGGAAGAAGG + Intergenic
1047833081 8:128657452-128657474 ATTTTGCTGAAAGTGGAGGTGGG + Intergenic
1047866614 8:129031169-129031191 ATTTTGATGAATTTGGACATAGG - Intergenic
1049291599 8:141805938-141805960 AATTTGATGACTATGAAAGATGG - Intergenic
1050871406 9:10575277-10575299 ATCTTGAAGAATATGAAAGTTGG + Intronic
1051061587 9:13051583-13051605 ATTTGGATGAAGAGGGAAGGAGG + Intergenic
1051545930 9:18274853-18274875 ACTTTGAGGAATTTGGAATTTGG + Intergenic
1052797884 9:32940798-32940820 ATTTTTATTATTATGGAAGGAGG - Intergenic
1052926872 9:34024494-34024516 CTTTTTATGAATAGGGAATTAGG - Intronic
1053577448 9:39367056-39367078 ATTATGATGAATATAGAAAGGGG - Intergenic
1053640901 9:40078607-40078629 ATCTTGATGAACAAGGAAATGGG - Intergenic
1053729609 9:41039816-41039838 ATTGTGATGATTATGGGAATGGG - Intergenic
1053765234 9:41386865-41386887 ATCTTGATGAACAAGGAAATGGG + Intergenic
1053841954 9:42195010-42195032 ATTATGATGAATATAGAAAGGGG - Intergenic
1053937063 9:43169679-43169701 ATTTTGTAGAATCTGCAAGTGGG + Intergenic
1053937600 9:43180928-43180950 TTTTTGAAGAATCTGCAAGTGGG + Intergenic
1054099023 9:60925775-60925797 ATTATGATGAATATAGAAAGGGG - Intergenic
1054120421 9:61201397-61201419 ATTATGATGAATATAGAAAGGGG - Intergenic
1054321590 9:63674589-63674611 ATCTTGATGAACAAGGAAATGGG - Intergenic
1054543849 9:66298024-66298046 ATCTTGATGAACAAGGAAATGGG + Intergenic
1054587330 9:66981159-66981181 ATTATGATGAATATAGAAAGGGG + Intergenic
1054599727 9:67108538-67108560 AATTGAATGATTATGGAAGTGGG + Intergenic
1054698898 9:68392246-68392268 ATTGTGATGATTATGGGAATGGG + Intronic
1055790771 9:79920705-79920727 TTTGTTATAAATATGGAAGTGGG + Intergenic
1055824946 9:80312769-80312791 ATTTTTATGAATATTGAAGGGGG + Intergenic
1055878733 9:80973248-80973270 ATTTTGTTCCATATGGAAGAAGG + Intergenic
1056120339 9:83481542-83481564 ATTTTAAAAAATATGGAAGAGGG + Intronic
1056487762 9:87076024-87076046 ATTTTGATGTGTGAGGAAGTGGG + Intergenic
1056673426 9:88651672-88651694 AGTTTGAGGAATATTGAACTAGG - Intergenic
1057492303 9:95530315-95530337 ATTTCTGTGAATATGGAACTTGG + Intergenic
1058234432 9:102471394-102471416 GTACTGAAGAATATGGAAGTAGG + Intergenic
1060573622 9:124667342-124667364 ATATACATGAATATGAAAGTAGG - Intronic
1202788675 9_KI270719v1_random:61689-61711 ATCTTGATGAACAAGGAAATGGG - Intergenic
1203380997 Un_KI270435v1:41961-41983 TTTTTGTAGAATCTGGAAGTGGG + Intergenic
1203400632 Un_KI270519v1:90567-90589 TTTTTGTAGAATATGCAAGTGGG + Intergenic
1203411216 Un_KI270579v1:7081-7103 TTTTTGTTGTATATGCAAGTGGG - Intergenic
1203415049 Un_KI270584v1:1423-1445 TTTTTGTAGAATCTGGAAGTGGG - Intergenic
1186627268 X:11307607-11307629 ATTTTTCTTAATCTGGAAGTAGG + Intronic
1187012619 X:15295373-15295395 ATTTAGATGACTATGGGAGTAGG + Intronic
1187907063 X:24076807-24076829 ATTCGGATGGATTTGGAAGTTGG + Exonic
1188364979 X:29304629-29304651 ATGTTGATAAATGTTGAAGTTGG + Intronic
1188950124 X:36360603-36360625 AGTTTGTTGCATATGGAACTTGG - Intronic
1189558942 X:42172858-42172880 AATTTGCTGAATAGAGAAGTGGG + Intergenic
1189814081 X:44807208-44807230 ATGTTGATAATTATTGAAGTTGG - Intergenic
1189815488 X:44820673-44820695 ATTTTCTTGACTATAGAAGTTGG - Intergenic
1190221552 X:48515423-48515445 AATTTGCTGAATTTGGATGTGGG + Intronic
1191565815 X:62528145-62528167 TTTTTGTTGAATCTGCAAGTGGG - Intergenic
1191601462 X:63013878-63013900 TTCTTGCTGAACATGGAAGTGGG - Intergenic
1191940494 X:66475292-66475314 ATTTTTAAGAATATGGACTTTGG - Intergenic
1193099675 X:77594627-77594649 AATTTGATGAAGATGGAATGTGG - Intronic
1193226245 X:78987647-78987669 ATTTTGATGGAGATGGAAGGAGG - Intergenic
1193765503 X:85524110-85524132 ATTTTGAAAAATAGGGGAGTAGG - Intergenic
1194048301 X:89035935-89035957 ATTTTGAGGAAAATGTAGGTAGG - Intergenic
1194450871 X:94043136-94043158 ATTTTTATGAATATGAACCTAGG + Intergenic
1194679459 X:96834419-96834441 ATTTTGAAGTATTTGGAAATAGG + Intronic
1195078485 X:101349219-101349241 ATTTGAATGAATCTGAAAGTTGG - Intergenic
1195463249 X:105151617-105151639 ATTTTATTGACTATTGAAGTTGG + Intronic
1196220294 X:113105967-113105989 ATTTCTATGAATATTGAAGAAGG + Intergenic
1197442217 X:126506477-126506499 ATTTTGTTGAAAATGGAGGATGG + Intergenic
1198398481 X:136246998-136247020 ATTCTGATGCATATTGAAGGTGG + Intronic
1199380861 X:147170391-147170413 AATTTCATAATTATGGAAGTGGG - Intergenic
1200408673 Y:2840503-2840525 AATTTGATGAGTATGGACATAGG - Intergenic
1200740550 Y:6849377-6849399 ATTTTTCTTAATTTGGAAGTAGG - Intergenic
1201064798 Y:10087543-10087565 TTTTTGTAGAATATGGAAGTGGG - Intergenic
1201080067 Y:10234438-10234460 TTTTTGTAGAATATGCAAGTGGG - Intergenic
1202106572 Y:21375069-21375091 ATTTTGATTGATTTGGAAGCTGG - Intergenic