ID: 1174875758

View in Genome Browser
Species Human (GRCh38)
Location 20:54224525-54224547
Sequence GGTCATGGGTCCATAGTTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 62}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174875758 Original CRISPR GGTCATGGGTCCATAGTTAT TGG Intronic
902234872 1:15050839-15050861 GGTCTTTGGTCCTTAGTCATTGG + Intronic
908767940 1:67570929-67570951 GGTCATTGGCCCAGGGTTATTGG - Intergenic
911797738 1:102095454-102095476 GGTGATGGGGCTATAGTTATGGG - Intergenic
916579443 1:166094471-166094493 AGTTCTGGGTCCATAGTGATTGG - Intronic
917740662 1:177959109-177959131 GGTAATGAGTCTATAGCTATAGG + Intronic
918323450 1:183386776-183386798 GCTCATGGATCGCTAGTTATAGG + Intronic
918638338 1:186807155-186807177 GGTCTTTGGTCCCTACTTATAGG - Intergenic
1070503777 10:77095489-77095511 GGTCAGGGCTCCATAAATATGGG + Intronic
1073398357 10:103236852-103236874 GGTTATGGGTTGATGGTTATTGG + Intergenic
1076604502 10:131680786-131680808 GATCATGGATTCACAGTTATGGG + Intergenic
1086096332 11:83053561-83053583 ACTCAAGGGTCCAGAGTTATTGG - Intronic
1100018200 12:90037793-90037815 GATCATGTGTCCATATGTATTGG - Intergenic
1102174481 12:110866381-110866403 GGTCATGGGACCATAGTGGAGGG + Intronic
1106152815 13:27122430-27122452 GGTCTTGGGTACATCTTTATTGG + Intronic
1111135644 13:84039144-84039166 AGTCATGTGTCCAGAGTTGTAGG + Intergenic
1121244807 14:92454011-92454033 GGTCCTGGGTCCAAACTTATTGG - Exonic
1129535529 15:76311196-76311218 GGACTTGGGTCCAAAGTTCTGGG - Intronic
1130269758 15:82440016-82440038 GGTCATGGCTCCCTGGTGATGGG + Intergenic
1130473718 15:84246236-84246258 GGTCATGGCTCCCTGGTGATGGG + Intergenic
1139984462 16:70886690-70886712 GATTCTGGGTCCACAGTTATTGG + Intronic
1141188540 16:81806872-81806894 GGTGATGGGGGCAGAGTTATGGG + Intronic
1143979872 17:10859581-10859603 GATCATATGTCCATTGTTATGGG + Intergenic
1145017255 17:19407559-19407581 GGTCCTGGGTCCATGTCTATGGG - Intergenic
1146311810 17:31775009-31775031 GGTCATGTGTCCTTGTTTATAGG - Intergenic
1153083624 18:1257408-1257430 TGTAATGGTCCCATAGTTATTGG - Intergenic
1157943534 18:51954838-51954860 CCTCATGGGTTCATAGCTATAGG - Intergenic
930833695 2:55772997-55773019 GGTCATGGGACAATAGTGAAGGG + Intergenic
935181419 2:100694084-100694106 GGTCATGATAACATAGTTATTGG - Intergenic
937868775 2:126772899-126772921 GGTCCTGGGTCCAAAGCTCTTGG - Intergenic
939495704 2:142925608-142925630 GGTCATGAGACCACATTTATTGG - Intronic
940665225 2:156600923-156600945 GGTGGTGGGTGCTTAGTTATTGG - Intronic
948077391 2:235175589-235175611 GGTCTTGGGTAGAGAGTTATGGG - Intergenic
1170596313 20:17808542-17808564 GGTCATGAGTCCATTGTCACAGG + Intergenic
1174875758 20:54224525-54224547 GGTCATGGGTCCATAGTTATTGG + Intronic
1179587014 21:42379922-42379944 AGTCACGGTTCCATTGTTATGGG - Intronic
1179838328 21:44052693-44052715 GGTCTTGGGCCCATAGTCCTGGG + Intronic
1183258895 22:36781481-36781503 GGTGAAGGGTTCTTAGTTATGGG + Intergenic
961176704 3:124841644-124841666 GGTGCTGGGTAAATAGTTATTGG - Intronic
972045689 4:34663183-34663205 GGTCATGGGCCCATGGGAATTGG + Intergenic
973085360 4:46052672-46052694 GCTCATGGGGCCATATTTACTGG - Intronic
984386117 4:179060055-179060077 GGCCCTGGATCCACAGTTATAGG - Intergenic
988039247 5:25867787-25867809 GCTTATGTGTCCACAGTTATAGG + Intergenic
992922074 5:81536060-81536082 GGTCTTTGGTCCATTTTTATTGG - Intronic
1001110325 5:168890711-168890733 GGCCATGGGTTGATACTTATTGG + Intronic
1002108317 5:176891282-176891304 GGTCAAGGGGCCATAGAGATGGG + Intronic
1004437824 6:15614089-15614111 GGTCATGTGTCCTTAGAGATGGG - Intronic
1010767569 6:79793822-79793844 GGTCATGTGTCCTAAGTTTTTGG + Intergenic
1011014460 6:82739711-82739733 GTTTTTGGGTCCATATTTATAGG - Intergenic
1012226908 6:96715011-96715033 GGCCATGGGGCCATAGTAAGCGG + Intergenic
1014058736 6:117046501-117046523 TGTCATGTGTCCATAATTACAGG - Intergenic
1014601929 6:123423924-123423946 GGTCATGGGCCCACACTCATGGG + Intronic
1016303053 6:142653141-142653163 GGTCATGGGTTCATGGGTACAGG + Intergenic
1018548573 6:164965622-164965644 AGTAATGTGTCCATATTTATAGG + Intergenic
1022047767 7:26636497-26636519 GTAGATGGGTCCATTGTTATTGG - Intergenic
1045015933 8:98001941-98001963 GGTCATGGGGTAATGGTTATTGG + Intronic
1052120437 9:24708987-24709009 GGTCATGGCTCTCTAGTTTTAGG + Intergenic
1055950491 9:81725429-81725451 GGTCCTGGGTGCAGAGTCATGGG + Intergenic
1185620324 X:1450065-1450087 GGTGATGGGGGCATAGTTACTGG - Intronic
1185831024 X:3303245-3303267 GGACATGTGTCCATAGATTTAGG - Intergenic
1185945164 X:4367629-4367651 GGCCATGGGTCCAGACTTAAGGG - Intergenic
1188140619 X:26546074-26546096 GGACATTGGTCCATAGTATTAGG + Intergenic
1193197970 X:78656719-78656741 GGTGATGTTTCCTTAGTTATGGG + Exonic
1200898130 Y:8397738-8397760 GGGCATAGCTCCAAAGTTATAGG - Intergenic
1202377179 Y:24247840-24247862 GGTCATGGCTCCCTGGTGATGGG - Intergenic
1202493601 Y:25422281-25422303 GGTCATGGCTCCCTGGTGATGGG + Intergenic