ID: 1174877086

View in Genome Browser
Species Human (GRCh38)
Location 20:54238585-54238607
Sequence ATTGTATCTTTGGAGATCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174877082_1174877086 26 Left 1174877082 20:54238536-54238558 CCTTTTTTTTTTGTGAGACATAT No data
Right 1174877086 20:54238585-54238607 ATTGTATCTTTGGAGATCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174877086 Original CRISPR ATTGTATCTTTGGAGATCAA AGG Intergenic
No off target data available for this crispr