ID: 1174881008

View in Genome Browser
Species Human (GRCh38)
Location 20:54279699-54279721
Sequence GATACTAATTCCATTCCTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174881006_1174881008 -8 Left 1174881006 20:54279684-54279706 CCTTTGAAAAATAAGGATACTAA No data
Right 1174881008 20:54279699-54279721 GATACTAATTCCATTCCTAAGGG No data
1174881003_1174881008 23 Left 1174881003 20:54279653-54279675 CCTCTCATGGTGGAAGGAGAAAA No data
Right 1174881008 20:54279699-54279721 GATACTAATTCCATTCCTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174881008 Original CRISPR GATACTAATTCCATTCCTAA GGG Intergenic
No off target data available for this crispr