ID: 1174881331 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 20:54282450-54282472 |
Sequence | CAGAGTAAACAGAGGTAAAG AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1174881331_1174881336 | 12 | Left | 1174881331 | 20:54282450-54282472 | CCTCTTTACCTCTGTTTACTCTG | No data | ||
Right | 1174881336 | 20:54282485-54282507 | AGTTATTTCATCTCTGACCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1174881331 | Original CRISPR | CAGAGTAAACAGAGGTAAAG AGG (reversed) | Intergenic | ||
No off target data available for this crispr |