ID: 1174881331

View in Genome Browser
Species Human (GRCh38)
Location 20:54282450-54282472
Sequence CAGAGTAAACAGAGGTAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174881331_1174881336 12 Left 1174881331 20:54282450-54282472 CCTCTTTACCTCTGTTTACTCTG No data
Right 1174881336 20:54282485-54282507 AGTTATTTCATCTCTGACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174881331 Original CRISPR CAGAGTAAACAGAGGTAAAG AGG (reversed) Intergenic
No off target data available for this crispr