ID: 1174882175

View in Genome Browser
Species Human (GRCh38)
Location 20:54292014-54292036
Sequence CTGTGGGTTAGGTGGGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174882175_1174882182 -7 Left 1174882175 20:54292014-54292036 CCCTCTCCCCACCTAACCCACAG No data
Right 1174882182 20:54292030-54292052 CCCACAGATATATCTCTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174882175 Original CRISPR CTGTGGGTTAGGTGGGGAGA GGG (reversed) Intergenic
No off target data available for this crispr