ID: 1174882882

View in Genome Browser
Species Human (GRCh38)
Location 20:54300196-54300218
Sequence CTGTGCCTTCTTTCCTTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174882882_1174882885 -5 Left 1174882882 20:54300196-54300218 CCTCTGAAGGAAAGAAGGCACAG No data
Right 1174882885 20:54300214-54300236 CACAGGGTCATACAGAAACCCGG No data
1174882882_1174882886 -2 Left 1174882882 20:54300196-54300218 CCTCTGAAGGAAAGAAGGCACAG No data
Right 1174882886 20:54300217-54300239 AGGGTCATACAGAAACCCGGAGG No data
1174882882_1174882888 3 Left 1174882882 20:54300196-54300218 CCTCTGAAGGAAAGAAGGCACAG No data
Right 1174882888 20:54300222-54300244 CATACAGAAACCCGGAGGCAGGG No data
1174882882_1174882887 2 Left 1174882882 20:54300196-54300218 CCTCTGAAGGAAAGAAGGCACAG No data
Right 1174882887 20:54300221-54300243 TCATACAGAAACCCGGAGGCAGG No data
1174882882_1174882889 10 Left 1174882882 20:54300196-54300218 CCTCTGAAGGAAAGAAGGCACAG No data
Right 1174882889 20:54300229-54300251 AAACCCGGAGGCAGGGTTTAAGG No data
1174882882_1174882892 21 Left 1174882882 20:54300196-54300218 CCTCTGAAGGAAAGAAGGCACAG No data
Right 1174882892 20:54300240-54300262 CAGGGTTTAAGGCAATACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174882882 Original CRISPR CTGTGCCTTCTTTCCTTCAG AGG (reversed) Intergenic