ID: 1174882886

View in Genome Browser
Species Human (GRCh38)
Location 20:54300217-54300239
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174882882_1174882886 -2 Left 1174882882 20:54300196-54300218 CCTCTGAAGGAAAGAAGGCACAG 0: 1
1: 0
2: 3
3: 44
4: 364
Right 1174882886 20:54300217-54300239 AGGGTCATACAGAAACCCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174882886 Original CRISPR AGGGTCATACAGAAACCCGG AGG Intergenic