ID: 1174882892

View in Genome Browser
Species Human (GRCh38)
Location 20:54300240-54300262
Sequence CAGGGTTTAAGGCAATACAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174882882_1174882892 21 Left 1174882882 20:54300196-54300218 CCTCTGAAGGAAAGAAGGCACAG No data
Right 1174882892 20:54300240-54300262 CAGGGTTTAAGGCAATACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174882892 Original CRISPR CAGGGTTTAAGGCAATACAT TGG Intergenic