ID: 1174883352

View in Genome Browser
Species Human (GRCh38)
Location 20:54304601-54304623
Sequence GTACAGGCTCCTGCCTCTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174883352_1174883355 1 Left 1174883352 20:54304601-54304623 CCCTTAGAGGCAGGAGCCTGTAC No data
Right 1174883355 20:54304625-54304647 GTTTCCCCTCAGCTAAGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174883352 Original CRISPR GTACAGGCTCCTGCCTCTAA GGG (reversed) Intergenic