ID: 1174891694

View in Genome Browser
Species Human (GRCh38)
Location 20:54402230-54402252
Sequence CTGTGGGTCCACAGAGTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174891691_1174891694 -5 Left 1174891691 20:54402212-54402234 CCAGAAAATTTATTAGGACTGTG No data
Right 1174891694 20:54402230-54402252 CTGTGGGTCCACAGAGTTGAAGG No data
1174891690_1174891694 -4 Left 1174891690 20:54402211-54402233 CCCAGAAAATTTATTAGGACTGT No data
Right 1174891694 20:54402230-54402252 CTGTGGGTCCACAGAGTTGAAGG No data
1174891689_1174891694 -3 Left 1174891689 20:54402210-54402232 CCCCAGAAAATTTATTAGGACTG No data
Right 1174891694 20:54402230-54402252 CTGTGGGTCCACAGAGTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174891694 Original CRISPR CTGTGGGTCCACAGAGTTGA AGG Intergenic
No off target data available for this crispr