ID: 1174892265

View in Genome Browser
Species Human (GRCh38)
Location 20:54408732-54408754
Sequence GTACATTCCTGAACCAAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174892263_1174892265 14 Left 1174892263 20:54408695-54408717 CCAAATCTTTATGTTGTGACTTA No data
Right 1174892265 20:54408732-54408754 GTACATTCCTGAACCAAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174892265 Original CRISPR GTACATTCCTGAACCAAAAG TGG Intergenic
No off target data available for this crispr